Картинка впр 4 класс: Иллюстрация 1 из 16 для Готовимся к ВПР. Русский язык. 4 класс. Рабочая тетрадь. ФГОС — Марина Кузнецова | Лабиринт

Содержание

Тренировочный вариант №1 ВПР 2021 по окружающему миру 4 класс

Тренировочный вариант №1 ВПР 2021 по окружающему миру 4 класс. Варианты ВПР 2021 4 класс Окружающий мир. Всероссийская проверочная работа 2021

Часть 1

1.

Рассмотри рисунок, на котором изображена клумба. Скамейка рядом с клумбой изготовлена из дерева. Она отмечена на рисунке стрелкой с соответствующей надписью.
Покажи на рисунке стрелкой любой предмет (любую деталь) из металла и любой предмет (любую деталь) из камня. Подпиши название соответствующего материала рядом с каждой стрелкой.

2.

На интернет-сайтах погоды можно встретить подобные таблицы. Изучи прогноз погоды на трое суток.

Выбери все верные утверждения об ожидаемой погоде на эти трое суток и запиши в строку ответа их номера.
1) В воскресенье ожидаются осадки в виде дождя.
2) Воздух в пятницу прогреется выше 18 °С.
3) На протяжении всех трёх суток влажность воздуха будет колебаться от 50% до 80%.


4) В субботу ветер изменит своё направление с северного на восточное.

3.

Рассмотри карту мира. На ней буквами А и Б отмечены два материка.

3.1. Запиши название каждого материка в отведённое для этого поле.

Название материка A :                                   Название материка Б

___________________                                   _____________________

3.2. На следующей странице представлены фотографии императорского пингвина, морского леопарда, рыси и большой панды. Запиши название каждого из этих животных рядом с номером фотографии, на которой оно изображено.

1) _____________________________ 2) ________________________________
3) _____________________________ 4) ________________________________

3.3. Какие из этих животных обитают в естественной среде (не в зоопарке) на материке А, а какие – на материке Б? Запиши в таблицу

номера фотографий с изображением этих животных.

Ответ:

Материк А Б
Животные

4.

Рассмотри изображение человека. Покажи стрелками и подпиши локоть, поясницу и головной мозг человека так, как показано на примере.

5.

Составь два правила сохранения здоровья человека из приведённых частей фраз: для этого к каждой позиции первого столбца подбери соответствующую позицию из второго столбца.

Начало фразы
А) Чтобы укреплять кости и мышцы,
Б) Чтобы избежать кишечных инфекций,

Продолжение фразы
1) всегда мой руки перед едой.
2) регулярно принимай прохладный душ.

3) делай по утрам оздоровительную гимнастику.

Запиши в таблицу выбранные цифры под соответствующими буквами.

Ответ: А=?, Б=?

6.

В жаркий солнечный день Софья решила провести опыт с испарением воды. Она взяла две одинаковые ёмкости – металлические кастрюли, налила в них одинаковое количество тёплой воды одинаковой температуры, вынесла их на улицу и поставила обе кастрюли рядом друг с другом на солнце. В одну из кастрюль Софья добавила ложку растительного масла. Через некоторое время Софья обнаружила, что в кастрюле, в которую было добавлено масло, воды осталось больше, чем в другой кастрюле.

6.1. Сравни условия испарения воды в ёмкостях в описанном опыте. Подчеркни в каждой строке одно из выделенных слов.
Исходная температура воды в ёмкостях:    одинаковая / различная
Исходное количество воды в ёмкостях:      одинаковое / различное

Содержимое ёмкостей:                              одинаковое / различное

6.2. По результатам опыта сделай вывод о том, как влияет добавление масла на скорость испарения воды.
Ответ:

6.3. Если бы Софья захотела выяснить, влияет ли добавление сахара на скорость испарения воды, с помощью какого опыта она могла бы это сделать? Опиши этот опыт.
Ответ:

Часть 2

При выполнении заданий 7–10 последовательно отвечай на каждый из представленных вопросов. Ответы записывай чётко и разборчиво, соблюдая нормы речи.

7. 

Рассмотри знаки, изображённые на рисунках. Как ты думаешь, где можно встретить каждый из этих знаков?
Ответ:
1 – _________________________________________________________________
2 – _________________________________________________________________

3 – _________________________________________________________________

Какое правило или какую информацию отражает каждый из этих знаков? Напиши значение каждого знака.
1 – _________________________________________________________________
2 – _________________________________________________________________
3 – _________________________________________________________________

8.

На фотографиях изображены люди разных профессий за работой. Выбери ОДНУ из фотографий и запиши букву, под которой она приведена.
Представитель какой профессии изображён на выбранной фотографии? Какую работу выполняют люди этой профессии? Какие материалы / какое оборудование используют представители этой профессии в работе?

Выбранная фотография:
Ответ:

9.

Во всём мире 1 октября отмечается Международный день музыки.

Обведи эту дату в календаре.

Запиши, на какой день недели приходится эта дата в 2018 году.
Ответ:_______________________
Как ты думаешь, какую роль играет музыка в жизни человека? (Напиши ответ объёмом до пяти предложений.)
Ответ:

10.

10.1. Запиши название региона: республики, или области, или края, или автономного округа, в котором ты живёшь.
Ответ: ______________________________________________________________
Как называется главный город твоего региона?
Ответ: ______________________________________________________________

10. 2. В какой природной зоне расположен твой регион?
Ответ: ______________________________________________________________
Какие музеи находятся в твоём регионе (укажи не менее двух музеев)? Напиши о своём посещении одного из этих музеев (какие экспонаты там представлены, что тебя больше всего заинтересовало, что понравилось)?

Ответ: ______________________________________________________________

ОТВЕТЫ

1.

В качестве правильного ответа должно быть засчитано указание на рисунке любых других предметов (деталей), если они могут быть сделаны из соответствующих материалов.
При оценивании засчитывается только указание предмета (детали) с подписью соответствующего материала, из которого предмет (деталь) сделан(а)

2.

14 или 41

3.

3.1. А – Евразия; Б – Антарктида

3.2. 1) большая панда;
2) морской леопард;
3) рысь;
4) императорский пингвин

3. 3. А (Евразия) – 13 или 31;
Б (Антарктида) – 24 или 42

4.

5.

А=3, Б=1

6.

6.1. Исходная температура воды в ёмкостях одинаковая.
Исходное количество воды в ёмкостях одинаковое.
Содержимое ёмкостей различное

6.2. При добавлении масла скорость испарения воды замедляется.
Может быть дана иная формулировка вывода, не искажающая его смысла

6.3. В ответе может быть дано такое описание опыта.
Нужно налить одинаковое количество воды одной и той же температуры в две ёмкости из одинакового материала, причём в одну из ёмкостей с водой добавить сахар. Затем надо поставить обе ёмкости рядом друг с другом в тёплое место, например на солнце. После этого наблюдать, как будет меняться объём воды в каждой из ёмкостей.
Может быть дано иное, близкое по смыслу описание опыта

7.

Правильный ответ должен содержать следующие элементы:
1) места, где можно встретить каждый из знаков:
1 – на проезжей части улицы / при въезде во двор / при выезде на дорогу с
односторонним движением;
2 – в музее / в торговом центре / в храме и т.

п.;
3 – на электроприборах / на электрощитках / на дверце трансформаторной будки;
2) значение знаков:
1 – Въезд запрещён.
2 – Запрещается фотографировать. / Фотосъёмка запрещена.
3 – Осторожно! Здесь электрическое напряжение / электрический ток.
Значения могут быть приведены в иных, близких по смыслу формулировках.
При оценивании в качестве верного ответа может быть принято любое объяснение, свидетельствующее о том, что обучающийся понимает значение соответствующего знака

9.

День недели записан верно: понедельник

Ответ на вопрос: Дан уместный ответ на вопрос, в котором в общей форме или на примере(-ах)
показана роль музыки / приведено хотя бы одно обоснование

10.

Правильно указаны название региона и его главный город: 2 балла
(принимается указание крупного города, находящегося в регионе)

«Шаблон описания картинки (ВПР 7 класс)»

Шаблон описания картинки

ВПР 7 класс

 

1.      I’d like to describe picture № (number) 1.

2.     The picture shows a girl at school.

(in the garden —  в саду; outside — на улице; in the classroom – в классе; at home –дома; in the park —  в парке; in the museum —  в музее; at the sea —  у моря; at the cinema – в кинотеатре).

3.     As we can see, the girl is writing her classwork.(ед

. ч.)

the children (the boys, the girls) are playing. (мн. ч.)

4.     It seems to me, (мне кажется) the girl is about 9 years old.

She/he has got long/short, dark/fair hair.

She/he has got big/small, green/brown/blue eyes.

I think he/she is very kind (добрая),  clever (умная).

Also he/she has got a pleasant smile.

He/she is wearing a school uniform (a T-shirt – футболка, a dress – платье, jeans – джинсы, warm clothes – теплая одежда).

5.     As for me, I like the picture because it gives me positive emotions about school (summer – лето, spring – весна, autumn – осень, holidays – праздниках, каникулах).

Moreover, I like to study (to play games, to swim, to watch TV,

to be outside – находиться на улице).

 

 

 

1.     I’d like to describe picture № (number) 1.

2.     The picture shows a girl at school.

(in the garden —  в саду; outside — на улице; in the classroom – в классе; at home –дома; in the park —  в парке; in the museum —  в музее; at the sea —  у моря; at the cinema – в кинотеатре).

3.     As we can see, the girl is writing her classwork.(ед. ч.)

the children (the boys, the girls) are playing. (мн. ч.)

4.     It seems to me, (мне кажется) the girl is about 9 years old.

She/he has got long/short, dark/fair hair.

She/he has got big/small, green/brown/blue eyes.

I think he/she is very kind (добрая),  clever (умная).

Also he/she has got a pleasant smile.

He/she is wearing a school uniform (a T-shirt – футболка, a dress – платье, jeans – джинсы, warm clothes – теплая одежда).

5.     As for me, I like the picture because it gives me positive emotions about school (summer – лето, spring – весна, autumn – осень, holidays – праздниках, каникулах).

Moreover, I like to study (to play games, to swim, to watch TV,

to be outside – находиться на улице).

 

ВПР Окружающий мир 4 класс Вариант 3 Всероссийская Проверочная Работа

ВПР Окружающий мир 4 класс Вариант 3 Всероссийская Проверочная Работа

1. Внимательно рассмотри рисунок, на котором изображён автомобиль. Корпус автомобиля может быть изготовлен из Металла. Он отмечен на рисунке стрелкой с соответствующей надписью. Какие предметы или детали среди изображённых на рисунке могут быть сделаны из пластика, а какие — из резины? Укажи на рисунке стрелкой любой предмет (деталь) из пластика и любой предмет (деталь) из резины. Подпиши название соответствующего материала рядом с каждой стрелкой.

2. На интернет-сайтах погоды можно встретить подобные таблицы. Внимательно изучи прогноз погоды на трое суток.

Выбери верные утверждения об ожидаемой погоде на эти трое суток и запиши в строку ответа их номера.

1) В течение всех трёх суток будут наблюдаться осадки в виде снега и дождя.
2) Самым тёплым из трёх суток будет вторник.
3) В среду ожидается западный ветер.
4) Во вторник влажность воздуха превысит 75%.

3. Внимательно рассмотри карту. На ней буквами А и Б отмечены два материка.

3.1. Запиши название каждого материка в отведённое для этого поле.
Название материка A :
Название материка Б :

3.2.  Далее представлены изображения полярной совы, ламы, Виктории Регии и секвойи. Запиши на строчках ниже название каждого из этих растений и животных рядом с номером фотографии, на которой оно изображено.

ЖИВОТНЫЕ

А) Полярная сова

Б) Лама

В) Виктория Регия

Г) Секвойя

ФОТОГРАФИИ

1) Фотография 1

2) Фотография 2

3) Фотография 3

4) Фотография 4

Запишите в ответ цифры, расположив их в порядке, соответствующем буквам:

3.3. Какие из этих растений и животных обитают в естественной среде (не в ботаническом саду или зоопарке) на материке А, а какие — на материке Б? Запиши номера, под которыми указаны эти растения и животные, в отведённое для этого поле после буквы соответствующего материка.

Запишите в ответ цифры, расположив их в порядке, соответствующем буквам:

Материки А Б
Животные

4. Если правильно подобрать к началу каждой фразы из первого столбца продолжение фразы из второго столбца, то получится правило, помогающее человеку сохранить здоровье и жизнь. Составь два правила из приведённых частей фраз: для этого к каждой позиции первого столбца подбери соответствующую позицию из второго столбца.

НАЧАЛО ФРАЗЫ

А) Чтобы избежать травм при падении различных предметов во время сильного ветра,

Б) Чтобы не переохладиться, выходя на улицу в холодную погоду,

ПРОДОЛЖЕНИЕ ФРАЗЫ

1)старайся находиться в местах, защищённых крышей.

2)не залезай на высокие строения.

3)надень тёплую одежду.

Запишите в ответ цифры, расположив их в порядке, соответствующем буквам:

5. Рассмотри изображение человека. Так же, как на примере слева отмечено ухо, на изображении справа покажи стрелками и подпиши щёку, стопу и печень человека.

6.

6.1. Андрей проводил опыт, чтобы выяснить, влияет ли вес предмета на его способность держаться на плаву. Он взял два одинаковых по форме и размеру бруска: один деревянный, другой, более лёгкий, из пенопласта — и поместил их в сосуд с водой. Деревянный брусок плавал, но почти весь находился под водой. Брусок из пенопласта также плавал и почти весь находился над водой.

Сравни условия проведения описанного эксперимента. Подчеркни в каждой строке одно из выделенных слов.

Размеры брусков: одинаковые / различные

Вес брусков: одинаковый / различный

Размеры брусков Вес брусков

6.2. По результатам эксперимента в 6.1. сделай вывод о том, как влияет вес предмета на его способность держаться на плаву.

6.3. Если бы Андрей захотел выяснить, влияет ли форма предметов на их плавучесть, с помощью какого эксперимента он мог бы это сделать? Опиши этот эксперимент.

7. Рассмотри знаки, изображённые на рисунках. Где можно встретить каждый из этих знаков?

Как ты думаешь, какое правило отражает каждый из этих знаков?

Напиши эти правила.

8. На фотографиях изображены предметы, с которыми работают представители разных профессий. Выбери ОДНУ из фотографий и запиши её номер. Представители какой профессии работают с изображёнными на выбранной фотографии предметами? Если ты знаешь много профессий, представители которых работают с выбранным(-и) тобой предметом(-ами), назови любую из них. Какую работу выполняют люди этой профессии? Чем работа людей этой профессии полезна обществу?

9. Какого человека называют привередливым? (Напиши ответ объёмом до пяти предложений).

10.

10. 1. Запиши название региона: республики, или области, или края, или города, или автономного округа, в котором ты живёшь.

10.2. Запиши название столицы или главного административного города твоего региона.

10.3. Как называется населённый пункт, в котором ты живёшь? Запиши название, в ответе укажи вид населённого пункта (город, село, посёлок, деревня). В каком климатическом поясе находится твой регион? Напиши о растительности, которая наиболее распространена в твоём регионе.

 

Ответы


  1. Могут быть указаны материалы и других деталей.
  2. 34
  3. 3.1. Южная Америка, Северная Америка;
    3.2.   А — 4, Б — 3, В — 1, Г — 2;
    3.3. А — 13 или 31, Б — 24 или 42.
  4. 13
  5. 6.1. Размеры брусков — одинаковые, вес брусков — различный. 6.2. Более тяжёлый предмет глубже погружён в воду. 6.3. В ответе может быть дано такое описание эксперимента: взять два одинаковых по весу, но разных по форме предмета, например кубик и дощечку из дерева. Наблюдать, насколько они погружены в воду.
  6. Данные знаки можно встретить:

    1. На дороге.
    2. В парке/на улице/в торговом центре.
    3. На этикетке одежды.

    Знаки отражают следующие правила:

    1. Ведутся дорожные работы.
    2. Запрещено кататься на роликах.
    3. Эту вещь нельзя гладить.

  7. Картинка 1. На ней изображена доска. Ее использует учитель. Он учит детей в школе.

    Картинка 2. На картинке изображены краски и кисти. Их использует художник. Он пишет картины.

    Картинка 3. На картинке изображен пюпитр. Его использует музыкант. Он играет музыку на концертах и театральных представлениях.

  8. Человек, который предъявляет слишком высокие требования к окружающим людям и предметам. Он часто бывают недовольным и капризным.
  9. Один из возможных вариантов ответа.

    Санкт-Петербург является субъектом России и городом федерального значения.

    Петербург находится в умеренном климатическом поясе. В окрестностях города много еловых и сосновых лесов, а также встречаются лиственные породы деревьев: ольха, береза, осина.

Проект

молодых писателей: Беглец

Это стихотворение представляет собой «До», как и до того, как автор поступил в Школу больших картин Южного Берлингтона. Автор, Сесилия Джордано, старшеклассница, прочитала это стихотворение на ежегодной конференции по образованию Rowland Foundation , состоявшейся 6 ноября. Сил был одним из двух студентов, выступивших в рамках основного доклада Денниса Литтки , который разработал Школы Big Picture по всему миру.В своем программном докладе Сил, стажер YWP в прошлом году, сказала, что теперь она стала гораздо более уверенной в себе и целенаправленной, и у нее есть четкое видение своего будущего.

Беглец
Сесилия Мари Джордано
12 класс, школа Big Picture, Южный Берлингтон, штат Вирджиния

В жизни —

Я никогда не был уверен, хочу ли я войти или просто выйти, застрял где-то между моим разумом и моим ртом,
Как будто я никогда не мог сказать слова так, как я хотел, чтобы они звучали
К твоим ушам, к ее ушам, к его ушам,
И из-за этого это препятствовало моей способности жить должным образом
К заставить себя правильно понять
Чтобы расти и давать,
Так что я молчал, что привело к насилию,
И напрасной трате времени.

От локтя до запястья Я резал и разрезал,
Пытаясь удалить те части себя, которые я ненавидел,
Прикрыл их одеждой,
И когда я пришел домой, Я был отмычкой,
Один родитель работает, один полностью отсутствует,
Так что для меня никогда не было разницы,
Будь то алкоголь или травка,
Было ли это членовредительством или сном,
Если бы я мог найти выход, это было бы единственное, что мне нужно.

В школе —
Я вошел в класс и был в лучшем случае склонен к суициду,
Сжался перед любым тестом,
Это могло еще раз сказать мне, что я был неудачником,
Не было признания ценности,
Нет присутствия жажды для знаний.

Негодяи-педагоги в системе,
Покровительствуя их мыслям и их мудрости,
Я искал помощи, но не у себя,
Был лишь небольшой шанс, что я добьюсь успеха,
Дважды пытался покончить жизнь самоубийством, даже не смог сделать это правильно,
Я думал,
Уравновешивая мысль, что эти люди, эти учителя,
Никогда меня не узнают,
Как я мог стоять перед толпой и все еще чувствовать себя одиноким.

Я всегда оставлял дверь слегка приоткрытой,
После входа в класс,
Чтобы, если моя боль зашла слишком далеко,
Я всегда мог выскользнуть через щели,
Точно так же, как я всегда делал в образовании.
 

Половая зрелость наступает раньше, но это не значит, что секс Эд

Для детей, растущих в районе залива Сан-Франциско, во многих школах есть стандартное введение в половое созревание: образовательная пьеса под названием Кошмар на улице Полового созревания.

Это вымышленная пьеса, и в ней персонаж Натали рассказывает о том, как быстро растет ее тело и как одноклассники обзывают ее.

«Я не выбирал, как будет расти мое тело, и я не чувствую себя нормально, потому что я не контролирую ситуацию».

Во многих местных школах спектакль « Кошмар на улице Пуберти » ставится начиная с шестого класса, но организация, производящая спектакль, Kaiser Permanente Northern California, получает запросы на то, чтобы довести пьесу до зрителей пятого класса.

Это потому, что изменения, с которыми сталкиваются дети в пьесе, начинаются раньше, чем поколение назад.Исследователи обсуждают возможные связи с химическими веществами в окружающей среде, стрессом и ожирением. Но независимо от причины, все больше и больше детей уже достигают половой зрелости к тому времени, когда в школе начинается половое воспитание.

Пока ученые пытаются выяснить, что вызывает раннее половое созревание, школам приходится иметь дело с тем, что выглядит как новая норма. А тем временем дети задаются вопросом, являются ли они нормальными.

Сейчас я нахожусь на миссии, чтобы люди поняли, что рассказывать детям о половой зрелости в пятом классе слишком поздно.

Все еще играю в переодевание

Рэйчел сейчас 15, но однажды утром, когда ей было 8, она проснулась и заметила в себе что-то другое.

«Я на самом деле, честно говоря, не очень этого помню, но моя мама сказала мне, что я проснулся и подумал: «Эй, мама, что это за штуки у меня на груди? Я не знаю что они там делают. И она должна была мне это объяснить».

Когда у Рэйчел началось половое созревание, она все еще играла в переодевания.

«Одежда сказочной принцессы, как правило, плохо сшита, откровенна и тому подобное, поэтому я играла в переодевания, хотя уже начала развиваться», — говорит она. «Итак, есть несколько моих фотографий в нарядной одежде, которая откровенна или слишком тесна в некоторых местах».

Рэйчел тоже выделялась в школе.

«У некоторых моих друзей были родители, которым было неудобно говорить о таких вещах. Я была человеком, который отвечал на множество вопросов других людей», — говорит Рэйчел — странная позиция для ребенка.

У некоторых девочек признаки полового созревания проявляются даже раньше, чем у Рэйчел. Например, у Джейдин было 6 лет, когда у нее появились волосы под мышками и она начала пользоваться дезодорантом, «и около 9, когда я начала носить лифчик», — говорит она.

Но к четвертому классу Джейдин так и не получила в школе никакого образования по половому созреванию, что оставило разговор о ее маме, Марелле.

«Честно говоря, мне стало немного не по себе, но я старалась изо всех сил, — говорит Марелла. «Я только что принесла ей домой бюстгальтеры и сказала: «Вот!» И она их надела.Знаешь, я максимально облегчил ей задачу».

Но справиться с этими разговорами нелегко ни родителям, ни детям. Отчасти поэтому в школах проводится обучение по вопросам полового созревания — чтобы помочь детям не волноваться, когда их тела меняются.

Энн Пикок, которая преподает курс полового созревания в начальной школе Редвуд-Хайтс в Окленде, штат Калифорния, рекомендует, чтобы каждая пятиклассница носила с собой личный мешочек с прокладками и свежей парой нижнего белья, поскольку у девочек этого возраста месячные могут начаться в любое время.

«Мое личное мнение состоит в том, что мы должны проводить какое-то сексуальное образование начиная с детского сада и чтобы они чувствовали себя комфортно», — говорит она.

«Пятый класс слишком поздно»

Доктор Луиза Гринспен, детский эндокринолог из Kaiser Permanente в Сан-Франциско, изучающая причины и последствия раннего полового созревания, соглашается. «Я действительно чувствую, что сейчас у меня есть миссия, чтобы убедиться, что люди понимают, что рассказывать детям о половой зрелости в пятом классе слишком поздно», — говорит она.

Для ясности: Гринспен , а не , говорит, что маленькие дети должны изучать секс в школе. Вместо этого, по ее словам, они должны понять, что физическая зрелость не означает, что они готовы к взрослым отношениям.

Гринспен также отмечает, что дети, у которых рано начинается половое созревание, не обязательно имеют проблемы со здоровьем.

«Но это расстройство, например, что-то не так с окружающей средой или что-то не так с тем, что происходит в мире? Может быть», — говорит она.«Что-то изменилось. Итак, у девочек нет расстройства — но, возможно, в нашем мире оно есть».

Прошлой весной на игровой площадке начальной школы имени Флинна в Сан-Франциско ученицы пятого класса Мила и Изабель говорили об уроке полового созревания, который они собирались начать. «Я чувствую, что важно учиться, но это своего рода неуклюжий урок», — говорит Изабель.

Так почему же дети не хотят говорить со своими родителями о месячных и других изменениях, которые у них происходят?

«Это одна из тех вещей, о которых ты не хочешь говорить с мамой», — говорит Мила.«Это как бойфренды. Ты не хочешь говорить с мамой о своем парне».

«Потому что тогда они могут сказать: «Боже мой, ты взрослеешь!» — добавляет Изабель.

Но дети растут — часто задолго до того, как они даже слышат слово «половая зрелость» в классе.

Звук для этого рассказа был подготовлен Молодежным радио.

Copyright 2021 YR Media. Чтобы узнать больше, посетите YR Media.

Меченый флуоресцентным белком Vpr отделяется от ядра ВИЧ-1 после слияния с вирусом и быстро проникает в ядро ​​клетки | Ретровирусология

  • 1.

    Амброуз З., Айкен С. Снятие оболочки ВИЧ-1: связь с проникновением в ядро ​​и регуляцией белками-хозяевами. Вирусология. 2014; 454–455: 371–9.

    Артикул пабмед Google Scholar

  • 2.

    Макдональд Д., Водицкая М.А., Лусеро Г., Свиткина Т.М., Борисый Г.Г., Эмерман М., Надежда Т.Дж. Визуализация внутриклеточного поведения ВИЧ в живых клетках. Джей Селл Биол. 2002; 159: 441–52.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 3.

    Arhel N, Genovesio A, Kim KA, Miko S, Perret E, Olivo-Marin JC, Shorte S, Charneau P. Количественное четырехмерное отслеживание цитоплазматических и ядерных комплексов ВИЧ-1. Нат Методы. 2006; 3: 817–24.

    КАС Статья пабмед Google Scholar

  • 4.

    Jun S, Ke D, Debec K, Zhao G, Meng X, Ambrose Z, Gibson GA, Watkins SC, Zhang P. Прямая визуализация ВИЧ-1 с коррелятивной микроскопией живых клеток и криоэлектронной томографией .Структура. 2011;19:1573–81.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 5.

    Лукич З., Дхаран А., Фрике Т., Диас-Грифферо Ф., Кэмпбелл Э.М. Обнажению ВИЧ-1 способствуют Dynein и Kinesin 1. J Virol. 2014;88:13613–25.

    Центральный пабмед Статья пабмед Google Scholar

  • 6.

    Халм А.Е., Келли З., Фоли Д., Хоуп Т.Дж. Дополнительные анализы показывают низкий уровень CA, связанный с ядерными вирусными комплексами ВИЧ-1.Дж Вирол. 2015;89(10):5350–5361. doi:10.1128/ОВИ.00476-15.

    КАС Статья пабмед Google Scholar

  • 7.

    Кэмпбелл Э.М., Перес О., Андерсон Дж.Л., Хоуп Т.Дж. Визуализация независимого от протеасом интермедиата при рестрикции ВИЧ-1 резусом TRIM5alpha. Джей Селл Биол. 2008; 180: 549–61.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 8.

    Burdick RC, Hu WS, Pathak VK. Ядерный импорт преинтеграционных комплексов ВИЧ-1, меченных APOBEC3F. Proc Natl Acad Sci USA. 2013; 110:E4780–9.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 9.

    Пэн К., Мураньи В., Гласс Б., Лакета В., Янт С.Р., Цай Л., Чихлар Т., Мюллер Б., Крауслих Х.Г. Количественная микроскопия функциональных поствходовых комплексов ВИЧ выявляет связь репликации с вирусным капсидом.Элиф. 2014;3:e04114.

    Артикул пабмед Google Scholar

  • 10.

    Мияучи К., Ким Ю., Латинович О., Морозов В., Меликян Г.Б. ВИЧ проникает в клетки путем эндоцитоза и динамин-зависимого слияния с эндосомами. Клетка. 2009; 137: 433–44.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 11.

    Селиг Л., Пейдж Дж.К., Танчжоу В., Преверал С., Берлиоз-Торрент С., Лю Л.С., Эрдтманн Л., Дарликс Дж., Бенарус Р., Беничу С.Взаимодействие с доменом p6 предшественника gag обеспечивает включение в вирионы белков Vpr и Vpx лентивирусов приматов. Дж Вирол. 1999; 73: 592–600.

    Центральный пабмед КАС пабмед Google Scholar

  • 12.

    Дженкинс Ю., Порниллос О., Рич Р.Л., Мышка Д.Г., Сандквист В.И., Малим М.Х. Биохимический анализ взаимодействия между вирусом иммунодефицита человека типа 1 Vpr и p6(Gag). Дж Вирол. 2001; 75:10537–42.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 13.

    Лю Х, У С, Сяо Х, Каппес Дж.К. Нацеливание белка интегразы вируса иммунодефицита человека (ВИЧ) 2 типа на ВИЧ 1 типа. J Virol. 1999;73:8831–6.

    Центральный пабмед КАС пабмед Google Scholar

  • 14.

    Ву С, Лю Х, Сяо Х, Конвей Дж.А., Хантер Э., Каппес Дж.К. Функциональные RT и IN включены в частицы ВИЧ-1 независимо от белка-предшественника Gag/Pol. EMBO J. 1997; 16: 5113–22.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 15.

    Saphire AC, Bobardt MD, Gallay PA. Спасение транскомплементации вирусов с дефицитом циклофилина А показывает, что потребность в циклофилине А для репликации вируса иммунодефицита человека типа 1 не зависит от его изомеразной активности. Дж Вирол. 2002; 76: 2255–62.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 16.

    Cavrois M, De Noronha C, Greene WC. Чувствительный и специфический ферментный анализ для выявления слияния вирионов ВИЧ-1 в первичных Т-лимфоцитах.Нац биотехнолог. 2002; 20:1151–4.

    КАС Статья пабмед Google Scholar

  • 17.

    Мюллер Б., Тессмер Ю., Шуберт Ю., Крауслих Х.Г. Белок Vpr вируса иммунодефицита человека типа 1 встраивается в вирион в значительно меньших количествах, чем gag, и фосфорилируется в инфицированных клетках. Дж Вирол. 2000;74:9727–31.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 18.

    Сингх С.П., Тунгатурти П., Картас М., Томкович Б., Ризви Т.А., Хан С.А., Кальянараман В.С., Шринивасан А. Вирион-ассоциированный Vpr ВИЧ-1: различное количество в вирусных частицах, полученных из клеток при вирусной инфекции или трансфекции провирусной ДНК. Вирусология. 2001; 283:78–83.

    КАС Статья пабмед Google Scholar

  • 19.

    Коэн Э.А., Дехни Г., Содроски Дж.Г., Хазелтин В.А. Продукт vpr вируса иммунодефицита человека представляет собой регуляторный белок, ассоциированный с вирионом.Дж Вирол. 1990;64:3097–9.

    Центральный пабмед КАС пабмед Google Scholar

  • 20.

    Перейра К.Ф., Росси Дж., Оуэн Д.М., Мак Дж., Гаус К. ВИЧ, полученный с помощью STORM: флуоресцентная микроскопия вирусной инфекции со сверхвысоким разрешением. Вирол Дж. 2012; 9:84.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 21.

    Чжу К.И., Тай А., Ли К.Л., Вонг К., Ван П.Визуализация нескольких промежуточных продуктов слияния мембран одного вируса, опосредованного различными слитыми белками. Микроск Рес Тех. 2010;73:886–900.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 22.

    Lampe M, Briggs JA, Endress T, Glass B, Riegelsberger S, Krauslich HG, Lamb DC, Brauchle C, Muller B. Частицы ВИЧ-1 с двойной меткой для изучения взаимодействия вируса с клеткой. Вирусология. 2007; 360: 92–104.

    КАС Статья пабмед Google Scholar

  • 23.

    Дейл Б.М., Макнерни Г.П., Томпсон Д.Л., Хабнер В., де Лос Рейес К., Чуанг Ф.Ю., Хузер Т., Чен Б.К. Перенос ВИЧ-1 от клетки к клетке через вирусологические синапсы приводит к созреванию эндосомального вириона, что активирует слияние вирусной мембраны. Клеточный микроб-хозяин. 2011;10:551–62.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 24.

    Кэмпбелл Э.М., Перес О., Мелар М., Хоуп Т.Дж. Мечение вирионов ВИЧ-1 двумя флуоресцентными белками позволяет идентифицировать вирионы, продуктивно проникшие в клетку-мишень.Вирусология. 2007; 360: 286–93.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 25.

    Маликов В., да Силва Э.С., Йовасевич В., Беннет Г., Де Соуза Аранья Виейра Д.А., Шульте Б., Диас-Грифферо Ф., Уолш Д., Нагави М.Х. Капсиды ВИЧ-1 связываются и используют адаптер кинезина-1 FEZ1 для движения внутрь ядра. Нац коммун. 2015;6:6660.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 26.

    Падилья-Парра С., Марин М., Галаут Н., Сутер Р., Кондо Н., Меликян Г.Б. Слияние зрелых частиц ВИЧ-1 приводит к полному высвобождению маркера содержимого на основе Gag-GFP и повышает внутривирусный рН. ПЛОС Один. 2013;8:e71002.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 27.

    Падилья-Парра С., Марин М., Кондо Н., Меликян Г.Б. Синхронное слияние ретровирусов с клетками, экспрессирующими альтернативные изоформы рецепторов, высвобождает вирусное ядро ​​в отдельные субклеточные компартменты.PLoS Патог. 2012;8:e1002694.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 28.

    Ллопис Дж., МакКаффери Дж.М., Мияваки А., Фаркуар М.Г., Цзянь Р.Ю. Измерение цитозольного, митохондриального pH и pH по шкале Гольджи в отдельных живых клетках с зелеными флуоресцентными белками. Proc Natl Acad Sci USA. 1998; 95: 6803–8.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 29.

    Джха Н.К., Латинович О., Мартин Э., Новицкий Г., Марин М., Мияучи К., Нотон Дж., Янг Дж.А., Меликян Г.Б. Визуализация одиночного проникновения ретровируса через альтернативные изоформы рецепторов и промежуточные продукты слияния вирус-эндосома. PLoS Патог. 2011;7:e1001260.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 30.

    Мияучи К., Марин М., Меликян Г.Б. Визуализация захвата и доставки ретровируса в кислые эндосомы.Биохим Дж. 2011;434:559–69.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 31.

    Падилья-Парра С., Марин М., Кондо Н., Меликян Г.Б. Точное определение мест проникновения ретровирусов в клетки, экспрессирующие изоформы рецепторов альтернативного сплайсинга, с помощью визуализации одного вируса. Ретровирусология. 2014;11:47.

    Центральный пабмед Статья пабмед Google Scholar

  • 32.

    Дженкинс Ю., МакЭнти М., Вайс К., Грин В.К. Характеристика ядерного импорта вируса ВИЧ-1 vpr: анализ сигналов и путей. Джей Селл Биол. 1998; 143: 875–85.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 33.

    Wyma DJ, Jiang J, Shi J, Zhou J, Lineberger JE, Miller MD, Aiken C. Связывание слияния вируса иммунодефицита человека типа 1 с созреванием вириона: новая роль цитоплазматического хвоста gp41. Дж Вирол.2004;78:3429–35.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 34.

    Forshey BM, von Schwedler U, Sundquist WI, Aiken C. Формирование ядра вируса иммунодефицита человека типа 1 с оптимальной стабильностью имеет решающее значение для репликации вируса. Дж Вирол. 2002; 76: 5667–77.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 35.

    Шах В.Б., Айкен С. Снятие оболочки ядер ВИЧ-1 in vitro. J Vis Exp. 2011;57:3384.

    ПабМед Google Scholar

  • 36.

    Нараян С., Барнард Р.Дж., Янг Дж.А. Два пути проникновения ретровирусов, отличающиеся ассоциацией липидного рафта с вирусным рецептором и различиями в вирусной инфекционности. Дж Вирол. 2003; 77: 1977–83.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 37.

    Ши Дж., Чжоу Дж., Шах В.Б., Айкен С., Уитби К. Низкомолекулярное ингибирование вируса иммунодефицита человека типа 1 путем дестабилизации вирусного капсида. Дж Вирол. 2011; 85: 542–9.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 38.

    Демирханян Л.Х., Марин М., Падилья-Парра С., Жан С., Мияучи К., Жан-Батист М., Новицкий Г., Лу В., Меликян Г.Б. Многогранные механизмы ингибирования проникновения ВИЧ-1 альфа-дефензином человека.Дж. Биол. Хим. 2012; 287:28821–38.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 39.

    Дросс Н., Сприет С., Цвергер М., Мюллер Г., Вальдек В., Ланговски Дж. Картирование подвижности олигомера eGFP в ядрах живых клеток. ПЛОС Один. 2009;4:e5041.

    Центральный пабмед Статья пабмед Google Scholar

  • 40.

    Депьен С., Рокес П., Креминон С., Фрич Л., Кассерон Р., Дормон Д., Даржемон С., Бенишу С.Распределение в клетке и кариофильные свойства белков матрикса, интегразы и Vpr вирусов иммунодефицита человека и обезьян. Разрешение ячейки опыта. 2000; 260:387–95.

    КАС Статья пабмед Google Scholar

  • 41.

    Gallay P, Stitt V, Mundy C, Oettinger M, Trono D. Роль пути кариоферина в переносе вируса иммунодефицита человека типа 1 в ядро. Дж Вирол. 1996; 70: 1027–32.

    Центральный пабмед КАС пабмед Google Scholar

  • 42.

    Штаубер Р.Х., Рулонг С., Палм Г., Тарасова Н.И. Прямая визуализация проникновения ВИЧ-1: механизмы и роль рецепторов клеточной поверхности. Biochem Biophys Res Commun. 1999; 258: 695–702.

    КАС Статья пабмед Google Scholar

  • 43.

    Фассати А., Гофф С.П. Характеристика внутриклеточных комплексов обратной транскрипции вируса иммунодефицита человека типа 1. J Virol. 2001;75:3626–35.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 44.

    Нермут М.В., Фассати А. Структурный анализ очищенных внутриклеточных комплексов обратной транскрипции вируса иммунодефицита человека 1 типа. Дж Вирол. 2003; 77: 8196–206.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 45.

    Аккола М.А., Охаген А., Готтлингер Х.Г. Выделение ядер вируса иммунодефицита человека типа 1: сохранение Vpr в отсутствие p6(gag). Дж Вирол. 2000;74:6198–202.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 46.

    Велкер Р., Хохенберг Х., Тессмер У., Хакхагель С., Крауслих Х.Г. Биохимический и структурный анализ изолированных зрелых ядер вируса иммунодефицита человека типа 1. J Virol. 2000;74:1168–77.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 47.

    Le Rouzic E, Mousnier A, Rustum C, Stutz F, Hallberg E, Dargemont C, Benichou S. Стыковка Vpr ВИЧ-1 с ядерной оболочкой опосредована взаимодействием с нуклеопорином hCG1.Дж. Биол. Хим. 2002; 277:45091–8.

    Артикул пабмед Google Scholar

  • 48.

    Лиска В., Шпехнер Д., Мехтали М., Шмитт Д., Кирн А., Обертен А.М. Локализация вирусного белка X в штамме макаки вируса иммунодефицита обезьян и анализ требований к его упаковке. Джей Ген Вирол. 1994; 75 (часть 11): 2955–62.

    КАС Статья пабмед Google Scholar

  • 49.

    Ким Б., Нгуен Л.А., Даддача В., Холленбо Дж.А. Тесное взаимодействие между уровнем белка SAMHD1, клеточными уровнями dNTP и кинетикой синтеза провирусной ДНК ВИЧ-1 в макрофагах, происходящих из первичных моноцитов человека. Дж. Биол. Хим. 2012; 287:21570–4.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 50.

    Jauregui P, Loge EC, Schultz ML, Fung S, Landau NR. Деградация SAMHD1 под действием Vpx не зависит от снятия покрытия. Дж Вирол.2015; 89: 5701–13.

    КАС Статья пабмед Google Scholar

  • 51.

    Кевалрамани В.Н., Эмерман М. Ассоциация Vpx со зрелыми структурами ядра ВИЧ-2. Вирусология. 1996; 218:159–68.

    КАС Статья пабмед Google Scholar

  • 52.

    Романи Б., Коэн Э.А. Дополнительные белки Vpr и Vpx лентивируса узурпируют убиквитинлигазу cullin4-DDB1 (DCAF1) E3.Карр Опин Вирол. 2012;2:755–63.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 53.

    Guenzel CA, Herate C, Benichou S. HIV-1 Vpr — все еще «загадочный многозадачный». Фронт микробиол. 2014;5:127.

    Центральный пабмед пабмед Google Scholar

  • 54.

    Лагетт Н., Бреньяр С., Хью П., Басбус Дж., Ятим А., Ларрок М., Кирххофф Ф., Константину А., Собхиан Б., Бенкиран М.Преждевременная активация комплекса SLX4 с помощью Vpr способствует аресту G2/M и ускользанию от врожденного иммунного восприятия. Клетка. 2014; 156:134–45.

    КАС Статья пабмед Google Scholar

  • 55.

    Zhang S, Pointer D, Singer G, Feng Y, Park K, Zhao LJ. Прямое связывание Vpr вируса иммунодефицита человека типа 1 с нуклеиновыми кислотами. Ген. 1998; 212:157–66.

    КАС Статья пабмед Google Scholar

  • 56.

    де Рокиньи Х., Канепаро А., Делоне Т., Бишерур Дж., Мускаде Ж.Ф., Рокес Б.П. Взаимодействие С-конца вирусного белка R с нуклеиновыми кислотами модулируется его N-концом. Евр Дж Биохим. 2000; 267:3654–60.

    Артикул пабмед Google Scholar

  • 57.

    Shimura M, Toyoda Y, Iijima K, Kinomoto M, Tokunaga K, Yoda K, Yanagida M, Sata T, Ishizaka Y. Эпигенетическое вытеснение HP1 из гетерохроматина с помощью Vpr ВИЧ-1 вызывает преждевременное разделение сестринских хроматид.Джей Селл Биол. 2011; 194:721–35.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 58.

    Белзиле Д.П., Абраамян Л.Г., Жерар Ф.С., Ружо Н., Коэн Э.А. Формирование мобильных ядерных очагов, связанных с хроматином, содержащих Vpr и VPRBP ВИЧ-1, имеет решающее значение для индукции остановки клеточного цикла G2. PLoS Патог. 2010;6:e1001080.

    Центральный пабмед Статья пабмед Google Scholar

  • 59.

    Fritz JV, Didier P, Clamme JP, Schaub E, Muriaux D, Cabanne C, Morellet N, Bouaziz S, Darlix JL, Mely Y, de Rocquigny H. Прямое взаимодействие Vpr-Vpr в клетках, наблюдаемое с помощью двухфотонной флуоресцентной корреляционной спектроскопии и визуализация жизни флуоресценции. Ретровирусология. 2008; 5:87.

    Центральный пабмед Статья пабмед Google Scholar

  • 60.

    Вальдхубер М.Г., Бейтсон М., Тан Дж., Гринуэй А.Л., Макфи Д.А. Исследования со слитыми белками GFP-Vpr: индукция апоптоза, но устранение остановки клеточного цикла, несмотря на ядерную мембрану или локализацию в ядре.Вирусология. 2003; 313: 91–104.

    КАС Статья пабмед Google Scholar

  • 61.

    Мутумани К., Монтанер Л.Дж., Айяву В., Вайнер Д.Б. Частица вириона Vpr-GFP идентифицирует ВИЧ-инфицированные мишени и сохраняет функцию HIV-1Vpr в макрофагах и Т-клетках. ДНК-клеточная биол. 2000; 19: 179–88.

    КАС Статья пабмед Google Scholar

  • 62.

    Го В.К., Рогель М.Е., Кинси К.М., Майкл С.Ф., Фульц П.Н., Новак М.А., Хан Б.Х., Эмерман М.Vpr ВИЧ-1 увеличивает экспрессию вируса, манипулируя клеточным циклом: механизм селекции Vpr in vivo. Нат Мед. 1998; 4: 65–71.

    КАС Статья пабмед Google Scholar

  • 63.

    Яо XJ, Муланд А.Дж., Суббраманиан Р.А., Форгет Дж., Ружо Н., Бержерон Д., Коэн Э.А. Vpr стимулирует экспрессию вируса и вызывает гибель клеток в делящихся Т-клетках Jurkat, инфицированных вирусом иммунодефицита человека типа 1. Дж Вирол. 1998;72:4686–93.

    Центральный пабмед КАС пабмед Google Scholar

  • 64.

    Balliet JW, Kolson DL, Eiger G, Kim FM, McGann KA, Srinivasan A, Collman R. Отличительные эффекты в первичных макрофагах и лимфоцитах дополнительных генов вируса иммунодефицита человека типа 1 vpr, vpu и nef: мутационный анализ первичного изолята ВИЧ-1. Вирусология. 1994; 200: 623–31.

    КАС Статья пабмед Google Scholar

  • 65.

    Коннор Р.И., Чен Б.К., Чоу С., Ландау Н.Р. Vpr необходим для эффективной репликации вируса иммунодефицита человека типа 1 в мононуклеарных фагоцитах. Вирусология. 1995; 206: 935–44.

    КАС Статья пабмед Google Scholar

  • 66.

    de Silva S, Planelles V, Wu L. Дифференциальные эффекты Vpr на одноцикловые и распространяющиеся инфекции ВИЧ-1 в CD4 + T-клетках и дендритных клетках. ПЛОС Один. 2012;7:e35385.

    Центральный пабмед Статья пабмед Google Scholar

  • 67.

    Экштейн Д.А., Шерман М.П., ​​Пенн М.Л., Чин П.С., Де Норонья К.М., Грин В.К., Голдсмит М.А. Vpr ВИЧ-1 увеличивает вирусную нагрузку, способствуя инфицированию тканевых макрофагов, но не неделящихся CD4 + Т-клеток. J Эксперт Мед. 2001; 194:1407–19.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 68.

    Машиба М., Коллинз Д.Р., Терри В.Х., Коллинз К.Л. Vpr преодолевает специфичное для макрофагов ограничение экспрессии Env ВИЧ-1 и продукции вириона.Клеточный микроб-хозяин. 2014;16:722–35.

    КАС Статья пабмед Google Scholar

  • 69.

    Шерман М.П., ​​де Норонья К.М., Экштейн Л.А., Хатай Дж., Мундт П., Уильямс С.А., Нейдлман Дж.А., Голдсмит М.А., Грин В.К. Ядерный экспорт Vpr необходим для эффективной репликации вируса иммунодефицита человека типа 1 в тканевых макрофагах. Дж Вирол. 2003; 77: 7582–9.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 70.

    Jacquot G, Le Rouzic E, David A, Mazzolini J, Bouchet J, Bouaziz S, Niedergang F, Pancino G, Benichou S. Локализация Vpr ВИЧ-1 в ядерной оболочке: влияние на функции Vpr и репликацию вируса в макрофагах. Ретровирусология. 2007; 4:84.

    Центральный пабмед Статья пабмед Google Scholar

  • 71.

    Хайнзингер Н.К., Букринский М.И., Хаггерти С.А., Рагланд А.М., Кевалрамани В., Ли М.А., Гендельман Х.Е., Ратнер Л., Стивенсон М., Эмерман М.Белок Vpr вируса иммунодефицита человека типа 1 влияет на ядерную локализацию вирусных нуклеиновых кислот в неделящихся клетках-хозяевах. Proc Natl Acad Sci USA. 1994; 91:7311–5.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 72.

    Коэн Э.А., Тервиллигер Э.Ф., Джалинус Ю., Пру Дж., Содроски Дж.Г., Хазелтин В.А. Идентификация продукта и функции vpr ВИЧ-1. J Приобретение иммунодефицитного синдрома. 1990; 3:11–8.

    КАС пабмед Google Scholar

  • 73.

    Popov S, Rexach M, Zybarth G, Reiling N, Lee MA, Ratner L, Lane CM, Moore MS, Blobel G, Bukrinsky M. Вирусный белок R регулирует ядерный импорт преинтеграционного комплекса ВИЧ-1. EMBO J. 1998; 17: 909–17.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 74.

    Фельзин Л.К., Воффендин С., Хоттигер М.О., Суббраманиан Р.А., Коэн Э.А., Набель Г.Дж. Активация транскрипции ВИЧ вспомогательным белком VPR опосредуется коактиватором p300.Proc Natl Acad Sci USA. 1998; 95: 5281–6.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 75.

    Хримех М., Яо XJ, Бачанд Ф., Ружо Н., Коэн Э.А. Вирус иммунодефицита человека типа 1 (ВИЧ-1) Vpr действует как белок немедленного начала во время инфекции ВИЧ-1. Дж Вирол. 1999;73:4101–9.

    Центральный пабмед КАС пабмед Google Scholar

  • 76.

    Hoshino S, Konishi M, Mori M, Shimura M, Nishitani C, Kuroki Y, Koyanagi Y, Kano S, Itabe H, Ishizaka Y. Vpr ВИЧ-1 индуцирует опосредованную TLR4/MyD88 продукцию IL-6 и реактивирует продукцию вируса из задержка. Дж. Лейкок Биол. 2010;87:1133–43.

    КАС Статья пабмед Google Scholar

  • 77.

    Varin A, Decrion AZ, Sabbah E, Quivy V, Sire J, Van Lint C, Roques BP, Aggarwal BB, Herbein G. Синтетический белок Vpr активирует активатор белка-1, N-концевую киназу c-Jun , и NF-kappaB и стимулирует транскрипцию ВИЧ-1 в промоноцитарных клетках и первичных макрофагах.Дж. Биол. Хим. 2005; 280:42557–67.

    КАС Статья пабмед Google Scholar

  • 78.

    Liu R, Lin Y, Jia R, Geng Y, Liang C, Tan J, Qiao W. Vpr ВИЧ-1 стимулирует передачу сигналов NF-kappaB и AP-1 путем активации TAK1. Ретровирусология. 2014;11:45.

    Центральный пабмед Статья пабмед Google Scholar

  • 79.

    Ру П., Альфьери К., Хримеч М., Коэн Э.А., Таннер Дж.Е.Активация факторов транскрипции NF-kappaB и NF-IL-6 белком R вируса иммунодефицита человека типа 1 (Vpr) индуцирует экспрессию интерлейкина-8. Дж Вирол. 2000;74:4658–65.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 80.

    Окумура А., Алсе Т., Лубёва Б., Эзель Х., Стребель К., Пита П.М. Дополнительные белки ВИЧ-1 VPR и Vif модулируют противовирусный ответ, направляя IRF-3 для деградации. Вирусология. 2008; 373:85–97.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 81.

    Пун Б., Гровит-Фербас К., Стюарт С.А., Чен И.С. Остановка клеточного цикла с помощью Vpr в вирионах ВИЧ-1 и нечувствительность к антиретровирусным препаратам. Наука. 1998; 281: 266–9.

    КАС Статья пабмед Google Scholar

  • 82.

    Вэй С., Декер Дж. М., Лю Х., Чжан З., Арани Р. Б., Килби Дж. М., Сааг М. С., Ву С., Шоу Г. М., Каппес Д. К.Возникновение резистентного вируса иммунодефицита человека типа 1 у пациентов, получающих монотерапию ингибитором слияния (Т-20). Противомикробные агенты Chemother. 2002; 46: 1896–905.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 83.

    де ла Вега М., Марин М., Кондо Н., Мияучи К., Ким Ю., Эпанд Р.Ф., Эпанд Р.М., Меликян Г.Б. Ингибирование эндоцитоза ВИЧ-1 делает возможным смешивание липидов на плазматической мембране, но не полное их слияние.Ретровирусология. 2011;8:99.

    Центральный пабмед Статья пабмед Google Scholar

  • 84.

    Netter RC, Amberg SM, Balliet JW, Biscone MJ, Vermeulen A, Earp LJ, White JM, Bates P. Пептиды на основе гептадных повторов 2 ингибируют инфекцию птичьей саркомы и вируса лейкоза подгруппы a и определяют промежуточный продукт слияния . Дж Вирол. 2004; 78:13430–9.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 85.

    Кондо Н, Меликян ГБ. Молекула межклеточной адгезии 1 способствует прикреплению ВИЧ-1, но не слиянию с клетками-мишенями. ПЛОС Один. 2012;7:e44827.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 86.

    Aiken C. Бесклеточные анализы на ВИЧ-1 без покрытия. Методы Мол Биол. 2009; 485:41–53.

    КАС Статья пабмед Google Scholar

  • Стэнфордский университет — Оушенсайд — Школы стипендий

    Эта неделя станет отличным началом февраля! В 3-м классе естественных наук мы завершаем первую главу «Наследование и черты», в которой ученые совместно работают над научным объяснением того, почему волки в Грейстоун-парке выглядят по-разному, хотя все они принадлежат к одному и тому же виду.Мы потратили много времени на обсуждение вариаций признаков других видов, и это был отличный способ развить навыки описания особенностей конкретного организма, а не просто говорить «это похоже на собаку». На этой неделе мы добавляем данные словарного запаса, виды, вариации и объяснения на нашу стену слов, а также читаем об адаптации животных для беглости речи и понимания.
    На этой неделе 3-й класс также начинает наш проект PBL, задавая главный вопрос: «Как мы можем спроектировать крошечный дом, отвечающий потребностям бездомной молодежи в районе Оушенсайд?» Это огромная проблема, вызывающая озабоченность в сообществах по всей Америке, и Оушенсайд не исключение. Наши ученые будут изучать статистику о бездомной молодежи и семьях, а также отвечать на классовые вопросы, которые у них были, такие как «Почему люди бездомные?» и «Кто может помочь вам, если вы станете бездомным?» Когда мы узнаем об этой проблеме, мы будем рассматривать одно из возможных решений строительства крошечных домов для бездомной молодежи, а ученые создадут модель крошечного дома. Этот проект будет представлен на нашей выставке PBL 19 марта, так что это только начало удивительного проекта для наших 3-классников.

    4-классники работают над своим последним заданием в нашем блоке преобразования энергии, представляя аргументы в пользу решения по улучшению электрической системы города Эргстаун. Они будут собирать данные обо всех возможных улучшениях в органайзере, а оттуда, основываясь на наших критериях, они должны сделать заявление и подтвердить доказательствами, какое улучшение они считают лучшим. Это фантастическое завершающее занятие для модуля, так как ученые могут практиковать все навыки, над которыми мы работали до сих пор: делать заявления, использовать критерии для принятия решения, подкреплять его несколькими формами доказательств и использовать язык. дисциплины.На этой неделе мы также будем разбираться в прочитанном о том, откуда берутся камни, и посвятим несколько дней исследованию в нашем проекте «Кто был/является…ученым».

    Предстоящие даты

    Обучение родителей-волонтеров и сопровождающих, 4 февраля, 17:00–17:30

    Кофе с директором, 5 февраля, 8:30–9:15, место: Art Room

    Тема: Результаты CAASPP и 20–21 гол

    Сбор команды Pep, 10 февраля с 18:00 до 19:00

    Ужин в ресторане: Chick fil A, 12 февраля, с 16:00 до 19:00

    Нет школы: День президента, 17 февраля

    Совет SPS Встреча, 18 февраля с 16:30 до 18:30,

    Ужин: Chick fil A, 20 февраля, с 16 до 19:00

    Fechas siguientes

    Entrenamiento para padres voluntarios y acompañantes, 4 февраля, 5:00- 17:30

    Кафе с директором, 5 февраля, 8:30-9:30, время: Sala de Arte

    Тема: Puntajes CAASPP y 20-21 goles

    Pep Squad Meeting, 10 февраля 18–19 часов

    Занятия в ресторане: Chick fil A, 12 февраля, 16–19 часов

    Занятия без сена: día del Presidente, 17 февраля

    Заседание Совета директоров SPS, 1 8 февраля с 16:30 до 18:30

    Заказать: Chick fil A, 20 февраля, с 16:00 до 19:00

    Образование — Детские шоу PBS

    С Новым годом! Мы добавили несколько наших любимых зимних тематических наборов для дома или школы! Мы включили ссылки на местные подкасты, такие как But Why (дошкольный класс 5), Timeline  (средняя школа) и One Small Step (средняя школа). Ознакомьтесь с безопасным, бесплатным и образовательным (до 3-го класса) игровым приложением PBS Kids и видеоприложением PBS Kids. Существуют интерактивные ресурсы по медиаграмотности и вебинары для учителей. Все новинки 2022 года!


    Только для учителей!


    Проект One Small Step Общественного радио Вермонта   

    Общественное радио Вермонта и Vermont PBS объединились и совместно работают над захватывающим проектом StoryCorp под названием One Small Step. «Один маленький шаг» — это общенациональная инициатива, направленная на преодоление политических разногласий и укрепление сообществ по одному разговору за раз.Это руководство – один маленький шаг – поможет преподавателям старшеклассников создать возможности для изучения политической идентичности и различий, но, что наиболее важно, найти точки соприкосновения. Чтобы узнать больше о способах вовлечения вашей школы или учащихся, напишите Хизер Дюамель, менеджеру по вопросам образования, по адресу [email protected] org.

    Хотите узнать больше?  

     


    От дошкольного до 2-го класса


    Наслаждайтесь БЕСПЛАТНЫМИ обучающими играми и подкастами!




    Другие вебинары для семейств



    9



    9072


    1 ​​



    Главный лист Critatic ChangeMaker — Давайте расширим повествование и способы, которыми мы думаем о цифровых медиа в классе!

    Информационный текст для сопровождения курсных лист в курсе:



    Средняя школа


    VPR PDR PODCAST: Срон с новым руководством обучения (WebQuest)

    Узнайте больше о Скотте Джоплин в январе.Композитора Скотта Джоплина называли «королем рэгтайма». Хотя его произведения были популярны при жизни, у Джоплина не было легкой жизни или королевского богатства.

    Расширение повествовательных ресурсов на PBS Schoolmedia

    1 9072


    Brave Little Mite Minal Highlights Podcast: черный комфорт, или его отсутствие, в Vermont

    мы чувствуем себя комфортно — или неудобно — и поговорить о жизни в Вермонте с черным ребенком или как с ним.  

    Вебинары и ресурсы для учителей  (для всех) 

    Виришу завдання впр на навколишний свит. ВПР навколишній свит методическая разработка навколишний свит (4 класс) по теме. Состав версии конверсионного робота

    Зразок ВПР 2018 с навколишним свит 4 класса с видповидами. Всероссийский оборот робота 2018 по Навколишному свиту 4 класс, реванш 10 сотрудников. За визит робота дается 45 хвили с навколишнего света.

    Завдання 1. Посмотрите на малышей, на которых изображен кабинет врача. Сталь можно сделать из дерева. Выигрыш значений на маленьком с линией с соответствующим письмом.

    Покажи мне маленькую вещь с маленькой стрелкой, будь то предмет (будь то деталь) из металла и будь предмет (будь то деталь) из камня. Позвольте мне дать вам название общего материала порядка стрелки кожи.

    Завдання 2. На интернет-сайтах можно увидеть такие таблицы.Вивчи прогноз ждать три доби.

    Viber правильное подтверждение о очікуванной погоде на троих добавьте и запишите рядом с указанными цифрами.

    1) В середине температура не превышает 21°С.
    2) На винторок дме пивничный витер.
    3) Вология не меняется с вечера второго до середины дня.
    4) С натяжкой три, добить плохо.

    Завдання 3 (вариант 1). Посмотрите на карту. Ни на одной из букв А и В не обозначено два континента.

    3.1. Запишите название континента скина во введенное поле.

    Материк A: __________
    Материк B: __________

    3.2. На оскорбительной стороне фотографии бобра, бобра, зебры и носорога. Запишите название шкуры цихского тварина, порядок номера фотографии, на которой изображено изображение.

    3.3. Вы живете в естественной среде (не в зоопарке) на материке А, но живете ли вы на материке Б? Запишите количество фотографий с картинок чич-тварин.

    Завдання 3 (2 варианта). Посмотрите на карту. На ній буквами А и Б обозначены две природные зоны.

    3.1. Запишите название зоны естественного кожного покрова во введенное поле.

    Название природной зоны А: __________
    Название природной зоны В: __________

    3.2. На оскорбительной стороне изображение фотографии соболя, полярной совы, песца и бурой бороды. Запишите название шкуры цихского тварина, порядок номера фотографии, на которой изображено изображение.

    1) ____________________________ 2) ______________________________
    3) ______________________________ 4) _________________________________

    3.3. Як сич тварин задерживается в природном очаге (не в зоопарке) на территории природной зоны А, а як — природной зоны Б? Запишите количество фотографий с изображений животных в таблице ниже по буквам.

    Природная зона А Б
    Существа

    Завдання 4. Хранить два правила для сохранения здоровья людей от руководящих частей фраз: для всего на коже положение первого, принять положение другого.

    Ухо фразы
    А) Чтобы не заразиться во рту,
    Б) Не простужаться, выходить на улицу в холодную погоду,

    Продолжение фразы
    1) надо одеться потеплее.
    2) необходимо регулярно заниматься физической культурой.
    3) необходимо регулярно чистить зубы.

    Завдання 5. Посмотрите на фото людей. Покажите стрелками и напишите поучение, плечо и голень человека, как показано на прикладе.

    Завдання 6. Артем, понаблюдав за ростками гороха и парами, объявился. Скоба з’ясувати, настоявшего озарение на скорость прорастания, возьми две фляги, потыкай из них по щепотке того же горошка и воды с одного танца, чтобы мы из воды выросли. Оскорбляя фляги, Артем поставил на стеклянный фронт лампу дневного света или даже на одну из них, заслонив лампу картонной коробкой с вирусными отверстиями. Потом Артем спостеригав за
    з’являются в обеих колбах с паром.

    6.1. Зистави проращивают горох в двух небольших колбах в указанной дозировке. Подкресли в коже ряд с одним из видений.

    Температура кюветы в двух колбах: та же/разная
    Освещенность дневная в двух колбах: та же/разная

    6.2. Як вимирювання и поровняння может провести Артем, сколько еще, какой настой иллюминации на скорость роста дня?

    6.3. За помощью какой уверенности может съясувати Артем, вселивший явление недомерка на Глоссе на скорость прорастания нашего дня? Опишите цей досвид.

    Завданья 7 (вариант 1). Посмотрите на знаки на малышах. Як ты думаешь, как из этих признаков может развиться кожа?

    Вид:
    1 – ____________________________________________________________________________
    2 – ____________________________________________________________________________
    3 – _______________________________________________________________


    Запишите правила.

    Завданья 7 (вариант 2). Посмотрите на знаки на малышах. Як ти важно, що об’єднує
    знаков усов?

    Каково правило показа кожи со всех вывесок?
    Запишите правила.

    Правило 1: __________________________________________________________________________
    Правило 2: ____________________________________________________________________________
    Правило 3: __________________________________________________________________________

    Завданья 8 (вариант 1). На фото изображения предметов, которые раскрашивают представители новых профессий. Viber ONE по фотографиям и запишите букву, как она обозначена.

    Представители какой профессии делают предметы из изображений на ярких фотографиях? Пока вы знаете много профессий, представителей тех, кто работает из выбран(ов) с вами предмета(ов), назовите их. Яку робот виконует людей всей профессии? Почему люди, работающие по профессии, за отстранение?

    Вибрана фото: __

    Вид: ______________________________________________________________

    Завданья 8 (2 варианта). На фотографиях есть изображения предметов, которые представлены представителями одной профессии.

    Что это за профессия? Яку-робот виконуют людей всей профессии? Почему люди, работающие по профессии, за отстранение?

    Вид: ______________________________________________________________

    Завданья 8 (вариант 3). На фотографиях люди промышленных профессий за работой. Viber ONE по фотографиям и запишите букву, как она обозначена.

    Представитель какой имидж-профессии на вибраниумной фотографии? Яку-робот виконуют людей всей профессии? Какие материалы/какие есть у використов, чтобы представлять представителей робототехнической профессии?

    Вибрана фото: __

    Вид: ______________________________________________________________

    Завдання 9. День матери является международным священным праздником в честь матерей. В России об этом официально говорят в последние дни листопада.Обведите дату в календаре.

    Запишитесь на месяц годичный в 2018 году.

    Просмотр: ____________________________

    Як ти вважаєш, кто самый важный день для кожи людей? (Напишите около
    , поругавшись до пяти предложений.)

    Вид: ______________________________________________________________

    Завданная 10.

    10.1. Запишите название области: республик, областей, областей, областей, автономных областей, где вы проживаете.

    Вид: ______________________________________________________________

    10.2. Как называется ваша головня по месту вашей области/района, в котором вы живете?

    Вид: ______________________________________________________________

    10.3. Какие товары из вашего региона? Каковы воспоминания о природе и воспоминания об истории этой культуры в вашем регионе? Свидетельства об одном из цихских мемориалов.

    Вид: ______________________________________________________________

    Видповиди на Зразок ВПР 2018 от навколичного свита 4 класс
    Завдання 1


    Завдання 2 . 24
    Завдання 3
    3.1. А — Африка; Б — Евразия / А — тундра; Б — тайга
    3.2. 1) носорог; 2) белый яд; 3) зебра; 4) бобр / 1) соболь; 2) полярная сова; 3) песец; 4) гроза ср середина
    3.3. Африка — 13 чи 31; Евразия — 24 чи 42 / тундра — 23 чи 32; тайга-14 чи 41
    Завдання 4 . 31
    Завданная 5

    Завданная 6
    6.1. температура такая же, подсветка
    6.2. необходимо получить пар из двух колб
    6.3. В одну бутылку надо насыпать три части земли и залить водой, в одну бутыль — ту землю насыпать и полить водой. Наденьте колбы на руку, пули одной освещенности и одной температуры.
    Завдання 7 (вариант 1) .
    1.Misce, как можно создать скин из знаков:
    1) улица; 2) Музей/Торговый центр Тошо; 3) бирка платья;
    2.Правила:

    2 — Фотографии вклеены на одно и то же место.
    3 — Цю Рич нельзя гладить.
    Завдання 7 (вариант 2) .
    1) в случае с продуктами питания: все знаки могут быть установлены на обочине дороги;
    2) правила:
    1 — Вот переходи дорогу с пропуском.
    2 — Будьте осторожны! Здесь дорогу могут переходить дети.
    3 — Здесь есть велопрогулка.
    Завдання 9
    Необходимо обвести 25 листов

    Вариант №1

    Демонстрационная версия ВПР для навколишнего свиту 4 класс 2017 г. рк.

    После часа показа фабрики с кратким уведомлением, напишите число в поле, чтобы указать правильный номер, либо цифру, либо слово, либо последнюю букву (слово) или цифры.Просмотр следующей записи без разрывов и дополнительных символов.

    Как вариант заданий в качестве учителя можно войти или добавить сообщение на фабрику с поднятым видом. Вчитель менять результаты и отображать результаты из краткого просмотра и можно оценить результаты списка из открытого просмотра. Посетил читатель Бали, чтобы появиться из вашей статистики.


    Версия для друга и копия в MS Word

    На интернет-сайтах можно увидеть такие таблицы. Вивчи прогноз ждать три доби.

    Viber правильное подтверждение о очікуванную погоду на троих добавьте и запишите в строке заданных цифр.

    1) В середине температуры не превышать 21°С.

    2) На винторок дме пивничный витер.

    3) Вология не меняется с вечера второго до середины дня.

    4) С натяжкой три, добить плохо.

    Вид:

    Храните два правила сохранения здоровья людей из руководящих частей фраз: в целом на кожу положение первого, принять положение другого.

    Запишите сверху цифры, раскладывая их по порядку, для букв:

    Вид:

    Посмотрите на малышей, на которых изображен шкаф. Внутреннюю часть окна можно подготовить со склада. Вона отмечена маленькой стрелкой с общим написанием.

    Стрелочкой покажи вещицу то ли это предмет (деталь) из металла, то ли это предмет (деталь) из бумаги. Позвольте мне дать вам название общего материала порядка стрелки кожи.

    Посмотрите на карту. Ни на одной из букв А и В не обозначено два континента.

    Запишите название континента кожи в введенное поле.

    Посмотрите на изображение людей. Показать стрелками и знаками хомилка , плечо и трус человек как показано на прикладе.

    Ревизия фабрики из открытого вида не меняется автоматически.
    В наступлении вам будет предложено пересмотреть их самостоятельно.

    Артем, понаблюдав за всходами гороха и парами, объявился. Скоба з’ясувати, настоявшего озарение на скорость прорастания, возьми две фляги, потыкай из них по щепотке того же горошка и воды с одного танца, чтобы мы из воды выросли. Оскорбляя фляги, Артем поставил на стеклянный фронт лампу дневного света или даже на одну из них, заслонив лампу картонной коробкой с вирусными отверстиями. Потом за парами зашагал Артем и показался в обеих флягах.

    В описываемом опыте горох срывают и проращивают в двух колбах. Подкресли в коже ряд с одним из видений.

    Температура кюветы в двух колбах: та же/разная

    Освещенность дневная в двух колбах: та же/разная

    Посмотрите на таблички на мал. Возможно ли развитие кожи от этих признаков?

    Как вы думаете, какое правило изображения кожи с этих знаков?

    Запишите правила.

    Ревизия фабрики из открытого вида не меняется автоматически.
    В наступлении вам будет предложено пересмотреть их самостоятельно.

    На фото изображения предметов, которые нарисованы представителями новых профессий. Viber ONE по фотографиям и запишите букву, как она обозначена. Представители какой профессии делают предметы из изображений на ярких фотографиях? Если вы знаете много профессий, представителей тех, кто практикует из вибраним(ов) с вашим предметом(ами), звоните по номеру … Яку роботов виконуют люди всей профессии? Почему люди, работающие по профессии, за отстранение?

    ВПР Навколишній легкий класс 4 (зразки, опции)

    ВВР 2020р., 4 класс Реверс робота от темы «Навколишний світ». ЗРАЗОК.

    ВВР 2019.4 кл. Навколишній свет. Варианты Trenuval 1-5 с разными опциями.

    ВВР 2016р., 4 класс. Обращение робота из темы «Навколишний свит».Зразок.

    2016. — 10 стр. (+ 8 стр., критерии оценки).

    Демо-версия. Учебно-методические материалы предназначены для изучения и индивидуального обучения (в школе и дома) четырехклассников до объявления Всероссийской школы образования конверсионных роботов (ВПР) навколишним светом.
    Перед всеми постройками установлены обзор, решение, критерии оценки.

    Формат: pdf

    Роземир: 769 КБ

    Marvel, скачать: диск.Google

    Диагностика робота по предмету «Навколишний свет», 4 класс, демо версия 2015 г. для рока, НИКО (Национальная доза качества)

    20 сторон, с индикацией (система оценки диагностических роботов) + Спецификация 9 что в.»

    ФИ _____________________________ Подготовка перед ВПР по навколишному свету. Тест за 4 класс 1. Напишите цифрами, как от живой природы -1, до неживой природы-2, раздавленной руками людей-3.Ожог, фломастеры, пидручник, ромашка, камень, плотва, мох, сова, паркан, шкарпетки, рычка, мисяц, крип, писок, руда, комар, липа, колодец, снажинки. Травы чагарники дерева Троянды, ромашки, вильхи, кульбабы, сливы, окропления, клена, смородины 2. Розы по группе: 3. Пополнить группу рослины окурками (3 наименования рослины): Хвойные ________________________________________________________________ Списки _________________________________________________ , для которых Я знаком с распределением роста линии).Горобина, лататта, яливец — _____________________________. Черная смородина, петрушка, яблоко ____________________________. 5. Запишите название группы, пока что за существо там. Бабушка — _________________, верблюд — ____________________, жаба — __________________, снеговик — ___________________, орел — ________________________________, дельфин — ______________________, кобра — ___________________, леминг — _____________________________, курица — ___________________, ящик — ________________________________, тест за 4 — класс ____________________ в цифрах, это стоит жить в природе -1, перед неживой природой-2, раздавленными руками людей-3. Ожог, фломастеры, пидручник, ромашка, камень, плотва, мох, сова, паркан, шкарпетки, рычка, мисяц, крип, писок, руда, комар, липа, колодец, снажинки. 2. Розы по группам: Травы чагарники дерева Троянды, ромашка, вильха, кульбаба, слива, окропление, клен, смородина 3. Пополнить группу рослины окурками (3 наименования рослины): Хвойные _________________________________________________ Списки _________________________________________________ 4. Подпідні _________________________________________________ 4.Подпоследний для которого я знаком с распределением темпов роста). Горобина, лататта, яливец — _____________________________. Черная смородина, петрушка, яблоко ____________________________. 5. Запишите название группы, пока что за существо там. Бабка — _________________, верблюд — ______________________, жаба — __________________, снигирь — ___________________, орел — ___________________, дельфин — ______________________, кобра — ___________________, леминг — _____________________________, курица — ___________________, ящерица — ____________________________,. 6. Назовите орган чувств: дотик — ____________, зир — _____________, слух — __________ _________, обоняние — ________________, вкус — _________________. скорпион -________________, черепаха -_______________________. 6. Назовите орган чувств: дотик — ____________, зир — _____________, слух — __________ _________, обоняние — ________________, вкус — _________________. 7. Ебать органи людей (не меньше трех). 8. Запишите в правильном порядке все планеты Сонячной. системы (зафиксировать прямо издалека с Сонца).____________________________________________________________ ____________________________________________________________. _____________________________________________________________. ____________________________________________________________. ____________________________________________________________. ____________________________________________________________. ___________________________________. _______________ ____________________________________________________________. 9. Трансферы всех континентов нашей планеты. 10. День и ночь на планете Земля лечь от 11. На пути к судьбе на Земле лечь на планету 12. Разбить океаны планеты Земля. 13. Назовите спутника Земли. 14. Напишите, как использовать воду (не менее 5): 7. Трахните органи людей (не менее трех). Нервная система — ____________________________________________, Травная система — _________________________________________________, Видильная система — ______________________________________________, Кровеносная система — ______________________________________________, Дихальная система — _____________________________________________, Опорно-руховая — ________________________________________________.8. Запишите в правильном порядке все планеты системы Сони (читать прямо с расстояния от Сони). ____________________________________________________________ ____________________________________________________________. 9. Трансферы всех континентов нашей планеты. _____________________________________________________________. 10. День и ночь на планете Земля лежат в ____________________________________________________________. 11. Время залегания горных пород на планете Земля ____________________________________________________________.12. Переход океана планеты Земля. ____________________________________________________________. 13. Назовите спутника Земли. ___________________________________. 14. Запишите способы использования воды в доме (не менее 5): _______________ ____________________________________________________________. 15. Напишите, что я буду следить за раханком месяца _____ месяца, весной _____. Напишите буквы месяца: _______________________________. 16. Напишите по компасу в сторону горизонта, указанную стрелкой.(Кроме горизонта, певческий порядок растет в сторону только одного, что, если я знаю меньше одного, то можно сделать различие.) 15. Напиши, как рахунк рядом с рахунка рядом с ротси мисяц титон _____ , вересен _____. Напишите буквы месяца: _______________________________. 16. Напишите по компасу в сторону горизонта, указанную стрелкой. (Кроме горизонта, поющий порядок растет как один, кто знает что-то одно, тот и может это обозначить. ) У В Ы С Ы С 17.Напишите 3 артикула воды в природе: 18. Напишите названия дорожных знаков. __________________________. 17. Напишите 3 картинки воды с натуры: 18. Напишите название дорожных знаков. __________________________. ____________ _____________ ______________ ________________ ____________ _____________ ______________ ________________

    ВВР, судя по навколишному свету, хранится в двух частях. В первую часть включены 6 построек, а в другую — 4, так что у всех роботов по 10 построек.Первые два взгляда на увиденные необходимые элементы изображения, следующие три — на письменный краткий обзор, а последние пять — открытые. Завдання 3, 6, 7 доведена до установленного уровня складывания, а сито — до основного.

    Рейтинговая система

    Суммарно для VLF можно исключить 31 точку по навколишному свету. Бали следует перевести в смету по следующей схеме:

    Прикрепите фабрику с помощью воздушных шаров, которые объясняются

    Завданная 1

    В самых разных изображениях младенцев — например, в следующих:


    Объект из дерева назначается новому. Я усвою потребность думать, а так она сама означает два предмета, один с резким крошением, например, с металлом, а другой — с бумагой.

    Правильно указаны два предмета, кожа из которой викония и из других материалов — ставь 2 бали. Как только нет указаний, сабж лишается одного материала — 1. Как только нет действительных указаний, балл по цене отрицать не буду.

    Завданная 2

    У другого сотрудника может быть таблица, например, с прогнозом погоды на три дня.Перед ней 4 тяжёлых времени, для которых нужно вибрировать — это типа «в пятницу температура днём не меняется 28 градусов» и «будет спать три дня». Так же как и вибрация, все правильно, ученик сможет избавиться от 2 бали. Разрешалось одно помилование (или одно вирне не написано) — 1. В інших випадках ставилось 0 баллов.

    Завданная 3

    У нас много интимных частей. Усёго по цене изготовления можно урезать на 6 баллов.

    Возле первой части представлена ​​карта, де на двух природных зонах (например, тайга и дикая природа) и континентах (например, Евразия и Африка) стоят два знака — А и Б. , необходимо написать название континентов. Если нет прощения — ставить 2 бали, если есть одно прощение — 1, а если больше одного — 0.

    В другой части представлены фотографии трех близнецов с номерами, без подписей — например:


    В уме написано, что представлено фото леопарда, берьера, барана и вовки.Писать нужно в виде картинки; Якшо все написано без прощения, присуждать 1 балл. Якшо ни — 0 баллов

    В третьей части Необходимо снабдиться питанием: те и другие существа притаились возле природного центра на материке А, а те — на материке Б (или в природных зонах А и В). Якшо пощады нет, можно 3 бали обрезать. За явность одного помилования — 2 балла, двух — 1 балл, а трех и более — 0.

    Завданная 4

    У четвертого менеджера необходимо выполнить вердикт: дать правильное окончание в ухо фразы. Фразы завязаны на здоровом образе жизни и на здоровый лад: занят спортом, следит за опорожнением рта, слишком мало нужно догонять погоду. Даны две фразы и даны три фразы;

    Представление для ввода перед таблицей в форме:

    Как только помилований не будет совсем, сниму 1 балл, возьму 0.

    Завданная 5

    Це завдання до фальцовки. По уму в теликах есть приклад органов — например, как чуть ниже:

    Узнаю потребность в аналоге, само собой, указанном в исходной части тела этого органа — например, шлюнок, кисть и хомили. Якщо це зроблено правильно, поставил 2 бали. Если правильно сказано, если две части тела потеряны, или если одна часть тела потеряна, то этот орган — 1 балл.В інших выпадках четырехкласник лишит 0 очков.

    Завданная 6

    Шоста завдання ВПР с навколишного света хранится в трех частях. Усого можно обрезать за 4 бала. Вновь дано описание эксперимента, как его проводить или с осторожностью — например,

    Артем после просмотра ростков гороха. Скоба зьясувати, настоявшего озарение на скорости прорастания, возьми две фляги, возьми две фляги из кожицы, а из них посыпь того же горошка и залей водой, чтобы мы росли у воды. Оскорбляя фляги, Артем поставил на стеклянный фронт лампу дневного света или даже на одну из них, заслонив лампу картонной коробкой с вирусными отверстиями. Потом за парами зашагал Артем и показался в обеих флягах.

    Рядом с первой частью Необходимо учитывать требования к питанию, однако температура и освещенность двух колб одинаковы. Вы также можете кормить о материале колб. Если не хотите мстить помилованием, вас не оценят в 1 балл, если хотите отомстить одному — 0 баллов.

    В другой части попросить один прием пищи, связанный с посохом — например, как надо выполнить требование, что немаловажно, так как озарение впрыскивается в рост дня, ибо, как бы Дело не в дне, а, пожалуй, в процессе прогрева Вірна ідповід на всей части набора также может принести школе 1 балл.

    В третьей части чотирикласник виновен в описании иншего эксперимента — например, как Артем хотив би зясувати, как проявление ранта, вылитого в рост насыння. Нужно уметь меняться, как лишать вас самых разных проблем. По цене можно урезать 2 бали — за такой вид, как за отображение всех аспектов эксперимента. Если задействован аспект, ставьте 1 балл. В інших выпадках ученый не откажется от очков ценой завдання.

    Завданная 7

    Процесс изменения интеллекта ребенка отображается на умных знаках, а также знания о тех, которые можно развить. Есть три знака, например:


    Перша частьна В состав завода входит блок питания, есть возможность создавать знаки, или, если имеется в виду, есть общие знаки (иначе все три знака будут из одной серии, например, дорожные знаки ).За правильное изложение поставьте 1 балл.

    Дружеская часть Завдання вимагає написание трех правил — для скина знака надо писать, как правило відображає. Если правильно написано три правила — ставится 2 балла, если правильно составлено если два — 1 балл, если меньше одного — 0 баллов.

    Завданная 8

    Для восьмого сотрудника будут провозглашены три фотографии материалов, как победить робота, или фото людей на час робота — например:


    • сделать профессию, с которой связано фото
    • напиши чем занимаются люди профессии
    • говорят, яку грабят людей, чтобы довести такую ​​профессию до отстранения

    Пока все правильно и правильно можно подстричь 3 бали (одