Вариант ларин 197: Вариант 197 Ларина, решение ЕГЭ математика 2017

Содержание

10458 — Тренировочный вариант ОГЭ (ГИА) № 197 по математике от Ларина 2019 года

Просмотр

ответы 1,6 2 3 330 4 -50/11 390 34 0,67 4 1365 1,125 19 4 90 30 76 12 0,8 12 — 1600 — 8 — 56

Ответы

Ответы к заданиям
[ ПРИ НАЛИЧИИ ] доступны
для бесплатного просмотра
только зарегистрированным
пользователям проекта!

Решения

Решения к заданиям доступны
для бесплатного просмотра
только зарегистрированным
пользователям проекта!

Файлы заданий доступны
для бесплатного скачивания
только зарегистрированным
пользователям проекта!

Оценивание

№ задания1-2021-26Всего
Баллы1232

Работа состоит из двух модулей: «Алгебра» и «Геометрия». Всего в работе 26 заданий. Модуль «Алгебра» содержит семнадцать заданий: в части 1 — четырнадцать заданий; в части 2 — три задания. Модуль

«Геометрия» содержит девять заданий: в части 1 — шесть заданий; в части 2 — три задания.

На выполнение экзаменационной работы по математике отводится 3 часа 55 минут (235 минут).

Ответы к заданиям 2, 3, 14 запишите в бланк ответов №1 в виде одной цифры, которая соответствует номеру правильного ответа.

Для остальных заданий части 1 ответом является число или последовательность цифр. Ответ запишите в поле ответа в тексте работы, а затем перенесите в бланк ответов №1. Если в ответе получена обыкновенная дробь, обратите её в десятичную.

При выполнении работы Вы можете воспользоваться справочными материалами, содержащими основные формулы курса математики, выдаваемыми вместе с работой. Разрешается использовать линейку, угольник, иные шаблоны для построения геометрических фигур (циркуль). Запрещается использовать инструменты с нанесёнными на них справочными материалами. Калькуляторы на экзамене

не используются.

На экзамене при себе надо иметь документ удостоверяющий личность (паспорт), пропуск и капиллярную или гелевую ручку с черными чернилами! Разрешают брать с собой воду (в прозрачной бутылке) и еду (фрукты, шоколадку, булочки, бутерброды), но могут попросить оставить в коридоре.

Справочные материалы

Загрузка формул…

Загрузка тестирования…

Обсуждения

Комментарии к заданиям доступны
для бесплатного просмотра
только зарегистрированным
пользователям проекта!

Тест Округление чисел (5 класс) по математике

Сложность: новичок.Последний раз тест пройден 55 минут назад.

Материал подготовлен совместно с учителем высшей категории

Опыт работы учителем математики — более 33 лет.

  1. Вопрос 1 из 10

    Округлите число 197 до десятков

    • Правильный ответ
    • Неправильный ответ

    В вопросе ошибка?

    Следующий вопросПодсказка 50/50Ответить
  2. Вопрос 2 из 10

    Округлите 98,7 до целого числа

    • Правильный ответ
    • Неправильный ответ

    В вопросе ошибка?

    Подсказка 50/50Ответить
  3. Вопрос 3 из 10

    Округлите число 597 до сотен

    • Правильный ответ
    • Неправильный ответ

    В вопросе ошибка?

    Подсказка 50/50Ответить
  4. Вопрос 4 из 10

    Округлите 4,425 до одной значащей цифры после запятой (десятых частей)

    • Правильный ответ
    • Неправильный ответ

    В вопросе ошибка?

    Подсказка 50/50Ответить
  5. Вопрос 5 из 10

    Округлите 10,999 с точностью до десятых частей десятичной дроби

    • Правильный ответ
    • Неправильный ответ

    В вопросе ошибка?

    Подсказка 50/50Ответить
  6. Вопрос 6 из 10

    Округлите 1999,99 до десятков

    • Правильный ответ
    • Неправильный ответ

    В вопросе ошибка?

    Подсказка 50/50Ответить
  7. Вопрос 7 из 10

    Округлите 11,055 до двух значащих цифр после запятой (сотых частей)

    • Правильный ответ
    • Неправильный ответ

    В вопросе ошибка?

    Подсказка 50/50Ответить
  8. Вопрос 8 из 10

    Округлите число 364 до сотен

    • Правильный ответ
    • Неправильный ответ

    В вопросе ошибка?

    Подсказка 50/50Ответить
  9. Вопрос 9 из 10

    Округлите число 415 до десятков

    • Правильный ответ
    • Неправильный ответ

    В вопросе ошибка?

    Подсказка 50/50Ответить
  10. Вопрос 10 из 10

    Округлите число 856 до сотен

    • Правильный ответ
    • Неправильный ответ

    В вопросе ошибка?

    Подсказка 50/50Ответить

Доска почёта

Чтобы попасть сюда — пройдите тест.

    
  • Макар Котенко

    8/10

  • Илья Сафронов

    10/10

  • Сайгид Асхабов

    6/10

  • Иван Артемов

    10/10

  • Виктор Пылаев

    9/10

  • Эльмир Нагиев

    10/10

  • Тимофей Жумаев

    9/10

  • Артем Багдасарян

    9/10

  • Светлана Филимонова

    9/10

  • Миха Шелудько

    10/10

ТОП-3 тестакоторые проходят вместе с этим
Рейтинг теста

Средняя оценка: 4.2. Всего получено оценок: 888.

А какую оценку получите вы? Чтобы узнать — пройдите тест.

восемь фактов о флаге России

Белый, красный, синий — не хаотично собранные цвета, а гордость для жителей России. Главный государственный символ нашей страны прожил более трех сотен лет и имеет богатую историю. Сегодня, 22 августа, он отмечает свой День рождения, а редакция «Блокнота» приводит 8 малоизвестных фактов о триколоре и объясняет, причем тут Северный Кавказ.

До XVII века у России официального флага не было. Каждый правитель ориентировался на свой вкус и подбирал знамя по душе. Например, полка Ивана Грозного направлялись в бой со знаменем красного цвета, на котором был изображен Иисус Христос. С этим флагом русские войска завоевали Казань. Знамя просуществовало полтора столетия и даже побывало в Крымских походах при царице Софье Алексеевне.


Флаг Ивана Грозного. Фото: wikipedia.org

Впервые белый, синий и красные цвета использовались на русском корабле «Орел», на котором находились войска из Голландии. Тогда царь Алексей Михайлович приказал установить на судно флаг, похожий на голландский. Историки представили свой вариант того, как выглядело знамя на корабле.


Флаг при Алексее Михайловиче. Фото: wikipedia.org

Белый, синий и красный запали в душу и царю Петру I. Однако он настаивал на идентичности, чтобы у Российской империи был собственный символ. Петр обновил дизайн, причем разработал его сам и разделил цвета. С 1705 года по указу царя этот флаг поднимали на всех российских судах. Еще через 100 лет в центре знамени разместили золотого двуглавого орла.


Флаг России в начале XIX века. Фото из открытых источников

После правления Петра многое изменилось. С 1853 по 1883 флаг был черно-желто-белым. Черный по задумке символизировал двуглавого орла, желтый заимствовали от золотого поля герба, а белый означал Святого Георгия.


Флаг России с 1853 по 1883 года. Фото из открытых источников

С 1918 по 1991 флаг был ярко-красным. С 1923 года на знамени СССР красовались скрещенные серп и молот со звездой в левом верхнем углу.


Флаг СССР с 1923 года. Фото: disput-pmr.ru

Все изменилось в 1991 году. Произошел августовский путч — политический переворот в Москве, в ходе которого люди стремились свергнуть действующее правительство и поменять вектор развития страны, не допустив при этом развала Советского Союза. Цели достигнуты не были, но флаг остался, ведь протестующие вышли именно с петровским знаменем. Верховный Совет РСФСР подготовил постановление от 22 августа, признающим бело-сине-красное знамя национальным флагом Российской Федерации. Еще через 2 года ширина полос стала иметь соотношение 2:3.


Флаг России. Фото из открытых источников

Интересные факты о триколоре

— В 1990 году, за год до признания петровского флага официальным, в первенстве мира по шахматам схлестнулись Гарри Каспаров и Анатолий Карпов. Последний выбрал революционное знамя, а Каспаров выбрал триколор. В турнире выиграл Каспаров, а его символ стал официальным в стране только через год после первенства.


Поединок Карпова и Каспарова. Фото: gettyimages.fr

— Самый большой «живой» флаг России попал в книгу рекордов Гиннеса в 2013 году. Жители Владивостока создали знамя страны длиной более 700 метров во время городского флешмоба.


Рекорд во Владивостоке. Фото: ntv.ru

— Самый большой флаг России за все время существования подняли в 2016 году на Северном Кавказе — его развернули на горе Эльбрус на высоте более 4 тысяч метров. Площадь знамени составила более 1000 метров, он попал в книгу рекордов России.


Рекорд на Эльбрусе. Фото:smerchenko.mirtesen.ru

— Для флага РФ создан свой ГОСТ, рассчитанный для дизайнеров. Он действует с 1998 года и регламентирует точные оттенки цветов, используемые для триколора.

— Кстати об оттенках: когда Петр Первый создавал флаг, он не задумывался над смыслом цветов — это сделали позже. Однако официальной трактовки их нет до сих пор. Считается, что белый — символ благородства, синий — верности, честности, а красный — любви и мужества.

— Ходит легенда, что матросы долго не могли запомнить порядок цветов. Они придумали слово «бесик» — аббревиатуру по первым буквам.

— Часто при изображении флага путают цвет средней полосы. По ошибке вместо темно-синего используют голубой цвет.

— Российский триколор раньше дозволялось использовать только органам госвласти, военным и заграничным послам. Частное лицо могло задействовать флаг лишь отдавая воинские почести. Запрет сняли только в 2008 году.

Кристина Ипатова

Новости на Блoкнoт-Ставрополь

Вариант тирозингидроксилазы V81M связан с более сильным замораживанием походки при болезни Паркинсона.

Паркинсонизм, связанный с расстройством. Авторская рукопись; доступно в PMC 1 февраля 2017 г.

Опубликован в окончательной редакции как:

PMCID: PMC4770791

NIHMSID: NIHMS747924

Izel Tekin

1 Департамент фармакологии, Медицинский колледж Государственного университета Пенсильвании, Милтонский медицинский университет Медицинский центр Херши, Херши, Пенсильвания, США

Нургуль Каркачи-Салли

1 Кафедра фармакологии Медицинского колледжа Государственного университета Пенсильвании, Милтон С.Медицинский центр Херши, Херши, Пенсильвания, США

Мехелль М. Льюис

1 Кафедра фармакологии Медицинского колледжа Пенсильванского государственного университета, Медицинский центр Милтона С. Херши, Херши, Пенсильвания, США

2 Департамент Неврология, Медицинский колледж Государственного университета Пенсильвании, Медицинский центр Милтона С. Херши, Херши, Пенсильвания, США

Ричард Б. Мэйлман

1 Кафедра фармакологии Медицинского колледжа Государственного университета Пенсильвании, Милтон С.Медицинский центр Херши, Херши, Пенсильвания, США

2 Отделение неврологии, Медицинский колледж Государственного университета Пенсильвании, Медицинский центр Милтона С. Херши, Херши, Пенсильвания, США

Сюэмэй Хуанг

1 Отдел фармакологии, Медицинский колледж Университета штата Пенсильвания, Медицинский центр Милтона С. Херши, Херши, Пенсильвания, США

2 Отделение неврологии Медицинского колледжа Государственного университета Пенсильвании, Медицинский центр Милтона С. Херши, Херши, Пенсильвания, США

3 Отделения радиологии и нейрохирургии, Милтон С.Медицинский центр Херши и кинезиология, Государственный университет Пенсильвании, Херши, Пенсильвания, США

Кент Э. Врана

1 Кафедра фармакологии, Медицинский колледж Государственного университета Пенсильвании, Медицинский центр Милтона С. Херши, Херши, Пенсильвания, США

1 Кафедра фармакологии Медицинского колледжа Государственного университета Пенсильвании, Медицинский центр Милтона С. Херши, Херши, Пенсильвания, США

2 Кафедра неврологии Медицинского колледжа Государственного университета Пенсильвании, Милтон С.Медицинский центр Херши, Херши, Пенсильвания, США

3 Отделения радиологии и нейрохирургии, Медицинский центр Милтона С. Херши и кинезиологии, Государственный университет Пенсильвании, Херши, Пенсильвания, США

Автор для корреспонденции: Д-р Кент Э. Врана, кафедра фармакологии, Медицинский колледж Государственного университета Пенсильвании, 500 University Drive, Hershey, PA 17033-0850. Телефон: (717) 531-8285. Факс: (717) 531-0419. [email protected] См. другие статьи в PMC, в которых цитируется опубликованная статья.
Дополнительные материалы

1.

GUID: 6FFD17B0-217E-4A29-8F81-E3188A5FDE06

2.

GUID: E0F583A6-0A28-4CA3-A20

0 900 9CD3-A20
0

GUID: 0FCAAD2C-5C4F-4717-89FD-BC6E0844C197

04.

GUID: 770AB615-DE97-4039-AD8E-9D1620975F4F

Описание симптомов болезни Паркинса

000 и

8 (PD) возникают в результате гибели дофаминовых нейронов среднего мозга, которые используют тирозингидроксилазу (TH) в качестве ограничивающего скорость фермента в биосинтезе катехоламинов.

Методы

Мы исследовали, влияет ли наличие общего полиморфизма ТГ на клинические исходы у 101 пациента с БП. Мы также исследовали влияние этого полиморфизма на очищенный рекомбинантный фермент.

Результаты

Пациенты с PD, гомозиготные по общему полиморфизму V81M, имеют более высокие общие показатели замораживания походки после контроля продолжительности заболевания, хотя этот полиморфизм не связан с возникновением PD или FOG. Функциональные анализы in vitro на чистых рекомбинантных TH дикого типа и V81M TH показали, что K m мутантного фермента тирозина в два раза больше, чем у дикого типа.Однако этот полиморфизм не повлиял на стабильность фермента и не повлиял на V max или K m для дополнительного субстрата BH 4 .

Заключение

Данные свидетельствуют о том, что наличие гомозиготного полиморфизма V81M связано с более тяжелым FOG, возможно, из-за более низкой синтетической способности катехоламинов. Необходимы дальнейшие исследования для изучения роли незначительных изменений доступности катехоламинов в развитии ВОГ.

Ключевые слова: Полиморфизм, SNP, допамин, норэпинефрин, двигательные расстройства

Введение

Болезнь Паркинсона (БП), второе по распространенности нейродегенеративное расстройство, первоначально проявляется двигательными нарушениями в виде тремора покоя, брадикинезии и ригидности [1] .По мере прогрессирования болезни также возникают трудности с походкой и равновесием. Замерзание походки (ВОГ) является одним из распространенных нарушений походки при БП и приводит к значительной клинической инвалидности, такой как падения. Патологическим признаком БП является потеря дофаминовых нейронов в компактной части черной субстанции, включая снижение уровня тирозингидроксилазы (TH), фермента, ограничивающего скорость синтеза катехоламинов [2,3]. Эта потеря белка наиболее значительна в нервных окончаниях.

TH — гомотетрамер, каждая из субъединиц которого содержит регуляторный, каталитический и тетрамеризационный домены [2].Фермент использует тирозин, BH 4 и O 2 в качестве сопутствующих субстратов, и Fe 2+ в качестве кофактора. Уровни и активность белка TH можно регулировать в нескольких точках, включая экспрессию мРНК, регуляцию стабильности РНК и трансляцию, включая посттрансляционное фосфорилирование и связывание эффекторных белков. Мыши с нокаутом TH эмбрионально летальны, но одной интактной копии достаточно для поддержания синтеза дофамина, на что указывает тот факт, что гетерозиготные животные жизнеспособны и экспрессируют нормальные уровни катехоламинов [4,5].Есть генетические полиморфизмы в нескольких областях гена TH, и некоторые из них, как предполагается, вовлечены в патологию БП и других форм паркинсонизма [6,7].

Несинонимичный полиморфизм кодирующей области в регуляторном домене ТН, V81M (rs6356), был описан в независимых исследованиях со средней зарегистрированной аллельной частотой 0,33 [6,7], но ни одно конкретное влияние этого полиморфизма на ни о ферменте, ни о потенциальных функциональных последствиях для пациентов с БП не сообщалось.Этот отчет является первым комплексным анализом влияния V81M на клинические проявления функции БП и ТГ.

Методы

Субъекты

Образцы крови были получены от 101 пациента с PD и 68 контрольных пациентов для анализа ДНК. Пациенты были отобраны из большой когорты, в настоящее время наблюдаемой в амбулаторной неврологической клинике Медицинского центра Херши для продолжающегося лонгитюдного исследования. Диагностика БП [8] проводилась специалистом по двигательным расстройствам. Все пациенты с болезнью Паркинсона, участвовавшие в этом исследовании, находятся под наблюдением специалиста по двигательным расстройствам и на оптимизированных схемах приема лекарств.Длительность заболевания определялась из анамнеза пациента. Баллы по унифицированной шкале оценки болезни Паркинсона, часть 3 (UPDRS-III), использовались в качестве меры общей двигательной способности [9] и оценивались дважды: один раз через 12 часов после последней дозы лекарства от болезни Паркинсона (UPDRS-OFF), а затем вскоре после приема. регулярного приема препарата для лечения болезни Паркинсона (UPDRS-ON). Суточная доза, эквивалентная леводопе (LEDD), была рассчитана для оценки эффекта комбинированных дофаминергических препаратов на каждого пациента [10]. FOG оценивался с помощью опросника Freezing of Gait Questionnaire (FOG-Q) [11.12]. Письменное информированное согласие было получено от всех испытуемых, и исследование было одобрено Советом по надзору за учреждениями штата Пенсильвания в Херши (IRB # 40726) и проводилось в соответствии с принципами Хельсинкской декларации.

Генетический анализ

Венозная кровь была собрана у всех участников, и выделение ДНК выполнено с помощью набора DNeasy Blood & Tissue Kit (QIAGEN; Валенсия, Калифорния). Мы использовали анализ генотипирования TaqMan SNP, разработанный против SNP rs6356 (Life Technologies, Thermo Fisher Scientific, Гранд-Айленд, Нью-Йорк).Последующее и подтверждающее секвенирование было выполнено с ранее описанными праймерами для экзона 3 гена тирозингидроксилазы человека с использованием полимеразной цепной реакции (ДНК-полимераза Hot Start Taq, QIAGEN) и секвенирования ампликона Сэнгера для определения наличия полиморфизма V81M [13]. Электрофорез в агарозном геле (1,5% гель агарозы, Sigma-Aldrich, Сент-Луис, Миссури, в буфере Трис / уксусная кислота / ЭДТА, Bio-Rad, Геркулес, Калифорния) продуктов ПЦР (выполняли при 150 В в течение 1 ч). с последующей экстракцией геля (NucleoSpin Gel and PCR Clean-up Kit, Macherey-Nagel, Bethlehem, PA).Секвенирование по Сэнгеру проводили для определения последовательности ДНК экзона 3 (Eurofins MWG Operon, Хантсвилл, Алабама). Результаты сравнивали с геномной последовательностью нативного TH человека с использованием ClustalW2 от EBI (http://www.ebi.ac.uk/Tools/msa/clustalw2/), а последовательность комплементарной цепи получали с использованием обратного комплемента (http: //www.bioinformatics.org/sms/rev_comp.html).

Сайт-направленный мутагенез и экспрессия мутантной рекомбинантной конструкции TH

Полноразмерная кДНК для hTh2 была приобретена у OriGene в специальном векторе (Rockville, MD), и кодирующая последовательность hTh2 была клонирована (в виде N-концевого слияния с гексагистидином). белок) в вектор экспрессии pET28-tev, как описано ранее для гена триптофангидроксилазы 2 человека [14].Сайт-направленный мутагенез выполняли с использованием набора QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Санта-Клара, Калифорния) со следующими праймерами: 5′-GGGAAGGCCATGCTAAACCTG-3 ‘(прямой) и 5′-GAAGAGCAGGTTTTAGCATGGC-3’ (обратный), приобретенный от компании Integrated DNA Technologies (Коралвилл, Айова). В термоциклере были использованы следующие параметры: денатурация 30 секунд при 95 ° C, отжиг 1 минута при 55 ° C, удлинение 8 минут при 68 ° C, выполненные в течение 18 циклов. После переваривания DpnI плазмиды трансформировали в суперкомпетентные клетки XL-1 Blue, и положительные колонии отбирали с использованием чашек с агаром LB с канамицином (25 мг / мл) (Sigma, St.Луис, Миссури). Отобранные колонии выращивали в течение ночи в жидких культурах LB при 37 ° C, и плазмиды выделяли с использованием набора NucleoSpin Plasmid Isolation Kit (Macherey-Nagel, Bethlehem, PA). Секвенирование плазмид выполняли с помощью Eurofins Operon (Хантсвилл, Алабама) со следующими праймерами: 5′-ATGCCCACCCCCGACGCCACC-3 ‘(прямой), 5′-CTAGCCAATGGCACTCAGCGCATGG-3’ (обратный), а также промотор Т7 (прямой). и терминатор Т7 (обратный) праймеры. Затем положительные колонии трансформировали в BL21-CodonPlus (DE3) -RIL E.coli для экспрессии белка.

Бактериальная экспрессия TH

человека дикого типа Экспрессию рекомбинантного белка в E. coli устанавливали с использованием среды ZYP-5052, как описано ранее [14,15]. Экспрессию проводили встряхиванием культур при 215 об / мин и 15 ° C до тех пор, пока плотность насыщения (измеренная при 600 нм) не достигала 9, после чего культуры собирали и хранили при -80 ° C.

Очистка рекомбинантного hTh2

Собранные бактериальные культуры лизировали с помощью BugBuster, Amine Free (EMD Chemicals Inc., Сан-Диего, Калифорния), содержащий бензоназу и r-лизоцим, с коктейлем из ингибиторов протеазы, не содержащего ЭДТА. Рекомбинантный гибридный ТГ гексагистидина очищали на колонке HT Nickel 5 мл (GE Healthcare, Питтсбург, Пенсильвания, США), как описано ранее [14]. 50% -насыщенный сульфат аммония использовали для осаждения белков, очищенных на Ni-колонке. Затем осадок растворяли в буфере для эксклюзионной хроматографии (25 мМ HEPES, 100 мМ NaCl, 1 мМ DTT, 0,1 мМ EDTA) и проводили эксклюзионную хроматографию с использованием колонки Superdex 200 10/300 GL на 25 мл (GE Healthcare).Стандарты белков были приобретены у Sigma (MW-GF-1000 Protein Standard Kit).

Анализ SDS-PAGE

Анализ SDS-PAGE использовали для документирования экспрессии и чистоты рекомбинантных белков. Предварительно отлитые 4-12% гели NuPAGE BisTris (Invitrogen) использовали для разделения денатурированных белков, как описано ранее [14]. Краситель кумасси синий использовали для визуализации разделенных белков (Pierce).

Анализ ферментативной активности

Тирозингидроксилазную активность чистых рекомбинантных белков оценивали с помощью радиоферментного анализа, который отслеживает высвобождение 3 H 2 O, как описано ранее Reinhard et al.[16]. Для определения концентрации белка использовали анализ белка Брэдфорда (Bio-Rad). Химические вещества, используемые для анализа активности, были получены от Sigma, за исключением активированного угля (Darco G-60, Fisher Scientific). Для анализа кинетических параметров использовали различные концентрации любого из субстратов в присутствии фиксированной концентрации аналога (100 мкМ тирозина или 100 мкМ BH 4 ) с кислородом окружающей среды. Полученные значения активности были нормализованы к количеству присутствующего белка для получения конкретных активностей.Программное обеспечение Prism Software V.5 (GraphPad, Сан-Диего, Калифорния) использовали для расчета кинетических констант (K m , V max ). Анализ стабильности выполняли аналогичным образом с инкубацией белка при 37 ° C в течение различных периодов времени до 90 мин. Значения активности в различные моменты времени наносили на полулогарифмический график зависимости от времени и рассчитывали период полураспада активности фермента.

Статистический анализ

Различия в значениях V max , K m и t 1/2 были проанализированы с использованием t-критерия Стьюдента с α = 0.05. Эти анализы были выполнены с использованием GraphPad Prism Version 5 (GraphPad Inc, Сан-Диего, Калифорния). Анализ ковариации (ANCOVA) использовали для сравнения баллов FOG-Q двух групп генотипов (гомозиготы V81M против гетерозигот и гомозигот дикого типа) при контроле продолжительности заболевания. Преобразование квадратного корня было применено к баллу FOG-Q, чтобы соответствовать предположениям нормальности. Статистический анализ проводился с использованием SAS версии 9.4 (SAS Institute, Inc., Кэри, Северная Каролина, США). Субъектов дикого типа и гетерозигот лечили консолидированным образом, учитывая, что они статистически неразличимы, и хорошо задокументированное отсутствие эффекта дозировки генов, как сообщалось ранее [4,5].

Результаты

Влияние полиморфизма V81M на прогрессирование заболевания

Основной целью этого исследования было изучить влияние полиморфизма hTH V81M на прогрессирование болезни Паркинсона. Таким образом, наш анализ был сосредоточен исключительно на субъектах с болезнью Паркинсона, которые были отобраны так, чтобы охватить диапазон тяжести заболевания. Контроли использовались только для определения частот аллелей в популяциях с PD и без (). Частоты минорного аллеля (V81M) были аналогичными для PD (0.37) и контрольной (0,38) популяции, и в соответствии с литературой () [6; http://www.ncbi.nlm.nih.gov/snp/?term=rs6356]. Полиморфизм V81M находится в регуляторном домене белка TH (дополнительная фигура 1A) и является результатом изменения одного нуклеотида G на A в положении 241 кодирующей области. Классическое секвенирование по Сэнгеру (Дополнение на Фигуре 1B) образцов было выполнено на экзоне 3 гена (содержащем SNP V81M).

Таблица 1

Общие характеристики людей

PD Контроль
Число 101 68
Возраст (год; среднее ± стандартное отклонение) 68.78 ± 9,36 65,92 ± 9,07
Пол (мужчина)
55/46 32/36
Частота второстепенного аллеля 0,371 0,375
Генотип (WT / HET / HOM) 41/44/16 25/35/8
FOG-Q (среднее ± стандартное отклонение) 4,86 ​​± 5,43
Длительность заболевания (лет)
6.20 ± 5,88
UPDRS-III-ON (среднее ± стандартное отклонение) 27,33 ± 19,52
UPDRS-III-OFF * (среднее ± стандартное отклонение) 34,76 ± 21,07
LEDD ** (среднее ± стандартное отклонение) 659,06 ± 461,54
Частота второстепенных аллелей Субъекты с остановкой походки 0.381
Генотип (WT / HET / HOM) Субъекты с замиранием походки 32/35/13
FOG-Q (среднее ± стандартное отклонение) Субъекты с замиранием походки 6,14 ± 5,42
Продолжительность заболевания (лет) Субъекты с замиранием походки 7,23 ± 6,14

Мы обнаружили значительную связь между наличием генетического варианта V81M и степень тяжести ВОГ у больных БП.Поскольку наша гипотеза состоит в том, что полиморфизм ухудшит FOG-Q и не обязательно вызовет FOG, мы исключили пациентов, у которых не было FOG. Результаты показали, что гомозиготные субъекты (n = 13) имели значительно более высокие баллы FOG-Q, чем люди с 1 или 2 аллелями дикого типа (n = 67), после контроля продолжительности заболевания (p = 0,05). Когда одинаковые анализы были выполнены для всех согласившихся субъектов ПД (даже включая тех, у кого не было FOG), наблюдалась аналогичная тенденция, но различия не были статистически значимыми (p = 0.11, данные не показаны). Этот полиморфизм не повлиял на другие показатели заболевания, включая UPDRS-ON, UPDRS-OFF, LEDD, ежедневное потребление леводопы или дискинезию (данные не показаны). Возможные молекулярные механизмы, лежащие в основе наблюдаемой ассоциации, были исследованы с использованием очищенных ферментов дикого типа и мутировавших ферментов TH. Ранее было установлено, что гетерозиготные животные с нокаутом TH ведут себя аналогично животным дикого типа в отношении синтеза катехоламинов [4,5]. Следовательно, субъекты WT и HET были сгруппированы вместе для анализа.Кроме того, при раздельном наблюдении не было различий в средних показателях FOG-Q для этих двух групп (p = 0,88).

Продолжительность заболевания (A) и общие баллы FOG-Q (B) субъектов с PD, у которых во время анализа отмечалась остановка походки (среднее значение ± SEM, p = 0,05). Эти данные представляют субъектов с FOG (всего 80, 32 дикого типа [WT], 35 гетерозиготных [HET], 13 гомозиготных [HOM]).

Стабильность мутантного фермента hTH

Не было различий между периодами полураспада активности рекомбинантных ферментов (дополнительная таблица 1 и).Используя гель-электрофорез, результаты продемонстрировали, что различия в активности не были связаны с потерей количества белка или результатом деградации белка ().

A) Полулогарифмический график остаточной активности hTH дикого типа (WT) и полиморфного (V81M) hTH в зависимости от времени инкубации при 37 ° C. B) SDS-PAGE гель образцов hTH, оцениваемых после увеличения времени инкубации.

Изменение кинетических параметров фермента мутанта hTH

описывает кинетические параметры устойчивого состояния, измеренные для чистого рекомбинантного дикого типа и мутантного TH.Не было изменений ни в максимальной скорости этих конструкций, ни в K м для скв. 4 . Напротив, полиморфизм V81M привел к двукратному увеличению тирозина K m по сравнению с таковым для белка V81 дикого типа (16 мкМ против 33 мкМ;).

Таблица 2

Кинетические параметры устойчивого состояния для очищенных ферментов hTH дикого типа и мутантных

Ферментная форма K m, L-Tyr (мкМ) V max, L-Tyr ( нмоль / мин / мг) K m, Bh5 (мкМ) V max, Bh5 (нмоль / мин / мг)
hTH WT 16.0 ± 1,8 42,3 ± 12,2 82,2 ± 15,7 43,6 ± 8,9
hTH V81M 32,8 ± 3,5 48,3 ± 15,9 83,0 ± 28,3 47,7 ± 9,9
p-значение 0,0049 0,78 0,98 0,77

Обсуждение

Хотя существует небольшой процент семейной БП, которая является результатом специфических полиморфизмов в дюжине или около того генов, подавляющее большинство БП носит спорадический и предполагаемый характер. быть результатом сочетания факторов окружающей среды, взаимодействующих с группами генов восприимчивости [1].Кроме того, в генах есть полиморфизмы, которые могут влиять на конкретную клиническую картину заболевания (например, психоз, дискинезию или расстройство личности) только у небольшой группы пациентов. В результате было очень трудно связать полиморфизм отдельных генов с аспектами клинического фенотипа для большинства пациентов.

ВОГ возник как клинический показатель прогрессирования БП, поскольку он прогрессирует пропорционально продолжительности заболевания и его наличие не зависит от типа лечения [17].ВОГ возникает у большинства пациентов с БП на более поздних стадиях заболевания [18], и предполагается, что дисфункции передачи сигналов норадреналина (НЭ) и дофамина вносят свой вклад в ВОГ. Например, уровни NE значительно снижаются у пациентов с тяжелой формой ВОГ (см. Обзор [19, 20]), а симптомы могут быть ослаблены введением предшественника норэпинефрина 3,4-дигидроксифенилсерина [21-24]. Хотя это выходит за рамки данного исследования, следует отметить, что холинергическая система также участвует в патологии ВОГ при БП [25].Также следует отметить, что TH V81M связан с клиническими проявлениями FOG, а не с другими критериями клинического исхода, такими как дискинезия, вызванная леводопой, и баллы по шкале UPDRS-III, которые, как известно, модулируются дофаминергической терапией. Это открытие согласуется с гипотезой о том, что ВОГ может возникать из-за экстра-нигральных дисфункций (таких как НЭ) во время протекания БП. Как отмечалось ранее, и дофаминергическая, и норадренергическая передача сигналов могут влиять на FOG, и последний был связан с несколькими другими симптомами БП, включая дискинезию и поведенческие проблемы [26].Таким образом, эффекты V81M могут быть связаны с изменениями как дофаминовой, так и норадренергической передачи. Следует отметить, что, помимо катехоламинергических систем, холинергическая система и ее дисфункция является важной мишенью, которая, как было предложено, лежит в основе ВОГ [27]. Напр., Педунколопонтинное ядро ​​(PPN) участвует в качестве регулятора походки у людей, и пациенты с PD демонстрируют сильную потерю холинергических нейронов в этой структуре [27]. Также было показано, что искусственная стимуляция PPN улучшает трудности походки и стабильность позы у пациентов с PD [27].Работа, представленная в этой рукописи, не касается некатехоламинергических систем в ВОГ. Возможно, что связь между TH V81M и более серьезными показателями FOG-Q, представленная здесь, связана с изменением взаимодействия между различными системами нейротрансмиттеров, а не с изолированным катехоламинергическим событием. Настоящее исследование не полностью выясняет механизм, с помощью которого полиморфизм TH V81M связан с более тяжелым FOG. Фактически, если бы эффекты были вызваны исключительно изменениями активности TH, можно было бы ожидать, что L-DOPA обойдет этот шаг и приведет к глобальному увеличению катехоламинов в головном мозге.Следовательно, вероятно, что текущее наблюдение происходит из-за зависящего от времени воздействия снижения норадренергической функции (например, нейропротекции или нейрональной связи).

В текущем исследовании мы также показали, что относительно распространенный полиморфизм V81M удваивает K m TH для его тирозинового субстрата, но не влияет на стабильность фермента или использование ферментом сопутствующего птерина (BH 4). ). Известно, что концентрации тирозина в плазме и тканях находятся в диапазоне измеренных значений K m [28,29].Таким образом, хотя удвоение K m в V81M является относительно небольшим изменением, это потенциально может снизить производство l-ДОФА. Однако следует отметить, что это конкретное исследование не измеряет уровни катехоламинов в полиморфных тканях. Когда количество допамина и норадреналина уже ограничено, этот кинетический эффект может играть роль в ВОГ. Соответственно, группа субъектов, гомозиготная по полиморфизму TH V81M, имела более высокие баллы по FOG-Q; следовательно, их симптомы ВОГ были хуже, чем у их коллег.Неудивительно, что изменение показателей FOG-Q значимо наблюдалось только у гомозиготных субъектов с PD, поскольку известно, что одной интактной копии аллеля TH достаточно для компенсации и достижения оптимального синтеза катехоламинов у гетерозиготных мышей с нокаутом TH [ 4,5].

Полиморфизмы TH не были связаны с возникновением PD или FOG [30,31], и предыдущие исследования предполагают, что V81M не играет этиологической роли в PD [32]. Однако недавно Гринбаум и его коллеги сообщили об ассоциации носителей V81M и более низких баллах по шкале UPDRS у субъектов, которые находились на ранних стадиях заболевания, по оценке с помощью ОФЭКТ-визуализации переносчика дофамина [33].

В заключение, этот отчет описывает значительную связь между общим полиморфизмом TH и более серьезным проявлением FOG при БП. Наша функциональная характеристика этого полиморфизма нативного фермента дает потенциальное кинетическое объяснение (снижение утилизации тирозинового субстрата) для клинических наблюдений (повышенная степень замирания походки). Работа, представленная в этой рукописи, не устанавливает причинного эффекта полиморфизма TH V81M с PD FOG. В будущих исследованиях, разработанных и выполненных в продольном направлении, будет лучше выяснена прямая связь между этим полиморфизмом TH и тяжестью FOG при БП.Тем не менее, это первое исследование, показывающее связь между SNP в ферменте, ограничивающем скорость синтеза катехоламинов, и тяжестью симптома БП.

Основные моменты

  • Мы показали значительную связь между общим полиморфизмом TH и FOG при БП.

  • Мутация V81M вызывает удвоение константы Михаэлиса-Ментен для субстрата фермента; тирозин.

  • Это поддерживает роль NE в генерации FOG и поддерживает роль этой системы в качестве мишени для лечения PD.

Благодарности

Авторы благодарят доктора Гуанвей Ду, г-жу Элеонору Эрнандес, г-жу Бриттани Джонс, г-жу Мелиссу Сантос, г-жу Грейс Шью и г-жу Рагда Клейфф за помощь в вопросах выбора темы и г-на Юджина Гонсалес-Лопес за техническую помощь. Мы также благодарим г-жу Кристи Стеттер за помощь в проведении статистического анализа. Эта работа была поддержана грантами Национальных институтов здравоохранения (GM38931, NIH NS060722, NS082151, Penn State Hershey Medical Center CTSI [NIH UL1 TR000127], GCRC Construction [C06 RR016499] и исследовательскими грантами CTSI [TL1 TR000125]) и Государственный институт персонализированной медицины Пенсильвании (04-017-52 HY 8A1HO; в рамках гранта Министерства здравоохранения Пенсильвании с использованием средств Tobacco CURE Funds).Департамент здравоохранения штата Пенсильвания не несет ответственности за любые анализы, интерпретации или выводы.

Сноски

Заявление издателя: Это PDF-файл неотредактированной рукописи, принятой к публикации. В качестве услуги для наших клиентов мы предоставляем эту раннюю версию рукописи. Рукопись будет подвергнута копированию, верстке и рассмотрению полученного доказательства, прежде чем она будет опубликована в окончательной форме для цитирования. Обратите внимание, что во время производственного процесса могут быть обнаружены ошибки, которые могут повлиять на содержание, и все юридические оговорки, относящиеся к журналу, имеют отношение.

Ссылки

1. Шульман Дж. М., Де Ягер П. Л., Фини МБ. Болезнь Паркинсона: генетика и патогенез. Анну Рев Патол. 2011; 6: 193–222. [PubMed] [Google Scholar] 2. Текин И., Роскоски Р., мл., Каркачи-Салли Н. и др. Комплексная молекулярная регуляция тирозингидроксилазы. J Neural Transm. 2014; 121: 1451–1481. [PubMed] [Google Scholar] 3. Левитт М., Спектор С., Сёрдсма А. и др. Выявление лимитирующего шага в биосинтезе норэпинефрина в перфузированном сердце морской свинки. J Pharmacol Exp Ther.1965; 148: 1–8. [PubMed] [Google Scholar] 4. Чжоу QY, Quaife CJ, Palmiter RD. Целенаправленное нарушение гена тирозингидроксилазы показывает, что катехоламины необходимы для развития плода мыши. Природа. 1995. 374: 640–643. [PubMed] [Google Scholar] 5. Кобаяши К., Морита С., Савада Х. и др. Целенаправленное нарушение локуса тирозингидроксилазы приводит к серьезному истощению катехоламинов и перинатальной летальности у мышей. J Biol Chem. 1995; 270: 27235–27243. [PubMed] [Google Scholar] 6. Хаавик Дж., Блау Н., Тони Б.Мутации в генах человеческих моноаминовых путей нейротрансмиттеров. Hum Mutat. 2008; 29: 891–902. [PubMed] [Google Scholar] 7. Bademci G, Vance JM, Wang L. Ген тирозингидроксилазы: еще одна часть генетической головоломки болезни Паркинсона. Цели лекарственного средства нейролептического расстройства ЦНС. 2012; 11: 469–481. [Бесплатная статья PMC] [PubMed] [Google Scholar] 8. Calne DB, Snow BJ, Lee C. Критерии диагностики болезни Паркинсона. Энн Нейрол. 1992; 32 (Приложение): S125–127. [PubMed] [Google Scholar] 9. Гетц К.Г., Тилли BC, Шафтман С.Р. и др.Пересмотр единой рейтинговой шкалы болезни Паркинсона (MDS-UPDRS), спонсируемый Обществом двигательных расстройств: представление шкалы и результаты клинических испытаний. Mov Disord. 2008; 23: 2129–2170. [PubMed] [Google Scholar] 10. Томлинсон К.Л., Стоу Р., Патель С. и др. Систематический обзор отчетов об эквивалентности доз леводопы при болезни Паркинсона. Mov Disord. 2010; 25: 2649–2653. [PubMed] [Google Scholar] 11. Гилади Н., Шабтай Х., Саймон Э.С. и др. Построение анкеты замораживания походки для пациентов с паркинсонизмом.Паркинсонизм, связанный с расстройством. 2000. 6: 165–170. [PubMed] [Google Scholar] 12. Гилади Н., Тал Дж., Азулай Т. и др. Валидация анкеты «замораживание походки» у пациентов с болезнью Паркинсона. Mov Disord. 2009. 24: 655–661. [PubMed] [Google Scholar] 13. Янссен Р.Дж., Веверс Р.А., Хаусслер М. и др. Мутация сайта ответвления, приводящая к аберрантному сплайсингу гена тирозингидроксилазы человека у ребенка с тяжелым экстрапирамидным двигательным расстройством. Энн Хам Жене. 2000. 64: 375–382. [PubMed] [Google Scholar] 14.Carkaci-Salli N, Flanagan JM, Martz MK, et al. Функциональные домены триптофангидроксилазы 2 человека (hTPh3). J Biol Chem. 2006; 281: 28105–28112. [PubMed] [Google Scholar] 15. Studier FW. Производство белка путем автоиндукции в культурах с высокой плотностью встряхивания. Protein Expr Purif. 2005. 41: 207–234. [PubMed] [Google Scholar] 16. Рейнхард Дж. Ф. младший, Смит Г. К., Никол Калифорния. Быстрый и чувствительный анализ тирозин-3-монооксигеназы, основанный на высвобождении 3H 2 O и адсорбции [3H] -тирозина древесным углем.Life Sci. 1986; 39: 2185–2189. [PubMed] [Google Scholar] 17. Гилади Н., депутат Макдермотта, Фан С. и др. Замораживание походки при БП: проспективная оценка в когорте DATATOP. Неврология. 2001; 556: 1712–1721. [PubMed] [Google Scholar] 18. Ахирон А., Зив И., Горен М. и др. Первичная прогрессирующая замерзающая походка. Mov Disord. 1993. 8: 293–297. [PubMed] [Google Scholar] 19. Паниссет М. Замерзание походки при болезни Паркинсона. Neurol Clin. 2004. 22: S53–62. [PubMed] [Google Scholar] 21. Tohgi H, Abe T, Takahashi S. Эффекты L-трео-3,4-дигидроксифенилсерина на общие концентрации норадреналина и дофамина в спинномозговой жидкости и замерзшую походку у пациентов с паркинсонизмом.J Neural Transm Park Dis Dement Sect. 1993; 5: 27–34. [PubMed] [Google Scholar] 22. Огава Н., Курода Х., Ямамото М., Нукина И., Ота З. Улучшение феномена замораживания при болезни Паркинсона после DL-трео-3,4-дигидроксифенилсерина. Acta Med Okayama. 1984; 38: 301–304. [PubMed] [Google Scholar] 23. Нарабаяши Х., Кондо Т., Йокочи Ф., Нагацу Т. Клинические эффекты L-трео-3,4-дигидроксифенилсерина в случаях паркинсонизма и чистой акинезии. Adv Neurol. 1987. 45: 593–602. [PubMed] [Google Scholar] 24. Фукада К., Эндо Т., Ёкоэ М., Хамасаки Т., Хазама Т., Сакода С.Совместное введение L-трео-3,4-дигидроксифенилсерина (L-DOPS) с энтакапоном улучшает замораживание походки при болезни Паркинсона. Мед-гипотезы. 2013; 80: 209–212. [PubMed] [Google Scholar] 25. Карачи С., Грабли Д., Бернард Ф.А. и др. Холинергические мезэнцефальные нейроны участвуют в нарушениях походки и осанки при болезни Паркинсона. J Clin Invest. 2010; 120: 2745–2754. [Бесплатная статья PMC] [PubMed] [Google Scholar] 26. Роммельфангер К.С., Вайншенкер Д. Норэпинефрин: рыжий пасынок болезни Паркинсона.Biochem Pharmacol. 2007; 74: 177–190. [PubMed] [Google Scholar] 27. Devos D, Defebvre L, Bordet R. Допаминергические и недофаминергические фармакологические гипотезы нарушений походки при болезни Паркинсона. Фонд Clin Pharmacol. 2010; 24: 407–421. [PubMed] [Google Scholar] 28. Wurtman RJ, Larin F, Mostafapour S, Fernstrom JD. Синтез катехолов в головном мозге: контроль концентрацией тирозина поездом. Наука. 1974; 185: 183–184. [PubMed] [Google Scholar] 29. Fernstrom JD, Fernstrom MH. Синтез и функции тирозина, фенилаланина и катехоламинов в головном мозге.J Nutr. 2007; 137: 1539S – 1547. [PubMed] [Google Scholar] 30. Герц Дж. М., Остергард К., Юнкер И. и др. Низкая частота мутаций генов паркина, тирозингидроксилазы и GTP циклогидролазы I в датской популяции с ранним началом болезни Паркинсона. Eur J Neurol. 2006; 13: 385–390. [PubMed] [Google Scholar] 31. Plante-Bordeneuve V, Davis MB, Maraganore DM, Marsden CD, Harding AE. Полиморфизм тирозингидроксилазы при семейной и спорадической болезни Паркинсона. Mov Disord. 1994; 9: 337–339. [PubMed] [Google Scholar] 32.Kunugi H, Kawada Y, Hattori M, Ueki A, Otsuka M, Nanko S. Исследование ассоциации структурных мутаций гена тирозингидроксилазы с шизофренией и болезнью Паркинсона. Am J Med Genet. 1998. 81: 131–133. [PubMed] [Google Scholar] 33. Гринбаум Л., Лорбербойм М., Меламед Э. и др. Перспектива: идентификация генетических вариантов, связанных с дофаминергическими компенсаторными механизмами на ранних стадиях болезни Паркинсона. Front Neurosci. 2013; 7: 52. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Frontiers | Анализ секвенирования экзома выявляет редкие варианты ATM и RPL8, которые связаны с более короткой длиной теломер

Введение

Теломеры — это структуры ДНК, расположенные на концах хромосом и состоящие из тандемных повторов гексануклеотидных последовательностей (TTAGGG) (Blackburn and Gall, 1978).Они важны для поддержания стабильности генома, предотвращая деградацию ДНК и слияние хромосом (Blackburn, 2000). Теломеры укорачиваются с каждым делением клетки из-за неспособности ДНК-полимеразы полностью удлинять 3′-конец цепи ДНК во время репликации. Когда теломеры достигают критической длины, это приводит к клеточному старению и, в конечном итоге, к гибели клеток, что делает их регуляторами репликативной способности клетки и маркерами биологического возраста (Lindsey et al., 1991; Allsopp et al., 1992).

Более короткая длина теломер лейкоцитов (LTL) была связана с рядом возрастных заболеваний, включая сердечно-сосудистые заболевания (Brouilette et al., 2003, 2007; Benetos et al., 2004; Fitzpatrick et al., 2007; Willeit et al., 2010a). ; Haycock et al., 2014), рака (Hastie et al., 1990; Willeit et al., 2010b, 2011; Bojesen et al., 2013) и деменции (Martin-Ruiz et al., 2006; Grodstein et al. , 2008; Honig et al., 2012). LTL также был связан со смертностью (Cawthon et al., 2003; Кимура и др., 2008; Фитцпатрик и др., 2011; Хониг и др., 2012; Дилен и др., 2014; Роде и др., 2015; Мариони и др., 2016). Однако эта ассоциация была непоследовательной (Martin-Ruiz et al., 2005; Harris et al., 2006; Njajou et al., 2009; Houben et al., 2011; Strandberg et al., 2011; Needham et al., 2015). LTL имеет высокую степень наследственности с оценками наследуемости от 34 до 82% (Slagboom et al., 1994; Bischoff et al., 2005; Vasa-Nicotera et al., 2005; Andrew et al., 2006; Broer et al., 2013). Ранее полногеномные ассоциативные исследования (GWAS) в исследованиях европейских предков выявили общие варианты, связанные с LTL, локализованные во многих генах, в том числе: TERC, (Codd et al., 2010, 2013; Mangino et al., 2012; Pooley et al. al., 2013), TERT, (Codd et al., 2013; Pooley et al., 2013), NAF1, (Codd et al., 2013), OBFC1, (Levy et al., 2010; Mangino et al., al., 2012; Codd et al., 2013; Pooley et al., 2013), RTEL1 (Codd et al., 2013), CTC1 (Mangino et al., 2012), ZNF676 (Mangino et al., 2012), ZNF208 (Codd et al., 2013), ACYP2 (Codd et al., 2013 ), DCAF4 (Mangino et al., 2015) и PXK (Pooley et al., 2013). Однако эти варианты объясняют <5% наследуемости.

До сих пор не было опубликовано ни одного системного скрининга всего экзома или генома на редкие варианты, несмотря на то, что они могут частично объяснять наследуемость (Manolio et al., 2009). Редкие варианты плохо улавливаются микрочипами, используемыми для GWAS, и по-прежнему трудно вменять, несмотря на недавние улучшения в панелях вменения (McCarthy et al., 2016). Технологии секвенирования нового поколения, такие как секвенирование всего экзома (WES), лучше подходят для изучения редких вариантов. В этом исследовании мы представляем двойной анализ. Во-первых, мы провели полногеномный WES-анализ LTL у 1303 человек из голландского исследования семьи Erasmus Rucphen (ERF) для поиска редких генетических вариантов, связанных с LTL.Преимущество семейного исследования состоит в том, что можно изучать сегрегацию редких вариантов. Мы выполнили репликационный анализ в Роттердамском исследовании (RS) и Семейном кардиологическом исследовании British Heart Foundation (BHF-FHS). Затем мы объединили данные и провели метаанализ результатов ассоциации всех трех когорт.

Результаты

Описательная статистика семейных и популяционных исследований представлена ​​в таблице 1. Средний возраст при измерении LTL составлял 49 лет (SD = 15.0) в исследовании ERF, и 61% участников исследования составляли женщины. Участники RS были старше (x¯, возраст = 75 лет, SD = 7,7), и 57% участников составляли женщины, в то время как средний возраст в BHF-FHS составлял 58 лет (SD = 8,2), а большинство участников исследования были мужчинами. (26% женщин). Средние значения LTL, измеренные у каждого участника с использованием метода количественной полимеразной цепной реакции (qPCR) как отношение длины теломерного повтора к количеству копий гена с одной копией 36B4 , были выше в исследовании ERF (x¯ LTL = 1.85, SD = 0,35), чем в RS (x¯ LTL = 0,94, SD = 0,18) и BHF-FHS (x¯ LTL = 1,37, SD = 0,22). После корректировки значений LTL для возраста и пола средний LTL был сопоставим между исследованиями (таблица 1).

Таблица 1. Описательная статистика исследуемых популяций.

Манхэттенский график и распределение тестовой статистики [график квантиль-квантиль (QQ), λ = 1,04] анализа WES в исследовании ERF представлены на рисунках 1 и 2, соответственно.Мы наблюдали значимую ассоциацию девяти редких вариантов [частота второстепенных аллелей (MAF) от 0,2% до 0,5%] с LTL, как показано в таблице 2. Порог значимости ( p -значение <1,42 × 10 –7 ) был скорректирован. для множественного тестирования с использованием поправки Бонферрони, основанной на количестве вариантов в анализе (0,05 / 353 075 вариантов). Каждый вариант был отрицательно связан с LTL, и предполагаемые эффекты минорного аллеля этих вариантов были большими (-2,18 <стандартизованный β <-1.34), что свидетельствует о значительном снижении LTL для каждого минорного аллеля.

Рис. 1. Манхэттенский график анализа ассоциации с LTL в исследовании ERF. Этот график показывает –log10 преобразованные p -значения ( y -ось) для всех вариантов, присутствующих в анализе ассоциации, в соответствии с их положением на каждой хромосоме ( x -ось). Красная пунктирная линия представляет собой скорректированный по Бонферрони p -значение порога значимости ( p -значение <1.42 × 10 –7 ), в то время как синяя пунктирная линия представляет p -значение порога предполагаемой значимости ( p -значение ≤ 1,42 × 10 –4 ).

Рисунок 2. График квантиль-квантиль анализа ассоциации с LTL в исследовании ERF. График QQ показывает наблюдаемую статистику теста (ось y ) в сравнении с ожидаемыми значениями статистики теста (ось x ) (распределение X 2 ).Красная линия показывает распределение при нулевой гипотезе.

Таблица 2. Значимые варианты из анализа ассоциации в исследовании ERF.

Восемь верхних вариантов расположены в плотной области на хромосоме 11q22.3 (диапазон положений: 108004687 — 108384666, рисунок 3) и, по-видимому, являются частью гаплотипа, охватывающего C11orf65 , ACAT1 , NPAT , ATM , KDELC2 и EXPH5 гены.Гаплотип может описывать пару генов, унаследованных вместе от одного родителя на одной хромосоме, или он может описывать все гены на хромосоме, которые были унаследованы вместе от одного родителя. Этот гаплотип отделяется от более короткого LTL в семье (дополнительный рисунок 1), где его переносят 14 человек, 11 из которых были родственниками в пределах 4 поколений в соответствии с данными родословной (рисунок 4). Кроме того, оценки генетического родства показывают, что остальные три человека также находятся в родстве в пределах 3–4 поколений.Эти 8 вариантов находятся в сильном неравновесном сцеплении (попарно LD: r 2 между 0,93 и 1,00, D ‘= 1) и показывают очень похожие значения p . Верхний вариант rs185270276 расположен в интроне гена C11orf65 (MAF = 0,5%, β = -1,34, SE = 0,25, p -value = 7,99 × 10 –8 ). Следующие шесть вариантов, значимо связанных с LTL (MAF = 0,5%, β = -1,38, SE = 0,26, p -value = 1,21 × 10 –7 ), расположены в ACAT1 , NPAT , ATM / гены C11orf65 , KDELC2 и EXPH5 .Два из этих шести вариантов являются миссенс-вариантами: rs7

25 ( NPAT , PolyPhen = 1, оценка CADD = 18,1) и rs12146512 ( EXPH5 , PolyPhen = 0,624, оценка CADD = 4,5). Восьмой значимый вариант, rs2234993, расположен в интроне ATM (MAF = 0,5%, β = -1,37, SE = 0,26, p -value = 1,25 × 10 –7 ). Девятый значимый вариант, rs144114619 (MAF = 0,2%, p -value = 1,29 × 10 –7 ), представляет собой миссенс-вариант, расположенный на шестой хромосоме в гене BTN3A1 , который, как предполагается, наносит вред (PolyPhen = 1, оценка CADD = 12.2) и имеет наибольшую величину эффекта (β = −2,18, SE = 0,41). В популяции ERF было шесть носителей этого варианта. Интересно, что четыре из этих носителей также являются носителями редких вариантов в области хромосомы 11q22.3 (дополнительный рисунок 2).

Рисунок 3. График региональной ассоциации для самых популярных совпадений на хромосоме 11. График был построен с использованием LocusZoom (http://locuszoom.org/). Преобразованные –log10 значения p нанесены на ось y .По оси абсцисс показано положение вариантов (точек) на хромосоме 11 и генов в этой области. Наиболее значимый вариант (rs185270276) показан фиолетовым цветом, а цвет точек указывает на степень неравновесия по сцеплению между вариантом и верхним вариантом.

Рисунок 4. График сегрегации редких вариантов на хромосоме 11q22.3 в исследовании ERF. Красным обозначены носители редких вариантов, расположенных на хромосоме 11q22.3. Отношение T / S добавлено под людьми, у которых были доступны данные полного экзомного секвенирования.Квадраты — мужские, а круглые — женские. Умершие люди обозначаются линией, проходящей через этого конкретного человека. Один человек входит в родословную дважды, это показано пунктирной линией.

Для анализа репликации мы использовали данные WES из двух независимых когорт европейского происхождения, RS и BHF-FHS. Результаты анализа репликации показаны в таблице 3 вместе с результатами мета-анализа сводных статистических данных по всем трем когортам для этих вариантов. Шесть из девяти редких вариантов, значимо связанных с LTL в исследовании ERF (расположенные в ACAT1 , NPAT , ATM / C11orf65 , EXPH5 и BTN3A1 ), присутствовали в RS и / или BHF. -FHS, но не были значимыми ( p -значение ≥ 0.21), ассоциированных с LTL ( p -значение <0,025, 0,05 / 2 независимых тестов). Направление действия большинства вариантов было сходным в исследовании ERF и RS, в то время как BHF-FHS показал противоположное направление эффекта для большинства вариантов. Три варианта, расположенные в C11orf65 , KDELC2 и ATM , не присутствовали в данных RS и BHF-FHS. Поскольку они уникальны для изолированной популяции, мы не смогли подтвердить или опровергнуть их связь с LTL в когортах репликации.

Таблица 3. Репликация результатов ассоциативного анализа.

Наконец, чтобы увеличить статистическую мощность, мы выполнили взвешенный с обратной дисперсией метаанализ результатов ассоциации для всех трех когорт с использованием программного обеспечения METAL. Варианты включались в метаанализ, если они присутствовали по крайней мере в двух из трех когорт и имели минимальное количество минорных аллелей, равное пяти в одной или нескольких когортах, что приводило к порогу значимости, скорректированному по множественным тестам, равному 3.02 × 10 –7 (варианты 0,05 / 165 311). Лучшие результаты метаанализа ( p -значение <3,02 × 10 –4 ) доступны в Таблице 4 и в Дополнительной Таблице 1, которые также содержат информацию по конкретной когорте. Графики Манхэттена и QQ представлены на дополнительных рисунках 3 и 4 соответственно. Значение λ 0,97 указывает на то, что мощность была низкой. Несмотря на то, что в метаанализе не было вариантов, значимо связанных с LTL в масштабе всего генома после корректировки для множественного тестирования, многие из основных результатов показывают устойчивый эффект для разных когорт.Вариант, наиболее значимо связанный с LTL, представлял собой высококонсервативный синонимичный вариант (оценка PhastCons = 0,999), расположенный в гене RPL8 на хромосоме 8 (значение p = 1,48 × 10 –6 ), что, как ожидается, будет вредоносный (оценка CADD = 15,11). Кроме того, мы использовали результаты метаанализа, чтобы выполнить поиск вариантов в локусах, идентифицированных предыдущими GWAS европейского происхождения (дополнительная таблица 2). В этих локусах присутствовало 153 варианта, и мы обнаружили убедительные доказательства ( p -значение meta <3.02 × 10 –4 ) для положительной ассоциации редкого варианта с LTL (rs181080831, β = 0,74, SE = 0,19, p -значение = 1,18 × 10 –4 ) в известном локусе RTEL1 .

Таблица 4. Предполагаемые результаты метаанализа ( p -значение ≤ 3,02 × 10 –4 ).

Обсуждение

В семейном исследовании ERF мы идентифицировали девять редких вариантов (MAF от 0,2% до 0,5%), связанных с LTL, путем выполнения анализа ассоциации WES.Восемь наиболее значимо ассоциированных вариантов расположены в области на хромосоме 11q22.3 и разделяются вместе с более короткими LTL в одном семействе. Эта область содержит локус ATM , который, как ранее было показано, участвует в поддержании теломер и стабильности генома и, таким образом, является очевидным геном-кандидатом. В метаанализе когорт открытия и репликации мы идентифицировали другой редкий миссенс-вариант в гене RPL8 , прочно связанный с LTL. Хотя нам не удалось воспроизвести ни одну из ассоциаций, ранее было обнаружено, что ATM и RPL8 являются сильными предикторами длины теломер ( ATM ) и хронологического возраста ( ATM и RPL8 ).

Интересно, что в исследовании ERF мы идентифицировали три уникальных редких варианта в гене ATM (Ataxia Telangiectasia Mutated), ассоциированном с LTL. ATM является гомологом гена Tel1 у дрожжей (Greenwell et al., 1995) и участвует в важных процессах поддержания теломер (Pandita, 2002; Lee et al., 2015; Tong et al., 2015). . Протеинкиназа ATM является главным контроллером сигнальных путей контрольных точек клеточного цикла, необходимых для клеточного ответа на повреждение ДНК и для стабильности генома (https: // www.ncbi.nlm.nih.gov/gene/?term=472). Кроме того, киназа ATM необходима для удлинения теломер (Lee et al., 2015; Tong et al., 2015). ATM участвует в генетическом заболевании атаксия-телеангиэктазия (AT), которое характеризуется мозжечковой атаксией, окулокожной телеангиэктазией, иммунодефицитом и предрасположенностью к раку (Savitsky et al., 1995). Клетки пациентов с AT также обнаруживают слияние теломер и ускоряют укорачивание теломер с возрастом (Metcalfe et al., 1996).Кроме того, ATM был значительно связан с хронологическим возрастом в метаанализе профилей экспрессии генов, показывая более низкое количество транскриптов у пожилых людей (Peters et al., 2015). Хотя генетические варианты в ATM были связаны с различными видами рака (Barrett et al., 2011; Helgason et al., 2015; Ransohoff et al., 2017; Scelo et al., 2017), только один генетический вариант в ATM , rs227080, в целом по геному был значительно связан с LTL в популяции сингапурских китайцев (Dorajoo et al., 2019). Этот вариант не был значительно связан с LTL в исследовании ERF, Rotterdam Study или BHF-FHS, подразумевая, что он не влиял на ассоциацию, наблюдаемую в текущем исследовании.

Анализ сегрегации вариантов в области хромосомы 11q22.3 в исследовании ERF показал, что варианты сегрегируют с более короткими LTL в одном семействе. Мы не обнаружили конкретного заболевания, которое выделяется в этой семье, что может быть объяснено относительно молодым возрастом большинства носителей.В анализе репликации мы не смогли подтвердить ассоциацию девяти вариантов, связанных с LTL в RS и BHF-FHS, из-за отсутствия ассоциации (шесть вариантов) или отсутствия варианта в когортах репликации (три варианта). . Однако возможно, что этот сигнал исходит от вариантов, специфичных для семейства и, следовательно, не может быть передан населению в целом. Сходным образом, также может быть, что весь гаплотип влияет на длину теломер, гаплотип, который, скорее всего, уникален для изолированной популяции ERF.В этом локусе ген ATM в настоящее время является наиболее вероятным геном-возбудителем. Наконец, мы провели метаанализ трех когорт. Верхний вариант метаанализа находится в RPL8 (рибосомный белок L8). Это интересно, поскольку RPL8 вместе с шестью другими RPL генами отрицательно связаны с хронологическим возрастом (Peters et al., 2015). В этом транскриптомном исследовании Peters et al. идентифицировали 1497 генов, уровень экспрессии которых зависит от возраста; этот список генов включает RPL8 и ATM .Мы также обнаружили убедительные доказательства ассоциации нового редкого варианта в известном локусе RTEL1 . Было бы интересно провести метаанализ WES или полногеномного секвенирования с большим размером выборки, чтобы увеличить статистическую мощность.

Преимущество нашего исследования заключается в том, что мы использовали семейную настройку, которая позволила нам показать сегрегацию вариантов, расположенных на хромосоме 11q22.3 в семье. Популяция, изучаемая ERF, показала низкий уровень иммиграции и высокий уровень инбридинга, что увеличило частоту многих редких аллелей (Pardo et al., 2005). Еще одно преимущество состоит в том, что во всех трех исследованиях для количественной оценки LTL использовался стандартизированный метод количественной ПЦР. Однако у нашего исследования есть несколько ограничений. Первое ограничение заключается в том, что наши результаты в исследовании ERF нелегко обобщить на население в целом, поскольку эти результаты могут быть семейными. Однако мы идентифицировали гены, которые, как известно, связаны с теломерными процессами и, таким образом, являются вероятными генами-кандидатами. Вторым ограничением нашего исследования может быть то, что мы использовали измерения длины теломер в крови вместо измерений, специфичных для ткани, хотя предыдущие исследования показали, что средняя длина теломер в крови и других тканях сильно коррелирована (Okuda et al., 2002; Wilson et al., 2008), поэтому мы ожидаем, что это не повлияло на наши выводы. Третье ограничение — разница в распределении LTL между тремя исследованиями, что может быть объяснено разным возрастным распределением в исследованиях. Средний возраст самый низкий в исследовании ERF (49 лет), самый высокий в RS (75 лет), а средний возраст в BHF-FHS находится между ними (58 лет). Поскольку LTL значительно уменьшается с возрастом (Lindsey et al., 1991; Slagboom et al., 1994; Blackburn, 2001) и ассоциируется со смертностью (Cawthon et al., 2003; Кимура и др., 2008; Фитцпатрик и др., 2011; Хониг и др., 2012; Дилен и др., 2014; Роде и др., 2015; Marioni et al., 2016), вариация LTL становится меньше по мере старения населения. Средние значения LTL были сопоставимы между исследованиями после корректировки значений LTL с учетом возраста и пола. Для дальнейшей стандартизации по трем когортам было выполнено z-преобразование значений LTL, в результате чего были получены сопоставимые распределения со средним значением, равным нулю, и стандартным отклонением, равным единице. Тем не менее, эти различия между исследованиями, вместе с небольшим размером выборки когорты BHF-FHS, потенциально могут объяснить отсутствие репликации.Четвертое ограничение заключается в том, что мы не смогли рассчитать влияние вариантов на длину теломер в парах оснований из-за метода количественной оценки LTL в нашем исследовании вместе с z-преобразованием, которое применялось к значениям LTL для стандартизации в когортах.

В заключение, это первое исследование с использованием данных WES для поиска редких генетических вариантов, связанных с LTL, выявило интересные варианты и гены, связанные с более короткими LTL. Восемь из девяти редких вариантов, связанных с LTL, расположены на хромосоме 11q22.3 и все варианты сегрегируют в семействе ERF. Поскольку мы не смогли воспроизвести результаты, будущие исследования д. Дальнейшее изучение этой области и др. Генов, идентифицированных в этом исследовании, чтобы подтвердить их участие в регуляции длины теломер.

Материалы и методы

Исследуемые группы

Популяция, открытая нами, состояла из участников семейного исследования Erasmus Rucphen Family (ERF). В исследовании ERF участвуют примерно 3000 жителей недавнего генетически изолированного сообщества на юго-западе Нидерландов, которое изучается в рамках программы генетических исследований изолированной популяции (Pardo et al., 2005). Все участники ERF являются потомками 22 пар-основателей, у которых было как минимум шестеро детей, крещенных в общинной церкви в 18 веке, или их супругов. Сбор исходных данных, включая забор крови, проводился в период с 2002 по 2005 годы. Поскольку популяция ERF демонстрирует низкий уровень иммиграции и высокий уровень инбридинга, частота нескольких редких аллелей в этой популяции увеличивается (Pardo et al., 2005 ). Исследование ERF было одобрено Комитетом по медицинской этике Медицинского центра Erasmus (MC), Роттердам, Нидерланды.Все участники предоставили письменное информированное согласие, и все расследования проводились в соответствии с Хельсинкской декларацией.

Когорты репликации включали участников Роттердамского исследования (RS) и Семейного исследования сердца Британского фонда сердца (BHF-FHS). RS — это проспективное когортное исследование, которое проводится с 1990 года в четко обозначенном районе Омморд в Роттердаме, Нидерланды. Исходная когорта RS (RS-I) включала 7 983 человека в возрасте 55 лет и старше.Вначале участники были опрошены дома и прошли обширный набор обследований, которые повторялись каждые 3–4 года (Ikram et al., 2017). Роттердамское исследование было одобрено Комитетом по медицинской этике Erasmus MC и Министерством здравоохранения, благосостояния и спорта Нидерландов. Роттердамское исследование было внесено в Национальный реестр исследований Нидерландов (NTR; www.trialregister.nl) и в Международную платформу реестра клинических испытаний ВОЗ (ICTRP; www.who.int/ictrp/network/primary/en/) с общим доступом. каталожный номер NTR6831.Все участники дали письменное информированное согласие на участие в исследовании и на получение информации от лечащих врачей.

В исследовании British Heart Foundation Family Heart участвовали семьи как минимум с двумя братьями и сестрами, у которых была диагностирована преждевременная (<66 лет) ишемическая болезнь сердца (ИБС) в Соединенном Королевстве в период с 1998 по 2003 год. Полная информация представлена ​​в другом месте (Samani et al., 2005 , 2007).

Длина теломер

Средние значения LTL в исследовании ERF и исследовании BHF-FHS были измерены с использованием метода qPCR во всех образцах (Cawthon, 2002).Измерения проводились в Лестере, Великобритания, и детали измерений были описаны ранее (Codd et al., 2010, 2013). Таким образом, средний LTL измеряли в лейкоцитах и ​​выражали как отношение (отношение T / S) длины теломерного повтора (T) к количеству копий гена с одной копией, 36B4 (S). Образцы были количественно определены относительно образца калибратора, используемого в каждом прогоне (ДНК из линии клеток K562) (Codd et al., 2010).

В RS средние значения LTL также были измерены с помощью анализа qPCR, основанного на методе, описанном Cawthon (2002) с небольшими модификациями.Для каждого образца анализ теломер и 36B4 проводили в отдельных лунках, но в одном и том же 384-луночном ПЦР-планшете. Каждая реакция содержала 5 нг ДНК, 1 мкМ каждого из праймеров (теломер tel1b-вперед: GGTT TGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT, tel2b- обратное: GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTA CCCT) или 250 нМ 36B4 праймеров (36B4u-вперед: CAG-CAAGTGGGAAGGTGTAATCC, 36B4d-обратный : CCCATTCT ATCATCAACGGGTACAA) и 1x Quantifast SYBR green PCR Mastermix (Qiagen). Реакции для обоих анализов проводили в двух экземплярах для каждого образца в машине 7900HT (Applied Biosystems).Кт. Относительную длину теломер рассчитывали путем деления Q теста теломер на Q теста 36B4 . Для валидации анализа 96 случайных образцов были проанализированы дважды, и CV этого эксперимента составлял 4,5%.

Секвенирование экзома

Экзомы 1336 участников ERF секвенировали в Центре биомики Erasmus при отделении клеточной биологии, Erasmus MC, Нидерланды. Экзомы случайно выбранной подгруппы из 2628 человек из популяции RS-I были секвенированы в центре генотипирования человека Департамента внутренней медицины, Erasmus MC, Нидерланды.Подробности методов и контроля качества для ERF и RS описаны в других источниках (Amin et al., 2016; van Rooij et al., 2017). В общей сложности 1303 участника ERF и 1257 участников RS имели как последовательность экзома, так и данные LTL, и были включены в этот анализ. Подмножество BHF-FHS, состоящее из 674 неродственных особей кавказского происхождения, которые ранее подвергались секвенированию экзома в рамках Лестерского исследования инфаркта миокарда (Khera et al., 2017) и имели данные LTL (Codd et al., 2010) были включены в этот анализ.

Статистический анализ

Для каждой отдельной когорты количественный анализ ассоциации признаков был проведен с использованием программного обеспечения Rare Variant tests (RVtests), которое поддерживает анализ связанных лиц (Zhan et al., 2016). Анализ ассоциаций проводился с использованием оценочного теста, предполагающего аддитивную модель, подходящую для анализа со связанными и неродственными лицами. Мы применили z-преобразование значений LTL для трех когорт отдельно, чтобы стандартизировать значения по когортам.Все анализы были скорректированы с учетом возраста, пола и эффекта партии (при необходимости). Кроме того, мы скорректировали семейные отношения в ERF, используя матрицу родства, оцененную на основе генотипированных данных, в то время как в RS мы скорректировали первые четыре основных компонента, поскольку четвертый главный компонент был значительно связан с LTL. Были включены только варианты с числом минорных аллелей ≥ 5.

В исследовании ERF мы рассчитали попарную LD ( r 2 и D ‘) между восемью верхними вариантами на хромосоме 11, которые были в значительной степени связаны с LTL, используя команду –ld в PLINK 1.9 (Chang et al., 2015) (www.cog-genomics.org/plink/1.9/). Кроме того, мы выполнили взвешенный метаанализ с обратной дисперсией с использованием программного обеспечения METAL (Willer et al., 2010). При анализе с использованием данных семейного исследования ERF мы скорректировали пороги значимости для множественного тестирования с помощью поправки Бонферрони, в результате чего порог значимости составил 1,42 × 10 –7 (0,05 / 353 075). В анализе репликации, множественное тестирование скорректировало p, пороговое значение было равно 0.025 (0,05 / 2 независимых теста). В метаанализе мы скорректировали количество протестированных вариантов, в результате чего порог значимости составил 3,02 × 10 –7 (0,05 / 165 311).

Заявление о доступности данных

Наборы данных, проанализированные для каждой отдельной когорты, можно запросить, связавшись с ответственным главным исследователем. Из-за ограничений, основанных на правилах конфиденциальности и информированном согласии участников, данные не могут быть доступны в открытом доступе в публичном хранилище.Что касается данных Роттердамского исследования, запросы следует направлять руководящей группе Роттердамского исследования (секретариат[email protected]), у которой есть протокол для утверждения запросов данных.

Заявление об этике

Исследования с участием людей были рассмотрены и одобрены соответствующими комиссиями по медицинской этике, и все исследования проводились в соответствии с Хельсинкской декларацией. Пациенты / участники предоставили письменное информированное согласие на участие в этом исследовании.

Взносы авторов

AS, NA и CD разработали исследование и написали рукопись. AS, SW, CN и SA провели анализ. LB, PA, RB, MD, MH, JR, RK и NA участвовали в сборе данных и предоставили данные. WI, NS, MI, AU и CD были вовлечены в наблюдение за отдельными когортами. AS, SW, CN, DV, NS, VC, NA и CD интерпретировали результаты. Все авторы критически рассмотрели и одобрили рукопись.

Конфликт интересов

AS является сотрудником компании SkylineDx.

Остальные авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Финансирование

Исследование ERF в рамках EUROSPAN (Европейская сеть исследований особых популяций) было поддержано грантом № 018947 STRP Европейской комиссии FP6 (LSHG-CT-2006-01947), а также получено финансирование от Седьмой рамочной программы Европейского сообщества (FP7 / 2007). -2013) / грантовое соглашение HEALTH-F4-2007-201413 Европейской Комиссией в рамках программы «Качество жизни и управление живыми ресурсами» 5-й рамочной программы (No.QLG2-CT-2002-01254). Высокопроизводительный анализ данных ERF поддержан совместным грантом Нидерландской организации научных исследований и Российского фонда фундаментальных исследований (NWO-RFBR 047.017.043). Анализ секвенирования экзома в ERF был поддержан грантом ZonMw (проект 025). AS и CD использовали гранты на обмен от консорциума Personalized PREvention of Chronic DIseases (PRECeDI) (h3020-MSCA-RISE-2014). Создание и управление данными секвенирования экзома для Роттердамского исследования было выполнено Центром генотипирования человека Генетической лаборатории Департамента внутренней медицины, Erasmus MC, Нидерланды.Набор данных по секвенированию экзома финансировался Нидерландской геномной инициативой (NGI) / Нидерландской организацией научных исследований (NWO), спонсируемой Нидерландским консорциумом по здоровому старению (NCHA; проект № 050-060-810), генетической лабораторией Департамента. внутренней медицины, Erasmus MC, а также Проектом дополнения инфраструктуры биобанков и биомолекулярных исследований в Нидерландах (BBMRI-NL; www.bbmri.nl; номер проекта CP2010-41). Роттердамское исследование финансировалось Медицинским центром Erasmus и Университетом Erasmus, Роттердам, Нидерландской организацией исследований и разработок в области здравоохранения (ZonMw), Научно-исследовательским институтом болезней пожилых людей (RIDE), Министерством образования, культуры и науки, Министерством по вопросам здравоохранения, социального обеспечения и спорта, Европейская комиссия (DG XII) и муниципалитет Роттердама.Исследование BHF-FHS финансировалось British Heart Foundation (BHF). Секвенирование экзома в Лестерском исследовании инфаркта миокарда было поддержано грантом 5U54HG003067 Национального института здоровья. CN и NS были поддержаны BHF. Н.С. — старший следователь NIHR.

Благодарности

Исследование ERF: мы благодарны всем участникам исследования и их родственникам, терапевтам и неврологам за их вклад, а также П. Вераарт за ее помощь в генеалогии, Дж.Vergeer за руководство лабораторной работой и P. Snijders за помощь в сборе данных. Роттердамское исследование: мы благодарим г-на Паскаля Арпа, г-жу Мила Джамай и г-на Марин Веркерк за их помощь в создании базы данных секвенирования RS-экзома. Мы благодарны участникам исследования, сотрудникам Роттердамского исследования, а также врачам общей практики и фармацевтам.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https: // www.frontiersin.org/articles/10.3389/fgene.2020.00337/full#supplementary-material

Список литературы

Allsopp, R.C., Vaziri, H., Patterson, C., Goldstein, S., Younglai, E.V., Futcher, A. B., et al. (1992). Длина теломер определяет репликативную способность фибробластов человека. Proc. Natl. Акад. Sci. США 89, 10114–10118. DOI: 10.1073 / pnas.89.21.10114

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Амин, Н., Йованова, О., Адамс, Х., Dehghan, A., Kavousi, M., Vernooij, M. W., et al. (2016). Секвенирование экзома в крупном популяционном исследовании выявило редкий вариант Asn396Ser в гене LIPG, связанный с депрессивными симптомами. Мол. Психиатрия 22, 537–543. DOI: 10.1038 / mp.2016.101

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эндрю Т., Авив А., Фальчи М., Сурдлеску Г. Л., Гарднер Дж. П., Лу X. и др. (2006). Картирование генетических локусов, которые определяют длину теломер лейкоцитов в большой выборке невыбранных пар братьев и сестер. Am. J. Hum. Genet. 78, 480–486. DOI: 10.1086 / 500052

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Барретт, Дж. Х., Илс, М. М., Харланд, М., Тейлор, Дж. К., Эйткен, Дж. Ф., Андресен, П. А. и др. (2011). Полногеномное ассоциативное исследование выявило три новых локуса восприимчивости к меланоме. Нат. Genet. 43, 1108–1113.

Google Scholar

Бенетос, А., Гарднер, Дж. П., Зурейк, М., Лабат, К., Сяобин, Л., Адамопулос, К., и другие. (2004). Короткие теломеры связаны с повышенным атеросклерозом сонных артерий у пациентов с гипертонией. Гипертония 43, 182–185. DOI: 10.1161 / 01.hyp.0000113081.42868.f4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Bischoff, C., Graakjaer, J., Petersen, H.C., Hjelmborg, J., Vaupel, J. W., Bohr, V., et al. (2005). Наследственность длины теломер у пожилых людей и пожилых людей. Twin Res. Гм. Genet. 8, 433–439. DOI: 10.1375 / твин. 8.5.433

CrossRef Полный текст | Google Scholar

Блэкберн Э. Х. и Галл Дж. Г. (1978). Тандемно повторяющаяся последовательность на концах генов внехромосомной рибосомной РНК в Tetrahymena. J. Mol. Биол. 120, 33–53. DOI: 10.1016 / 0022-2836 (78) -2

CrossRef Полный текст | Google Scholar

Bojesen, S. E., Pooley, K. A., Johnatty, S. E., Beesley, J., Michailidou, K., Tyrer, J. P., et al. (2013). Множественные независимые варианты в локусе TERT связаны с длиной теломер и риском рака груди и яичников. Нат. Genet. 45, 371–384.

Google Scholar

Broer, L., Codd, V., Nyholt, D. R., Deelen, J., Mangino, M., Willemsen, G., et al. (2013). Мета-анализ длины теломер у 19 713 субъектов показывает высокую наследуемость, более сильную материнскую наследственность и влияние возраста отца. Eur. J. Hum. Genet. 21, 1163–1168. DOI: 10.1038 / ejhg.2012.303

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бруилетт, С., Сингх, Р. К., Томпсон, Дж.Р., Гудолл А. Х. и Самани Н. Дж. (2003). Длина теломер белых клеток и риск преждевременного инфаркта миокарда. Артериосклер. Тромб. Васк. Биол. 23, 842–846. DOI: 10.1161 / 01.atv.0000067426.96344.32

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бруилет, С. В., Мур, Дж. С., Макмахон, А. Д., Томпсон, Дж. Р., Форд, И., Шеперд, Дж. И др. (2007). Длина теломер, риск ишемической болезни сердца и лечение статинами в исследовании первичной профилактики на западе Шотландии: вложенное исследование случай-контроль. Ланцет 369, 107–114. DOI: 10.1016 / s0140-6736 (07) 60071-3

CrossRef Полный текст | Google Scholar

Коутон Р. М. (2002). Измерение теломер с помощью количественной ПЦР. Nucleic Acids Res. 30: e47.

Google Scholar

Коутон Р. М., Смит К. Р., Обрайен Э., Сиваченко А. и Кербер Р. А. (2003). Связь между длиной теломер в крови и смертностью людей в возрасте 60 лет и старше. Ланцет 361, 393–395.DOI: 10.1016 / s0140-6736 (03) 12384-7

CrossRef Полный текст | Google Scholar

Чанг, К. К., Чоу, К. С., Теллье, Л. К., Ваттикути, С., Перселл, С. М., и Ли, Дж. Дж. (2015). PLINK второго поколения: ответ на вызов более крупных и богатых наборов данных. Gigascience 4: 7.

Google Scholar

Кодд В., Мангино М., Ван дер Харст П., Браунд П. С., Кайзер М., Беверидж А. Дж. И др. (2010). Распространенные варианты около TERC связаны со средней длиной теломер. Нат. Genet. 42, 197–199. DOI: 10,1038 / нг. 532

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кодд, В., Нельсон, К. П., Альбрехт, Э., Мангино, М., Дилен, Дж., Бакстон, Дж. Л. и др. (2013). Идентификация семи локусов, влияющих на среднюю длину теломер и их связь с заболеванием. Нат. Genet. 45, 422–427.

Google Scholar

Deelen, J., Beekman, M., Codd, V., Trompet, S., Broer, L., Hagg, S., et al. (2014).Длина теломер лейкоцитов ассоциируется с предполагаемой смертностью независимо от параметров иммунной системы и известных генетических маркеров. Внутр. J. Epidemiol. 43, 878–886. DOI: 10.1093 / ije / dyt267

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дораджу Р., Чанг, X., Гурунг, Р. Л., Ли, З., Ван, Л., Ван, Р. и др. (2019). Локусы длины теломер лейкоцитов человека в сингапурской китайской популяции и трансэтнические генетические исследования. Нат. Commun. 10: 2491.

Google Scholar

Фитцпатрик А. Л., Кронмал Р. А., Гарднер Дж. П., Псати Б. М., Дженни Н. С., Трейси Р. П. и др. (2007). Длина теломер лейкоцитов и сердечно-сосудистые заболевания в исследовании здоровья сердечно-сосудистой системы. Am. J. Epidemiol. 165, 14–21. DOI: 10.1093 / AJE / kwj346

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фицпатрик, А. Л., Кронмал, Р. А., Кимура, М., Гарднер, Дж. П., Псати, Б. М., Дженни, Н. С., и другие. (2011). Длина теломер лейкоцитов и смертность в исследовании здоровья сердечно-сосудистой системы. J. Gerontol. Биол. Sci. Med. Sci. 66, 421–429.

Google Scholar

Гринвелл, П. В., Кронмал, С. Л., Портер, С. Е., Гассенхубер, Дж., Обермайер, Б., и Питес, Т. Д. (1995). TEL1, ген, участвующий в контроле длины теломер в S. cerevisiae , гомологичен гену атаксии-телеангиэктазии человека. Cell 82, 823–829. DOI: 10.1016 / 0092-8674 (95)

-4

CrossRef Полный текст | Google Scholar

Гродштейн, Ф., Van Oijen, M., Irizarry, M.C., Rosas, H.D., Hyman, B.T., Growdon, J.H., et al. (2008). Более короткие теломеры могут указывать на ранний риск развития деменции: предварительный анализ 62 участников исследования состояния здоровья медсестер. PLoS One 3: e1590. DOI: 10.1371 / journal.pone.0001590

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Харрис, С. Е., Дири, И. Дж., Макинтайр, А., Лэмб, К. Дж., Радхакришнан, К., Старр, Дж. М. и др. (2006). Связь между длиной теломер, физическим здоровьем, когнитивным старением и смертностью у пожилых людей без деменции. Neurosci. Lett. 406, 260–264. DOI: 10.1016 / j.neulet.2006.07.055

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хасти, Н. Д., Демпстер, М., Данлоп, М. Г., Томпсон, А. М., Грин, Д. К., и Олшир, Р. К. (1990). Уменьшение теломер при колоректальной карциноме человека и с возрастом. Природа 346, 866–868. DOI: 10.1038 / 346866a0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Haycock, P.C., Heydon, E.E., Каптоге, С., Баттерворт, А.С., Томпсон, А., и Виллит, П. (2014). Длина теломер лейкоцитов и риск сердечно-сосудистых заболеваний: систематический обзор и метаанализ. BMJ 349: g4227. DOI: 10.1136 / bmj.g4227

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хельгасон, Х., Рафнар, Т., Олафсдоттир, Х.С., Йонассон, Дж. Г., Сигурдссон, А., Стейси, С. Н. и др. (2015). Варианты с потерей функции в ATM создают риск рака желудка. Нат. Genet. 47, 906–910.DOI: 10,1038 / нг.3342

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хониг, Л.С., Канг, М.С., Шупф, Н., Ли, Дж. Х. и Мейе, Р. (2012). Связь более короткой длины теломерного повтора лейкоцитов с деменцией и смертностью. Arch. Neurol. 69, 1332–1339.

Google Scholar

Хубен, Дж. М., Гилтай, Э. Дж., Риус-Оттенхайм, Н., Хагеман, Г. Дж., И Кромхаут, Д. (2011). Длина теломер и смертность у пожилых мужчин: исследование пожилых людей зутфена. J. Gerontol. Биол. Sci. Med. Sci. 66, 38–44. DOI: 10.1093 / gerona / glq164

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Икрам, М.А., Брюссель, Дж. Г. О., Мурад, С. Д., Ван Дуйн, К. М., Франко, О. Х., Гедегебуре, А. и др. (2017). Роттердамское исследование: обновленная информация о целях, дизайне и основных результатах за 2018 год. Eur. J. Epidemiol. 32, 807–850. DOI: 10.1007 / s10654-017-0321-4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хера, А.В., Вон, Х. Х., Пелосо, Г. М., О’душлейн, К., Лю, Д., Стициэль, Н. О. и др. (2017). Связь редких и распространенных вариаций гена липопротеинлипазы с ишемической болезнью сердца. JAMA 317, 937–946.

Google Scholar

Кимура, М., Хьельмборг, Дж. В., Гарднер, Дж. П., Батум, Л., Бримакомб, М., Лу, X. и др. (2008). Длина теломер и смертность: исследование лейкоцитов у пожилых датских близнецов. Am. J. Epidemiol. 167, 799–806. DOI: 10.1093 / AJE / kwm380

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ли, С.С., Борсон, К., Пайк, А. М., Уилан, С. Дж., И Грейдер, К. В. (2015). Киназа ATM необходима для удлинения теломер в клетках мыши и человека. Cell Rep. 13, 1623–1632. DOI: 10.1016 / j.celrep.2015.10.035

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Леви Д., Нойхаузен С. Л., Хант С. К., Кимура М., Хван С. Дж., Чен В. и др. (2010). Полногеномная ассоциация идентифицирует OBFC1 как локус, участвующий в биологии теломер лейкоцитов человека. Proc.Natl. Акад. Sci. США 107, 9293–9298. DOI: 10.1073 / pnas.0

4107

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Линдси, Дж., Макгилл, Н. И., Линдси, Л. А., Грин, Д. К., и Кук, Х. Дж. (1991). У людей с возрастом потеря теломерных повторов in vivo. Mutat. Res. 256, 45–48. DOI: 10.1016 / 0921-8734 (91) -7

CrossRef Полный текст | Google Scholar

Мангино, М., Кристиансен, Л., Стоун, Р., Хант, С. К., Хорват, К., Айзенберг, Д. Т. и др. (2015). DCAF4, новый ген, связанный с длиной теломер лейкоцитов. J. Med. Genet. 52, 157–162. DOI: 10.1136 / jmedgenet-2014-102681

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мангино, М., Хван, С. Дж., Спектор, Т. Д., Хант, С. К., Кимура, М., Фицпатрик, А. Л. и др. (2012). Полногеномный метаанализ указывает на CTC1 и ZNF676 как на гены, регулирующие гомеостаз теломер у людей. Гум. Мол. Genet. 21, 5385–5394.DOI: 10.1093 / hmg / dds382

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Манолио, Т. А., Коллинз, Ф. С., Кокс, Н. Дж., Гольдштейн, Д. Б., Хиндорф, Л. А., Хантер, Д. Дж. И др. (2009). Обнаружение недостающей наследственности сложных заболеваний. Природа 461, 747–753.

Google Scholar

Мариони Р. Э., Харрис С. Э., Шах С., Макрэй А. Ф., фон Зглиницки Т., Мартин-Руис К. и др. (2016). Эпигенетические часы и длина теломер независимо связаны с хронологическим возрастом и смертностью. Внутр. J. Epidemiol . 45, 424–432. DOI: 10.1093 / ije / dyw041

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мартин-Руис, К., Дикинсон, Х. О., Киз, Б., Роуэн, Э., Кенни, Р. А., и фон Зглиницки, Т. (2006). Длина теломер позволяет прогнозировать смертность после инсульта, деменцию и снижение когнитивных функций. Ann. Neurol. 60, 174–180. DOI: 10.1002 / ana.20869

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мартин-Руис, К. М., Гуссеклоо, Дж., Ван Хемст, Д., Фон Зглиницки, Т., и Вестендорп, Р. Г. (2005). Длина теломер в лейкоцитах не связана с заболеваемостью или смертностью в пожилом возрасте: популяционное исследование. Ячейка старения 4, 287–290. DOI: 10.1111 / j.1474-9726.2005.00171.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Маккарти, С., Дас, С., Кречмар, В., Делано, О., Вуд, А. Р., Тоймер, А., и др. (2016). Контрольная панель из 64 976 гаплотипов для вменения генотипа. Нат. Genet. 48, 1279–1283. DOI: 10,1038 / нг.3643

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Меткалф, Дж. А., Паркхилл, Дж., Кэмпбелл, Л., Стейси, М., Биггс, П., Берд, П. Дж. И др. (1996). Ускоренное укорочение теломер при телеангиэктазии атаксии. Нат. Genet. 13, 350–353. DOI: 10.1038 / ng0796-350

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Нидхэм, Б. Л., Рехкопф, Д., Адлер, Н., Грегорич, С., Лин Дж., Блэкберн Э. Х. и др. (2015). Длина теломер лейкоцитов и смертность в национальном обследовании здоровья и питания, 1999-2002 гг. Эпидемиология 26, 528–535. DOI: 10.1097 / ede.0000000000000299

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Njajou, O.T., Hsueh, W.C., Blackburn, E.H., Newman, A.B., Wu, S.H., Li, R., et al. (2009). Ассоциация между длиной теломер, конкретными причинами смерти и годами здоровой жизни в условиях здоровья, старением и составом тела, популяционное когортное исследование. J. Gerontol. Биол. Sci. Med. Sci. 64, 860–864. DOI: 10.1093 / gerona / glp061

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Окуда, К., Бардегес, А., Гарднер, Дж. П., Родригес, П., Ганеш, В., Кимура, М., и др. (2002). Длина теломер у новорожденного. Pediatr. Res. 52, 377–381.

Google Scholar

Пардо, Л. М., Маккей, И., Остра, Б., Ван Дуйн, К. М., и Аульченко, Ю. С. (2005). Эффект генетического дрейфа в молодой генетически изолированной популяции. Ann. Гм. Genet. 69, 288–295. DOI: 10.1046 / j.1469-1809.2005.00162.x

CrossRef Полный текст | Google Scholar

Петерс, М. Дж., Джоханес, Р., Пиллинг, Л. К., Шурманн, К., Коннели, К. Н., Пауэлл, Дж. И др. (2015). Транскрипционный ландшафт периферической крови человека. Нат. Commun. 6: 8570.

Google Scholar

Пули, К. А., Бойзен, С. Э., Вайшер, М., Нильсен, С. Ф., Томпсон, Д., Амин Аль Олама, А., и др. (2013).Полногеномное ассоциативное сканирование (GWAS) для определения средней длины теломер в рамках проекта COGS: выявленные локусы слабо связаны с риском рака, связанного с гормонами. Гум. Мол. Genet. 22, 5056–5064. DOI: 10.1093 / hmg / ddt355

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Рансохофф, К. Дж., Ву, В., Чо, Х. Г., Чахал, Х. К., Лин, Ю., Дай, Х. Дж. И др. (2017). Двухэтапное исследование ассоциации всего генома определяет новый локус восприимчивости, связанный с меланомой. Oncotarget 8, 17586–17592.

Google Scholar

Роде, Л., Нордестгаард, Б. Г., и Бойесен, С. Э. (2015). Длина теломер лейкоцитов периферической крови и смертность среди 64 637 человек из общей популяции. J. Natl. Cancer Inst. 107: djv074.

Google Scholar

Самани Н. Дж., Бертон П., Мангино М., Болл С. Г., Балмфорт А. Дж., Барретт Дж. И др. (2005). Полногеномное исследование связи 1933 семей, страдающих преждевременной ишемической болезнью сердца: исследование семейного сердца, проведенное британским фондом сердца (BHF). Am. J. Hum. Genet. 77, 1011–1020. DOI: 10.1086 / 498653

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Самани, Н. Дж., Эрдманн, Дж., Холл, А. С., Хенгстенберг, К., Мангино, М., Майер, Б. и др. (2007). Общегеномный ассоциативный анализ ишемической болезни сердца. N. Engl. J. Med. 357, 443–453.

Google Scholar

Савицкий К., Бар-Шира А., Гилад С., Ротман Г., Зив Ю., Ванагайте Л. и др. (1995). Один ген атаксии телеангиэктазии с продуктом, подобным киназе PI-3. Наука 268, 1749–1753. DOI: 10.1126 / science.7792600

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Scelo, G., Purdue, M. P., Brown, K. M., Johansson, M., Wang, Z., Eckel-Passow, J. E., et al. (2017). Полногеномное ассоциативное исследование выявляет множественные локусы риска почечно-клеточного рака. Нат. Commun. 8: 15724.

Google Scholar

Slagboom, P. E., Droog, S., and Boomsma, D. I. (1994). Генетическое определение размера теломер у людей: двойное исследование трех возрастных групп. Am. J. Hum. Genet. 55, 876–882.

Google Scholar

Strandberg, T. E., Saijonmaa, O., Tilvis, R. S., Pitkala, K. H., Strandberg, A. Y., Miettinen, T. A., et al. (2011). Связь длины теломер у пожилых мужчин со смертностью и индексом массы тела среднего возраста и курением. J. Gerontol. Биол. Sci. Med. Sci. 66, 815–820. DOI: 10.1093 / gerona / glr064

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Тонг, А.С., Стерн, Дж.L., Sfeir, A., Kartawinata, M., De Lange, T., Zhu, X. D., et al. (2015). Передача сигналов ATM и ATR регулирует рекрутирование теломеразы человека на теломеры. Cell Rep. 13, 1633–1646. DOI: 10.1016 / j.celrep.2015.10.041

PubMed Аннотация | CrossRef Полный текст | Google Scholar

van Rooij, J. G. J., Jhamai, M., Arp, P. P., Nouwens, S. C. A., Verkerk, M., Hofman, A., et al. (2017). Популяционная генетическая изменчивость в больших наборах данных секвенирования: почему больше данных все же лучше. Eur. J. Hum. Genet. 25, 1173–1175. DOI: 10.1038 / ejhg.2017.110

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Васа-Никотера, М., Бруилет, С., Мангино, М., Томпсон, Дж. Р., Браунд, П., Клемитсон, Дж. Р. и др. (2005). Картирование главного локуса, определяющего длину теломер у человека. Am. J. Hum. Genet. 76, 147–151. DOI: 10.1086 / 426734

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Виллейт, П., Виллейт, Дж., Brandstatter, A., Ehrlenbach, S., Mayr, A., Gasperi, A., et al. (2010a). Клеточное старение, отражаемое длиной теломер лейкоцитов, предсказывает прогрессирующий атеросклероз и риск сердечно-сосудистых заболеваний. Артериосклер. Тромб. Васк. Биол. 30, 1649–1656. DOI: 10.1161 / atvbaha.110.205492

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Виллейт, П., Виллейт, Дж., Клосс-Брандштаттер, А., Кроненберг, Ф., и Кихл, С. (2011). Пятнадцатилетнее наблюдение связи между длиной теломер и заболеваемостью раком и смертностью от рака. JAMA 306, 42–44.

Google Scholar

Willeit, P., Willeit, J., Mayr, A., Weger, S., Oberhollenzer, F., Brandstatter, A., et al. (2010b). Длина теломер и риск возникновения рака и смертность от рака. JAMA 304, 69–75.

Google Scholar

Виллер, К. Дж., Ли, Ю., и Абекасис, Г. Р. (2010). МЕТАЛЛ: быстрый и эффективный мета-анализ сканирования ассоциаций в масштабе всего генома. Биоинформатика 26, 2190–2191. DOI: 10.1093 / биоинформатика / btq340

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Уилсон, В.Р., Герберт, К. Е., Мистри, Ю., Стивенс, С. Е., Патель, Х. Р., Гастингс, Р. А. и др. (2008). Содержание теломер ДНК лейкоцитов в крови позволяет прогнозировать содержание ДНК теломер сосудов у людей с сосудистыми заболеваниями и без них. Eur. Heart J. 29, 2689–2694. DOI: 10.1093 / eurheartj / ehn386

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чжан, X., Ху, Ю., Ли, Б., Абекасис, Г. Р., и Лю, Д. Дж. (2016). RVTESTS: эффективный и всеобъемлющий инструмент для анализа ассоциации редких вариантов с использованием данных о последовательностях. Биоинформатика 32, 1423–1426. DOI: 10.1093 / биоинформатика / btw079

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Поиск ассоциаций по всему транскриптому генов и генетических вариантов, которые связаны с ИМТ и прибавкой в ​​весе во время беременности у женщин с диабетом 1 типа | Молекулярная медицина

  • Андерссон Э.С., Сильвентоинен К., Тайнелиус П., Нор Э.А., Соренсен ТИА, Расмуссен Ф. Наследственность гестационного набора веса — исследование близнецов на основе шведских регистров.Twin Res Hum Genet. 2015; 18 (4): 410–8.

    PubMed Статья PubMed Central Google ученый

  • Barbati SA, Colussi C, Bacci L, Aiello A, Re A, Stigliano E, et al. Фактор транскрипции CREM опосредует высокий ответ глюкозы в кардиомиоцитах и ​​в модели длительной гипергликемии у мышей-самцов. Эндокринология. 2017; 158 (7): 2391–405.

    CAS PubMed Статья PubMed Central Google ученый

  • Башир М., Наем Э, Таха Ф, Конье Дж. К., Абу-Самра, AB.Исходы сахарного диабета 1 типа при беременности; влияние чрезмерной гестационной прибавки в весе и гипергликемии на рост плода. Синдр диабетического метаболизма Clin Res Rev.2019; 13 (1): 84–8.

    Артикул Google ученый

  • Beckers S, De Freitas F, Zegers D, Mertens IL, Verrijken A, Van Camp JK, et al. Нет убедительных доказательств ассоциации полиморфизмов гена рецептора адипонектина 1, AdipoR1, с распространенным ожирением. Эндокринная.2013. 43 (1): 120–6.

    CAS PubMed Статья PubMed Central Google ученый

  • Berglind D, Müller P, Willmer M, Sinha I, Tynelius P, Näslund E, et al. Дифференциальное метилирование в генах воспаления и диабета 2 типа у братьев и сестер, родившихся до и после бариатрической хирургии матери. Ожирение. 2016; 24 (1): 250–61.

    CAS PubMed Статья PubMed Central Google ученый

  • Capittini C, Pasi A, Bergamaschi P, Tinelli C, De Silvestri A, Mercati MP, et al.Гаплотипы HLA и вариации веса при рождении: будет ли ваше будущее светлым или тяжелым? Тканевые антигены. 2009. 74 (2): 156–63.

    CAS PubMed Статья PubMed Central Google ученый

  • Селия Б., Ричард Х., Чинез О., Кейси Э., Элизабет П., Макаули А. Декларация Сент-Винсента — 25 лет спустя: обзор случаев материнской смертности, представленных в конфиденциальную комиссию по расследованию в Великобритании, и извлеченные уроки. Eur J Obstet Gynecol Reprod Biol.2016; 206: e139–40.

    Артикул Google ученый

  • Cheng M, Mei B, Zhou Q, Zhang M, Huang H, Han L, et al. Вычислительный анализ локусов, ассоциированных с ожирением, созданный в результате полногеномных ассоциативных исследований. PLoS ONE. 2018; 13: 7.

    Google ученый

  • Клеменсон Б., Бабо М., Трезеге В. Митохондриальный носитель АДФ / АТФ (семейство SLC25): патологические последствия его дисфункции.Vol. 34, Молекулярные аспекты медицины. 2013. с. 485–93.

  • Correa-Rodríguez M, Schmidt-RioValle J, Rueda-Medina B. Полиморфизм rs7117858 SOX6 связан с остеопорозом и фенотипами, связанными с ожирением. Eur J Clin Invest. 2018; 48: 10.

    Артикул CAS Google ученый

  • Cyganek K, Skupien J, Katra B, Hebda-Szydlo A, Janas I, Trznadel-Morawska I, et al. Риск макросомии остается зависимым от глюкозы в группе женщин с прегестационным диабетом 1 типа и хорошим гликемическим контролем.Эндокринная. 2017; 55 (2): 447–55.

    CAS PubMed Статья PubMed Central Google ученый

  • Дэн Х, Ян Й, Сун Х, Ци В., Дуань Й, Цянь Ю. Анализ полногеномного метилирования и профилей экспрессии генов в висцеральной сальниковой жировой ткани беременных с гестационным сахарным диабетом. J Chinese Med Assoc. 2018; 81 (7): 623–30.

    Артикул Google ученый

  • ДиСтефано Дж., Кингсли С., Крейг Вуд Дж., Чу Х, Аргиропулос Дж., Стилл CD и др.Полногеномный анализ содержания липидов в печени при крайнем ожирении. Acta Diabetol. 2014. 52 (2): 373–82.

    PubMed PubMed Central Статья CAS Google ученый

  • Доганай Л., Катринли С., Колак Y, Сенаты Е, Земхери Е., Озтюрк О. и др. Аллели HLA DQB1 связаны с неалкогольной жировой болезнью печени. Mol Biol Rep. 2014; 41 (12): 7937–43.

    CAS PubMed Статья PubMed Central Google ученый

  • Дори-Даян Н., Цукерман-Яффе Т., Земет Р., Коэн О., Мазаки-Тови С., Йоэли-Ульман Р.1013: Увеличение веса во время беременности не влияет на потребность в инсулине во время беременности у женщин с диабетом 1 типа. Am J Obstet Gynecol. 2020; 222 (1): S630–1.

    Артикул Google ученый

  • Düvel K, Yecies JL, Menon S, Raman P, Lipovsky AI, Souza AL, et al. Активация регуляторной сети метаболических генов ниже комплекса mTOR 1. Mol Cell. 2010. 39 (2): 171–83.

    PubMed PubMed Central Статья CAS Google ученый

  • Эллис К.Л., Чжоу Ю., Бешанский Д.Р., Айнехсазан Э., Селкер Х.П., Куплес Л.А. и др.Генетические модификаторы ответа на инфузию глюкозы-инсулина-калия (GIK) при острых коронарных синдромах и ассоциации с клиническими исходами в исследовании IMMEDIATE. Pharmacogenomics J. 2015; 15 (6): 488–95.

    CAS PubMed PubMed Central Статья Google ученый

  • Eyerahi BF, Mancilla-Herrera I, Espino Y Sosa S, Ortiz-Ramirez M, Flores-Rueda V, Ibargüengoitia-Ochoa F, et al. Популяции макрофагов во висцеральной жировой ткани беременных женщин: потенциальная роль ожирения в воспалении матери.Int J Mol Sci. 2018; 19: 4.

  • Fang CY, Yu CC, Liao YW, Hsieh PL, Lu MY, Lin KC и др. LncRNA LINC00974 активирует передачу сигналов TGF-β / Smad, способствуя фиброгенезу полости рта. J Oral Pathol Med. 2019; 48 (2): 151–8.

    CAS PubMed PubMed Central Google ученый

  • Fensterseifer SR, Austin KJ, Ford SP, Александр BM. Влияние материнского ожирения на концентрацию адипонектина в плазме матери и плода и экспрессию адипонектина и его рецепторных генов в семядольной и жировой тканях в середине и конце беременности у овец.Anim Reprod Sci. 2018; 197: 231–9.

    CAS PubMed Статья PubMed Central Google ученый

  • Федорчук К., Сазанов Л.А. Структура митохондриального комплекса I млекопитающих и мутации, вызывающие заболевание. Vol. 28, Тенденции в клеточной биологии. 2018. с. 835–67.

  • Finlin BS, Zhu B, Confides AL, Westgate PM, Harfmann BD, Dupont-Versteegden EE, et al. Тучные клетки способствуют появлению сезонного белого жира у людей.Диабет. 2017; 66 (5): 1237–46.

    CAS PubMed PubMed Central Статья Google ученый

  • Forde N, Duffy GB, McGettigan PA, Browne JA, Mehta JP, Kelly AK, et al. Доказательства ранней реакции эндометрия на беременность у крупного рогатого скота: как зависимые, так и независимые от интерферона тау. Physiol Genomics. 2012. 44 (16): 799–810.

    CAS PubMed Статья PubMed Central Google ученый

  • Fujii T, Nagamatsu T, Schust DJ, Ichikawa M, Kumasawa K, Yabe S, et al.Плацентарная экспрессия рецепторов лизофосфатидовой кислоты при нормальной беременности и преэклампсии. Am J Reprod Immunol. 2019; 82: 5.

    Артикул CAS Google ученый

  • Gamazon ER, Wheeler HE, Shah KP, Mozaffari SV, Aquino-Michaels K, Carroll RJ, et al. Метод ассоциации на основе генов для картирования признаков с использованием эталонных данных транскриптома. Нат Жене. 2015; 47 (9): 1091–8.

    CAS PubMed PubMed Central Статья Google ученый

  • Gentili A, Zaibi MS, Alomar SY, De Vuono S, Ricci MA, Alaeddin A, et al.Уровни циркуляции адипокинов, моноцитарного хемотаксического белка-4 (MCP-4), макрофагального воспалительного белка-1β (MIP-1β) и эотаксина-3 при тяжелом ожирении и после бариатрической хирургии. Horm Metab Res. 2016; 48 (12): 847–53.

    CAS PubMed Статья PubMed Central Google ученый

  • Гонг Ю.Л., Тао С.Дж., Ху М., Чен Дж.Ф., Цао ХФ, Львов Г.М. и др. Экспрессия рецепторов лизофосфатидной кислоты и местная инвазивность и метастазирование при китайском раке поджелудочной железы.Curr Oncol. 2012; 19: 1.

    Артикул Google ученый

  • Гутай П., Завейска А., Мантай Ю., Вендер-Ожеговска Е. Детерминанты преэклампсии у женщин с диабетом 1 типа. Acta Diabetol. 2017; 54 (12): 1115–21.

    PubMed PubMed Central Статья Google ученый

  • Хан К., Хассанзаде С., Сингх К., Менацза С., Нгуен Т.Т., Стивенс М.В. и др. Паркин-регуляция CHOP модулирует восприимчивость к стрессу эндоплазматического ретикулума сердца.Научный доклад 2017; 7: 1.

    Артикул CAS Google ученый

  • He J, Ford HC, Carroll J, Ding S, Fearnley IM, Walker JE. Сохранение перехода митохондриальной проницаемости в отсутствие субъединицы c АТФ-синтазы человека. Proc Natl Acad Sci USA. 2017; 114 (13): 3409–14.

    CAS PubMed Статья PubMed Central Google ученый

  • Hebbar P, Abu-Farha M, Alkayal F, Nizam R, Elkum N, Melhem M, et al.Полногеномное исследование ассоциации выявляет новые варианты риска от RPS6KA1, CADPS, VARS и DHX58 для глюкозы в плазме натощак в арабской популяции. Научный доклад 2020; 10: 1.

    Артикул CAS Google ученый

  • Hormozdiari F, van de Bunt M, Segrè AV, Li X, Joo JWJ, Bilow M, et al. Совместная локализация сигналов GWAS и eQTL обнаруживает гены-мишени. Am J Hum Genet. 2016; 99 (6): 1245–60.

    CAS PubMed PubMed Central Статья Google ученый

  • Hsiung CN, Chang YC, Lin CW, Chang CW, Chou WC, Chu HW, et al.Причинно-следственная связь циркулирующего триглицерида и гликированного гемоглобина: исследование менделевской рандомизации. J Clin Endocrinol Metab. 2020; 105: 3.

    Артикул Google ученый

  • Hu YW, Guo FX, Xu YJ, Li P, Lu ZF, McVey DG, et al. Длинная некодирующая РНК NEXN-AS1 смягчает атеросклероз, регулируя актин-связывающий белок NEXN. J Clin Invest. 2019; 129 (3): 1115–28.

    PubMed PubMed Central Статья Google ученый

  • Хуанг И, Ван Л., Беннетт Б., Уильямс Р.В., Ван Ю.Дж., Гу В.К. и др.Потенциальная роль Atp5g3 в эпигенетической регуляции предпочтения алкоголя или ожирения с точки зрения генома мышей. Genet Mol Res. 2013; 12 (3): 3662–74.

    CAS PubMed PubMed Central Статья Google ученый

  • Huyghe JR, Jackson AU, Fogarty MP, Buchkovich ML, Stančáková A, Stringham HM, et al. Анализ массива экзомов позволяет идентифицировать новые локусы и низкочастотные варианты, влияющие на процессинг и секрецию инсулина. Нат Жене.2013. 45 (2): 197–201.

    CAS PubMed Статья PubMed Central Google ученый

  • Hwang JY, Sim X, Wu Y, Liang J, Tabara Y, Hu C и др. Полногеномный метаанализ ассоциации выявляет новые варианты, связанные с глюкозой плазмы натощак у жителей Восточной Азии. Диабет. 2015; 64 (1): 291–8.

    CAS PubMed Статья PubMed Central Google ученый

  • Игнасио Р.М.К., Гиббс С.Р., Ли Э.С., Сын Д.С.Дифференциальная сигнатура хемокинов между преадипоцитами и адипоцитами человека. Immune Netw. 2016; 16 (3): 189–94.

    PubMed PubMed Central Статья Google ученый

  • Игучи Х., Икеда Й., Окамура М., Танака Т., Урасима Й., Огучи Х. и др. SOX6 ослабляет секрецию инсулина, стимулированную глюкозой, подавляя транскрипционную активность PDX1, и подавляется у мышей с гиперинсулинемическим ожирением. J Biol Chem. 2005. 280 (45): 37669–80.

    CAS PubMed Статья PubMed Central Google ученый

  • Кан М., Ли С.М., Ким В., Ли К.Х., Ким Д.Й. Fubp1 поддерживает ось лактат-Akt-mTOR посредством активации Hk1 и Hk2. Biochem Biophys Res Commun. 2019; 512 (1): 93–9.

    CAS PubMed Статья PubMed Central Google ученый

  • Karnes JH, Bastarache L, Shaffer CM, Gaudieri S, Xu Y, Glazer AM и др.Сканирование по всему феному позволяет выявлять множественные заболевания и фенотипы степени тяжести, связанные с вариантами HLA. Sci Transl Med. 2017; 9: 389.

    Артикул Google ученый

  • Картик Д., Илавенил С., Калисваран Б., Сунил С., Равикумар С. Протеомный анализ белков плазмы у диабетических крыс с помощью 2D-электрофореза и MALDI-TOF-MS. Appl Biochem Biotechnol. 2012. 166 (6): 1507–19.

    CAS PubMed Статья PubMed Central Google ученый

  • Като М.Функциональная протеомика, генетика человека и биология рака членов семьи GIPC. Exp Mol Med. 2013; 45: 1.

    Артикул CAS Google ученый

  • Кавай В.К., Нвосу СК, Курник Д., Харрелл Ф.Е., Штейн С.М. Варианты генов, связанных с ИМТ, и адренергических генов не связаны с траекторией гестационного веса. Ожирение. 2019; 27 (7): 1184–9.

    CAS PubMed PubMed Central Google ученый

  • Кавасаки К., Абэ М., Тада Ф., Токумото Ю., Чен С., Мияке Т. и др.Блокада передачи сигналов фактора активации В-клеток усиливает стеатоз печени, вызванный диетой с высоким содержанием жиров, и улучшает чувствительность к инсулину. Lab Investig. 2013; 93 (3): 311–21.

    CAS PubMed Статья PubMed Central Google ученый

  • Kershaw EE, Hamm JK, Verhagen LAW, Peroni O, Katic M, Flier JS. Жировая триглицерид липаза: функция, регуляция инсулином и сравнение с адипонутрином. Диабет. 2006. 55 (1): 148–57.

    CAS PubMed PubMed Central Статья Google ученый

  • Keustermans G, Van Der Heijden LB, Boer B, Scholman R, Nuboer R, Pasterkamp G, et al. Дифференциальная экспрессия рецепторов адипокина на подгруппах циркулирующих лейкоцитов у худых и тучных детей. PLoS ONE. 2017; 12: 10.

    Артикул CAS Google ученый

  • Кобаяши Х., Ямадзаки С., Такашима С., Лю В., Окуда Х, Ян Дж. И др.Удаление Rnf213 замедляет прогрессирование диабета у мышей Akita. Biochem Biophys Res Commun. 2013. 432 (3): 519–25.

    CAS PubMed Статья PubMed Central Google ученый

  • Коминиарек М.А., Миротворец А.М. Увеличение веса во время беременности. Am J Obst Gynecol. 2017; 217: 642–51.

    Артикул Google ученый

  • Kowalczyk-Zieba I, Woclawek-Potocka I, Wasniewski T, Boruszewska D, Grycmacher K, Sinderewicz E, et al.LPAR2 и LPAR4 являются основными рецепторами, ответственными за действия LPA в эндометриоидных кистах яичников. Reprod Sci. 2019; 26 (1): 139–50.

    CAS PubMed Статья PubMed Central Google ученый

  • Кусич Д., Коннолли Дж., Кайнулайнен Х., Семенова Е.А., Борисов О.В., Ларин А.К. и др. Бета-серин / треонин-протеинкиназа, специфичная для поперечно-полосатых мышц, отделяется с высокой или низкой чувствительностью к тренировкам на выносливость. Physiol Genomics.2020; 52 (1): 35–46.

    PubMed Статья CAS PubMed Central Google ученый

  • Лоулор Д.А., Фрейзер А., Макдональд-Уоллис С., Нельсон С.М., Палмер Т.М., Смит Г.Д. и др. Генетические варианты, связанные с ожирением матери и потомства, и прибавка в весе во время беременности. Am J Clin Nutr. 2011; 94 (1): 149–55.

    CAS PubMed PubMed Central Статья Google ученый

  • Leow SC, Poschmann J, Too PG, Yin J, Joseph R, McFarlane C, et al.Фактор транскрипции SOX6 способствует возникновению ожирения, способствуя адипогенезу. Dev. 2016. 143 (6): 950–61.

    CAS Статья Google ученый

  • Li B, Verma SS, Veturi YC, Verma A, Bradford Y, Haas DW и др. Оценка предикса для определения приоритетов ассоциаций GWAS и прогнозирования экспрессии генов. В: Тихоокеанский симпозиум по биокомпьютингу. 2018. с. 448–59.

  • Li C, Ge M, Yin Y, Luo M, Chen D.Подавление экспрессии рибосомных белков L26 и L29 за счет вмешательства РНК ингибирует пролиферацию клеток рака поджелудочной железы человека PANC-1. Mol Cell Biochem. 2012. 370 (1–2): 127–39.

    CAS PubMed Статья PubMed Central Google ученый

  • Li XC, Hu QK, Chen L, Liu SY, Su S, Tao H, et al. HSPB8 способствует слиянию аутофагосомы и лизосомы во время аутофагии в нейронах диабета. Int J Med Sci. 2017; 14 (13): 1335–41.

    CAS PubMed PubMed Central Статья Google ученый

  • Li XF, Литтон Дж. Важная роль K + -зависимого Na + / Ca2 + -обменника, NCKX4, в зависимой от меланокортин-4-рецептора сытости. J Biol Chem. 2014. 289 (37): 25445–59.

    CAS PubMed PubMed Central Статья Google ученый

  • Лин Х.М., Ли Дж.Х., Ядав Х., Камараджу А.К., Лю Э., Чжиган Д. и др.Передача сигналов трансформирующего фактора роста-β / Smad3 регулирует транскрипцию гена инсулина и функцию β-клеток островков поджелудочной железы. J Biol Chem. 2009. 284 (18): 12246–57.

    CAS PubMed PubMed Central Статья Google ученый

  • Лю Ф.Х., Сон Дж.Й., Шан XR, Мэн XR, Ма Дж., Ван Х.Дж. Взаимодействие ген-ген пути INSIG-SCAP-SREBP на риск ожирения у китайских детей. Biomed Res Int. 2014; 2014: 1.

    CAS Google ученый

  • Лю YZ, Pei YF, Liu JF, Yang F, Guo Y, Zhang L и др.Мощный двумерный анализ ассоциации по всему геному предполагает, что ген SOX6 влияет на фенотипы ожирения и остеопороза у мужчин. PLoS ONE. 2009; 4: 8.

    Google ученый

  • Лю З., Ли К., Канг Н., Малхи Х., Шах В.Х., Майерс Дж.Л. Перекрестная связь трансформирующего фактора роста (TGF) с ответом развернутого белка имеет решающее значение для активации звездчатых клеток печени. J Biol Chem. 2019; 294 (9): 3137–51.

    CAS PubMed PubMed Central Статья Google ученый

  • Loucks CM, Bialas NJ, Dekkers MPJ, Walker DS, Grundy LJ, Li C, et al.PACRG, белок, связанный с подвижностью ресничек, опосредует клеточную сигнализацию. Mol Biol Cell. 2016; 27 (13): 2133–44.

    PubMed PubMed Central Статья Google ученый

  • Ludwig-Słomczyńska AH, Seweryn MT, Kapusta P, Pitera E, Handelman SK, Mantaj U, et al. Митохондриальный GWAS и ассоциация ядерно-митохондриального эпистаза с ИМТ у пациентов с СД1. BMC Med Genomics. 2020; 13: 1.

    Артикул CAS Google ученый

  • Luecke E, Cohen AK, Brillante M, Rehkopf DH, Coyle J, Hendrick CE, et al.Сходство веса матери и веса при рождении во время беременности и у сестер. Здоровье матери и ребенка J. 2019; 1: 138–47.

    Артикул Google ученый

  • Манкузо Н., Ши Х., Годдард П., Кичаев Г., Гусев А., Пасанюк Б. Интеграция экспрессии генов со сводной статистикой ассоциации для идентификации генов, связанных с 30 сложными признаками. Am J Hum Genet. 2017; 100 (3): 473–87.

    CAS PubMed PubMed Central Статья Google ученый

  • Mastella LS, Weinert LS, Gnielka V, Hirakata VN, Oppermann MLR, Silveiro SP и др.Влияние прибавки в весе матери на вес при рождении: когорта гестационного диабета. Arch Endocrinol Metab. 2018; 62 (1): 48–56.

    Артикул Google ученый

  • Маквортер К.Л., Бауэрс К., Долан Л.М., Дека Р., Джексон К.Л., Хури Дж.С. Влияние прибавки в весе во время беременности и индекса массы тела перед беременностью на распространенность детей с большим для гестационного возраста возрастом в двух когортах женщин с инсулинозависимым диабетом 1 типа: поперечное популяционное исследование.BMJ Open. 2018; 8: 3.

    Артикул Google ученый

  • Мешеде Дж., Шадич М., Фуртманн Н., Мидема Т., Зехр Д.А., Мюллер-Ришарт А.К. и др. Продукт гена PACRG, корегулируемый паркином, способствует передаче сигналов TNF за счет стабилизации LUBAC. Sci Signal. 2020; 13: 617.

    Артикул CAS Google ученый

  • Мойзини И., Дэвидсон А. BAFF: местная и системная мишень при аутоиммунных заболеваниях.Clin Exp Immunol. 2009. 158: 155–63.

    CAS PubMed PubMed Central Статья Google ученый

  • Муньос-Муньос Э., Краузе Б.Дж., Уауи Р., Касанелло П. LGA-новорожденный от пациентов с прегестационным ожирением демонстрирует сниженную адипонектин-опосредованную релаксацию сосудов и эндотелиальную дисфункцию в фетоплацентарных артериях. J. Cell Physiol. 2018; 233 (10): 6723–33.

    PubMed Статья CAS PubMed Central Google ученый

  • Муро С., Мияке Ю., Като Х., Цуцуми К., Ямамото К.Сывороточные антитела к рибосомному белку L29 60s как новый прогностический маркер неоперабельного рака поджелудочной железы. Пищеварение. 2015; 91 (2): 164–73.

    CAS PubMed Статья PubMed Central Google ученый

  • Ng MCY, Shriner D, Chen BH, Li J, Chen WM, Guo X и др. Мета-анализ полногеномных ассоциативных исследований афроамериканцев дает представление о генетической архитектуре диабета 2 типа. PLoS Genet. 2014; 10: 8.

    Артикул CAS Google ученый

  • Nunnery D, Ammerman A, Dharod J. Предикторы и исходы избыточной гестационной прибавки в весе среди беременных женщин с низкими доходами. Health Care Women Int. 2018; 39 (1): 19–33.

    PubMed Статья PubMed Central Google ученый

  • Падилла Дж., Дженкинс Н.Т., Торн П.К., Мартин Дж. С., Скотт Ректор Р., Уэйд Дэвис Дж и др.Идентификация генов, экспрессия которых изменяется из-за ожирения по всему артериальному дереву. Physiol Genomics. 2014. 46 (22): 821–32.

    PubMed PubMed Central Статья CAS Google ученый

  • Пендин Д., Греотти Э., Поццан Т. Неуловимая важность того, чтобы быть митохондриальным унипортером Са2 +. Клеточный кальций. 2014; 55: 139–45.

    CAS PubMed Статья PubMed Central Google ученый

  • Петерс К.Э., Бейлби Дж., Кэдби Дж., Уоррингтон Н.М., Брюс Д.Г., Дэвис В.А. и др.Всестороннее исследование вариантов генов, кодирующих адипонектин (ADIPOQ) и его рецепторы (ADIPOR1 / R2), и их связь с сывороточным адипонектином, диабетом 2 типа, инсулинорезистентностью и метаболическим синдромом. BMC Med Genet. 2013; 14: 1.

    Артикул CAS Google ученый

  • Piccolis M, Bond LM, Kampmann M, Pulimeno P, Chitraju C, Jayson CBK, et al. Исследование глобальных клеточных реакций на липотоксичность, вызванную насыщенными жирными кислотами.Mol Cell. 2019; 74 (1): 32-44.e8.

    CAS PubMed PubMed Central Статья Google ученый

  • Родригес-Араухо Г., Накагами Х., Хаяси Х., Мори М., Сиучи Т., Минокоши Ю. и др. Альфа-синуклеин вызывает захват и утилизацию глюкозы в адипоцитах посредством пути трансдукции Gab1 / PI3K / Akt. Cell Mol Life Sci. 2013. 70 (6): 1123–33.

    CAS PubMed Статья PubMed Central Google ученый

  • Rudkowska I., Pérusse L, Bellis C, Blangero J, Després JP, Bouchard C, et al.Взаимодействие между распространенными генетическими вариантами и общим потреблением жира на пиковом диаметре частиц липопротеинов низкой плотности: исследование ассоциации на уровне всего генома. J Nutrigenet Nutrigenomics. 2015; 8 (1): 44–53.

    CAS PubMed Статья PubMed Central Google ученый

  • Rys PM, Ludwig-Slomczynska AH, Cyganek K, Malecki MT. Непрерывная подкожная инфузия инсулина по сравнению с несколькими ежедневными инъекциями у беременных с сахарным диабетом 1 типа: систематический обзор и метаанализ рандомизированных контролируемых исследований и обсервационных исследований.Eur J Endocrinol. 2018; 178 (5): 545–63.

    CAS PubMed Статья PubMed Central Google ученый

  • Saxena R, Elbers CC, Guo Y, Peter I, Gaunt TR, Mega JL и др. Крупномасштабный геноцентрический метаанализ 39 исследований позволяет выявить локусы диабета 2 типа. Am J Hum Genet. 2012; 90 (3): 410–25.

    CAS PubMed PubMed Central Статья Google ученый

  • Шнеткамп ЦБК.Семейство гена SLC24 обменников Na + / Ca2 + -K +: от зрения и запаха до консолидации памяти и пигментации кожи. Мол Аспекты Мед. 2013; 34: 455–64.

    CAS PubMed Статья PubMed Central Google ученый

  • Scifres CM, Feghali MN, Althouse AD, Caritis SN, Catov JM. Влияние избыточной гестационной прибавки в весе на исходы беременности у женщин с диабетом 1 типа. Obstet Gynecol. 2014. 123 (6): 1295–302.

    PubMed Статья PubMed Central Google ученый

  • Secher AL, Parellada CB, Ringholm L, Ásbjörnsdóttir B, Damm P, Mathiesen ER.У женщин с диабетом 1 типа более высокая прибавка в весе во время беременности связана с увеличением веса при рождении у потомства независимо от контроля гликемии у матери. Уход за диабетом. 2014. 37 (10): 2677–84.

    CAS PubMed Статья PubMed Central Google ученый

  • Шен Дж, Го Т, Ван Т, Чжэнь И, Ма Х, Ван И и др. HLA-B ∗ 07, HLA-DRB1 ∗ 07, HLA-DRB1 ∗ 12 и HLA-c ∗ 03: 02 прочно связаны с ИМТ: данные 1,3 миллиона здоровых взрослых китайцев.Диабет. 2018; 67 (5): 861–71.

    CAS PubMed PubMed Central Статья Google ученый

  • Siega-Riz AM, Bodnar LM, Stotland NE, Stang J. Текущее понимание увеличения веса во время беременности среди женщин с ожирением и необходимость будущих исследований. NAM Perspect. 2020;

  • Сонг Нью-Джерси, Ким С., Джанг Б.Х., Чанг С.Х., Юн Ю.Дж., Пак К.М. и др. Низкомолекулярный фактор комплемента D (адипсин) способствует накоплению липидов и дифференцировке адипоцитов.PLoS ONE. 2016; 11: 9.

    Google ученый

  • Spataru A, Le Duc D, Zagrean L, Zagrean AM. Под воздействием этанола созревающие гранулярные клетки мозжечка крысы демонстрируют нарушение энергетического метаболизма и повышенную гибель клеток после кислородно-глюкозной недостаточности. Neural Regen Res. 2019; 14 (3): 485–90.

    PubMed PubMed Central Статья Google ученый

  • Speidel D, Salehi A, Obermueller S, Lundquist I, Brose N, Renström E, et al.CAPS1 и CAPS2 регулируют стабильность и рекрутмент гранул инсулина в β-клетках поджелудочной железы мыши. Cell Metab. 2008. 7 (1): 57–67.

    CAS PubMed Статья PubMed Central Google ученый

  • Стивенсон СЭМ, Ауманн Т.Д., Тейлор Дж. М., Ризли Дж. Р., Ли Р., Манн Дж. Р. и др. Создание и характеристика линии мышей с нокаутом Parkin-Pacrg и линии мышей с нокаутом Pacrg. Научный доклад 2018; 8: 1.

    CAS Статья Google ученый

  • Сугихара М., Морито Д., Айнуки С., Хирано Ю., Огино К., Китамура А. и др.ААА + АТФаза / убиквитинлигаза мистерин стабилизирует цитоплазматические липидные капли. J Cell Biol. 2019; 218 (3): 949–60.

    CAS PubMed PubMed Central Статья Google ученый

  • Suzuki T, Gao J, Ishigaki Y, Kondo K, Sawada S, Izumi T. и др. Стрессовый белок ER CHOP опосредует инсулинорезистентность, модулируя полярность макрофагов жировой ткани. Cell Rep., 2017; 18 (8): 2045–57.

    CAS PubMed Статья PubMed Central Google ученый

  • Тан Дж, Чжо Х, Чжан Х, Цзян Р., Джи Дж, Дэн Л. и др.Новый биомаркер Linc00974, взаимодействующий с KRT19, способствует пролиферации и метастазированию гепатоцеллюлярной карциномы. Cell Death Dis. 2014; 5: 12.

    Артикул CAS Google ученый

  • Винет Л., Жеданов А. «Недостающее» семейство классических ортогональных многочленов. J Phys A Math Theor. 2011. 44 (8): 197–206.

    Артикул Google ученый

  • Вишнякова П.А., Тарасова Н.В., Володина М.А., Цвиркун Д.В., Суханова И.А., Курчакова Т.А. и др.Гестационная возрастная динамика экспрессии митохондриальных кальциевых унипортерных субъединиц в фето-материнском комплексе при доношенных и преждевременных родах. Научный доклад 2019; 9: 1.

    CAS Статья Google ученый

  • Voerman E, Santos S, Inskip H, Amiano P, Barros H, Charles MA и др. Связь увеличения веса во время беременности с неблагоприятными исходами для матери и ребенка. ДЖАМА. 2019; 321 (17): 1702–15.

    PubMed PubMed Central Статья Google ученый

  • Ван З, Кан Дж, Дэн Х, Го Б, Ву Б, Фан И.Нокдаун GATAD2A подавляет пролиферацию клеток при раке щитовидной железы in vitro. Онкол Реп. 2017; 37 (4): 2147–52.

    CAS PubMed Статья PubMed Central Google ученый

  • Уоррингтон Н.М., Ричмонд Р., Фенстра Б., Майхр Р., Гайярд Р., Патерностер Л. и др. Генетический вклад матери и плода в прибавку в весе во время беременности. Int J Obes. 2018; 42 (4): 775–84.

    CAS Статья Google ученый

  • Wasniewski T, Woclawek-Potocka I.Измененная экспрессия рецепторов лизофосфатидной кислоты в связи с синтезом эстрогенов и андрогенов в биологии рака эндометрия 1 типа. Гинекол Эндокринол. 2018; 34 (5): 422–7.

    CAS PubMed Статья PubMed Central Google ученый

  • Wen W, Kato N, Hwang JY, Guo X, Tabara Y, Li H и др. Полногеномные исследования ассоциации у жителей Восточной Азии выявляют новые локусы соотношения талии и бедер и окружности талии.Научный доклад 2016; 6: 1.

    Артикул CAS Google ученый

  • Xu L, Yang L, Wang L, Zhu B, Chen Y, Gao H и др. Анализ ассоциации на основе зондов позволяет выявить несколько делеций, связанных со среднесуточным приростом мясного скота. BMC Genomics. 2019; 20: 1.

    Артикул Google ученый

  • Yu L, Liang Q, Zhang W, Liao M, Wen M, Zhan B и др. HSP22 подавляет вызванное диабетом повреждение эндотелия, ингибируя образование активных форм кислорода в митохондриях.Redox Biol. 2019; 21: 1.

    Артикул CAS Google ученый

  • Yu X, Zhang Y, Chen H. Рецептор LPA 1 опосредует LPA-индуцированное метастазирование рака яичников: исследование in vitro и in vivo. BMC Рак. 2016; 16: 1.

    CAS Статья Google ученый

  • Za’don NHA, Kamal AFM, Ismail F, Othman SIT, Appukutty M, Salim N, et al. Интервальные тренировки высокой интенсивности вызывали экспрессию генов PGC-1α и Adipor1 и улучшали чувствительность к инсулину у лиц с ожирением.Med J Malaysia. 2019; 74 (6): 461–7.

    Google ученый

  • Чжан Ю., Ян Дж., Чжан Дж., Сун Л., Хиранкарн Н., Пан Х.Ф. и др. Полногеномный поиск с последующей репликацией показывает генетическое взаимодействие CD80 и ALOX5AP, связанное с системной красной волчанкой в ​​азиатских популяциях. Ann Rheum Dis. 2016; 75 (5): 891–8.

    CAS PubMed Статья PubMed Central Google ученый

  • Zhao LP, Alshiekh S, Zhao M, Carlsson A, Larsson HE, Forsander G, et al.Секвенирование следующего поколения показывает, что HLA-DRB3, -DRB4 и -DRB5 могут быть связаны с островковыми аутоантителами и риском развития диабета 1 типа у детей. Диабет. 2016; 65 (3): 710–8.

    CAS PubMed PubMed Central Статья Google ученый

  • Чжу Б., Риппе С., Холмберг Дж., Зенг С., Перисич Л., Альбинссон С. и др. Нексилин / NEXN контролирует полимеризацию актина в гладких мышцах и регулируется коактиваторами семейства миокардина и YAP.Научный доклад 2018; 8: 1.

    Артикул CAS Google ученый

  • Влияние веса во время беременности на здоровье матери и ребенка. Влияние веса при беременности на здоровье матери и ребенка. 2007.

  • % PDF-1.4 % 562 0 объект > эндобдж 1302 0 объект > поток 2019-10-18T11: 29: 34 + 02: 002019-10-22T10: 08: 42 + 08: 00LaTeX с пакетом hyperref2019-10-22T10: 08: 42 + 08: 00application / pdf

  • Акробат Дистиллятор 9.0.0 (Windows) Falseuuid: 52f7e7d8-f33f-4989-abed-44f71b41586duuid: 01c5fabf-d7de-4f8f-bb9a-05030aa40ad4default1
  • преобразовано 34 + 02: 00
  • 2B
  • http://ns.adobe.com/pdf/1.3/pdf Adobe PDF
  • internal Объект имени, указывающий, был ли документ изменен для включения информации о треппинге TrappedText
  • http://ns.adobe.com/xap/1.0/mm/xmpMMXMP Схема управления носителями
  • Внутренний идентификатор на основе UUID для конкретного воплощения документа InstanceIDURI
  • внутренний — Общий идентификатор для всех версий и представлений документа.Оригинальный документ IDURI
  • http://www.aiim.org/pdfa/ns/id/pdfaidPDF/A ID Schema
  • internalPart of PDF / A standardpartInteger
  • внутренняя Поправка к стандарту PDF / A amdText
  • внутренний Уровень соответствия стандарту PDF / A Текст
  • конечный поток эндобдж 569 0 объект > эндобдж 565 0 объект > эндобдж 739 0 объект > эндобдж 545 0 объект [548 0 R 551 0 R] эндобдж 493 0 объект > эндобдж 496 0 объект > эндобдж 519 0 объект > эндобдж 523 0 объект > эндобдж 527 0 объект > эндобдж 530 0 объект > эндобдж 534 0 объект > эндобдж 537 0 объект > эндобдж 540 0 объект > эндобдж 1700 0 объект > эндобдж 1834 0 объект > эндобдж 17 0 объект > эндобдж 198 0 объект > эндобдж 403 0 объект > эндобдж 581 0 объект > эндобдж 692 0 объект > поток xZrF} ޖ _fɲ ‘** VX) $ (3 $ @ ז L t> ݃? k ׂ je = h ~: ㌜O.nq8 {s [XŤZ ~: Y0íUҜk `% =: aB + N20B.s1x 23h.? F9 / | 𶈟.? lePBac̛Y9mˈ, ND!» D # `& TP.20wCIaZ’4_P , 5 = _ܸ sk \ Տ fPZ0 aFkL>! YxhV-> ޠ KAK

    Произошла ошибка при настройке вашего пользовательского файла cookie

    Произошла ошибка при настройке вашего пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.

    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно.Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки вашего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу.Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.

    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта.Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    Произошла ошибка при настройке вашего пользовательского файла cookie

    Произошла ошибка при настройке вашего пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.

    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки вашего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.

    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    (PDF) Крибриформно-морулярный вариант папиллярной карциномы щитовидной железы в детском возрасте — клинический случай и обзор литературы

    Andreea Cristiana Brehar et al.

    536

    Благодарности

    Мы благодарим доктора Оану Попа за анализ FISH и доктора

    Анду Думитрашку за изображения компьютерной томографии.

    Анализ FISH финансировался проектом ГЕНИТИР,

    PCCA2 № 135/2012.

    Ссылки

    [1] Делеллис Р.А., Ллойд Р.В., Хейтц ПУ, Eng C (ред.).Патология

    и генетика опухолей эндокринных органов. Всемирное здравоохранение

    Организация (ВОЗ) Международная классификация опухолей,

    Международное агентство по изучению рака (IARC) Press,

    Lyon, France, 2004.

    [2] Harach HR, Williams GT, Williams ED. Семейная аденоматозная

    ассоциированная с полипозом карцинома щитовидной железы: особый тип

    фолликулярно-клеточного новообразования. Гистопатология, 1994, 25 (6): 549–561.

    [3] Cameselle-Teijeiro J, Chan JK.Крибриформно-морулярный вариант

    папиллярной карциномы: отличительный вариант, представляющий спорадический аналог

    семейной аденоматозно-ассоциированной карциномы щитовидной железы

    ? Мод Патол, 1999, 12 (4): 400–411.

    [4] Cameselle-Teijeiro J, Ruiz-Ponte C, Loidi L, Suarez-Peña-

    randa J, Baltar J, Sobrinho-Simoes M. Соматическая, но не

    мутация зародышевой линии гена APC в случае cribriform-

    морулярный вариант папиллярной карциномы щитовидной железы.Am J Clin Pathol,

    2001, 115 (4): 486–493.

    [5] Сюй Б., Ёсимото К., Мияути А., Кума С., Мизусава Н.,

    Хирокава М., Сано Т. Крибриформно-морулярный вариант папиллярной

    карциномы щитовидной железы: патологическое и молекулярно-генетическое исследование

    с доказательствами частые соматические мутации в экзоне 3 гена бета-катенина

    . Дж. Патол, 2003, 199 (1): 58–67.

    [6] Cetta F, Pelizzo MR, Curia MC, Barbarisi A. Genetics и

    клинико-патологические находки в карциномах щитовидной железы, ассоциированных

    с семейным аденоматозным полипозом.Am J Pathol, 1999,

    155 (1): 7–9.

    [7] Соравиа С., Сугг С.Л., Берк Т., Митри А., Ченг Х., Галлингер С.,

    Коэн З., Аса С.Л., Бапат Б.В. Семейный аденоматозный полипоз-

    ассоциированный рак щитовидной железы: клиническое, патологическое и молекулярно-генетическое исследование

    . Am J Pathol, 1999, 154 (1): 127–135.

    [8] Cameselle-Teijeiro J, Menasce LP, Yap BK, Colaco RJ,

    Castro P, Celestino R, Ruíz-Ponte C, Soares P, Sobrinho-

    Simões M.Крибриформно-морулярный вариант папиллярной карциномы щитовидной железы

    : молекулярная характеристика случая нейро-

    эндокринной дифференцировки и агрессивного поведения. Am J Clin

    Pathol, 2009, 131 (1): 134–142.

    [9] Sugg SL, Zheng L, Rosen IB, Freeman JL, Ezzat S, Asa SL.

    перестройки онкогенов ret / PTC-1, -2 и -3 в

    карциноме щитовидной железы человека

    : влияние на метастатический потенциал? J Clin

    Endocrinol Metab, 1996, 81 (9): 3360–3365.

    [10] Фридман М.В., Савва Н.Н., Краско О.В., Зборовская А.А.,

    Маньковская С.В., Курт Вернер С., Демидчик Ю.Е. Клинические и

    патологические и

    патологические признаки «спорадической» папиллярной карциномы щитовидной железы

    , зарегистрированных в 2005-2008 годах у детей и подростков —

    цента Беларуси. Thyroid, 2012, 22 (10): 1016–1024.

    [11] Чо ЭЙ, Ли Си, Шин Ч., Ян СВ. Клиническая характеристика

    папиллярного рака щитовидной железы у детей и подростков.

    J Korean Soc Pediatr Endocrinol, 2008, 13 (1): 65–72.

    [12] Хоган А.Р., Чжуге Ю., Перес Э.А., Кониарис Л.Г., Лью Джи, Сола Дж. Э.

    Детская карцинома щитовидной железы: частота и исходы у 1753

    пациентов. J Surg Res, 2009, 156 (1): 167–172.

    [13] Machens A, Lorenz K, Nguyen Thanh P, Brauckhoff M, Dralle H.

    Папиллярный рак щитовидной железы у детей и подростков не отличается

    по типу роста и метастатическому поведению. J Pediatr,

    2010, 157 (4): 648–652.

    [14] Романчишен А.Ф., Томпсон Д.Б., Гостимский А.В. Хирургическое

    и послеоперационное лечение больных с карциномами

    щитовидной железы в детском и подростковом возрасте. Вестн Хир

    Im I I Grek, 2008, 167 (5): 55–58.

    [15] Тронко М.Д., Богданова Т.И., Комиссаренко И.В., Эпштейн О.В.,

    Олийнык В., Коваленко А.А., Лихтарев И.А., Кайро И., Петерс С.Б.,

    ЛиВолси В.А. Карцинома щитовидной железы у детей и подростков

    в Украине после аварии на Чернобыльской АЭС: статистические данные

    и клинико-морфологическая характеристика.Рак, 1999,

    86 (1): 149–156.

    [16] Ип Ф.В., Рив Т.С., Пул А.Г., Делбридж Л. Узлы щитовидной железы в

    детском и подростковом возрасте. Aust N Z J Surg, 1994, 64 (10):

    676–678.

    [17] Ahn HY, Park YJ. Заболеваемость и клинические характеристики

    рака щитовидной железы в Корее. Korean J Med, 2009, 77 (5): 537–542.

    [18] Koo JS, Hong S, Park CS. Диффузный склерозирующий вариант — это

    основных подтипов папиллярной карциномы щитовидной железы у молодых.

    Thyroid, 2009, 19 (11): 1225–1231.

    [19] Бюлов С., Бюлов С. Показан ли скрининг на карциному щитовидной железы

    при семейном аденоматозном полипозе? Замок Лидс Poly-

    posis Group. Int J Colorectal Dis, 1997, 12 (4): 240–242.

    [20] Трута Б., Аллен Б.А., Конрад П.Г., Ким Ю.С., Берк Т., Галлингер С.,

    Бапат Б., Тердиман Дж. П., Слейзенгер М. Х. Генотип и фенотип

    пациентов с семейным аденоматозным полипозом и

    карциномой щитовидной железы.Fam Cancer, 2003, 2 (2): 95–99.

    [21] Хидзава К., Иида М., Яо Т., Аояги К., Оохата Ю., Мибу Р.,

    Ямасаки К., Хирата Т., Фудзишима М. Связь между

    рака щитовидной железы с крибриформным вариантом и семейным аденоматозным

    полипозом. Дж. Клин Патол, 1996, 49 (7): 611–613.

    [22] Херрайз М., Барбесино Г., Факин В., Чан-Смутко Г., Патель Д.,

    Шеннон К.М., Дэниэлс Г.Х., Чанг, округ Колумбия. Распространенность рака щитовидной железы

    при синдроме семейного аденоматозного полипоза и роль скрининговых ультразвуковых исследований

    .Clin Gastroenterol

    Hepatol, 2007, 5 (3): 367–373.

    [23] Talbot IC, Burt R, Järvinen H. Семейный аденоматозный полипоз.

    В: Hamilton SR, Aaltonen LA (ред.). Патология и генетика

    опухолей пищеварительной системы. Международная классификация опухолей ВОЗ

    , IARC Press, Lyon, France, 2000, 120–125.

    [24] Groden J, Thliveris A, Samowitz W., Carlson M, Gelbert L,

    Albertsen H, Joslyn G, Stevens J, Spirio L, Robertson M,

    Sargeant L, Krapcho K, Wolff E, Burt R , Hughes JP,

    Warrington J, McPherson J, Wasmuth J, Le Paslier D,

    Abderrahim H, Cohen D, Leppert M, White R.Идентификация

    и характеристика семейного аденоматозного полипоза

    гена coli. Cell, 1991, 66 (3): 589–600.

    [25] Kinzler KW, Nilbert MC, Vogelstein B, Bryan TM, Levy DB,

    Smith KJ, Preisinger AC, Hamilton SR, Hedge P, Markham A,

    Carlson M, Joslyn G, Groden J, White R , Miki Y, Miyoshi Y,

    Nishisho I, Nakamura Y. Идентификация гена, расположенного в хромосоме 5q21

    , который мутирован при колоректальном раке.

    Наука, 1991, 251 (4999): 1366–1370.

    [26] Ли С., Хонг С.В., Шин С.Дж., Ким Ю.М., Ри И., Джин Б.И., Мун В.С.,

    О, М.Р., Лим СК. Папиллярная карцинома щитовидной железы, ассоциированная

    с семейным аденоматозным полипозом: молекулярный анализ патогенеза

    в семье и обзор литературы. Endocr J,

    2004, 51 (3): 317–323.

    [27] Мияки М., Иидзима Т., Исии Р., Хишима Т., Мори Т., Ёсинага К.,

    Таками Х., Куроки Т., Ивама Т.Молекулярные доказательства мульти-

    центрического развития карциномы щитовидной железы у пациентов с

    семейным аденоматозным полипозом. Am J Pathol, 2000, 157 (6):

    1825–1827.

    [28] Хирокава М., Кума С., Мияучи А., Цянь З.Р., Накасоно М.,

    Сано Т., Какудо К. Морулес в решетчато-морулярном варианте

    папиллярной карциномы щитовидной железы: иммуногистохимические характеристики и отличие от

    эристики. плоскоклеточная метаплазия. АПМИС,

    2004, 112 (4–5): 275–282.

    [29] Volante M, Collini P, Nikiforov YE, Sakamoto A, Kakudo K,

    Katoh R, Lloyd RV, LiVolsi VA, Papotti M, Sobrinho-Simoes M,

    Bussolati G, Rosai J. Плохо дифференцированная щитовидная железа карцинома:

    Туринское предложение по использованию единых диагностических критериев

    и алгоритмического диагностического подхода. Am J Surg Pathol,

    2007, 31 (8): 1256–1264.

    [30] Юнг С.К., Чхве Й.Дж., Ли К.Й., Пэ Дж.С., Ким Х.Дж., Юн С.К., Сон Й.И.,

    Чунг Дж.Х., О Й.Л.Цитологические, клинические и патологические особенности

    крибриформно-морулярного варианта папиллярной карциномы щитовидной железы

    и анализ мутаций генов CTNNB1 и BRAF

    . Thyroid, 2009, 19 (8): 905–913.

    [31] Cameselle-Teijeiro J, Alberte-Lista L, Chiarelli S, Buriticá C,

    Gonçalves L, González-Cámpora R, Nogales FF. CD10 является характерным маркером

    опухолей, образующих морулы с богатыми биотином

    оптически прозрачными ядрами, которые встречаются в различных органах.

    Author: alexxlab

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *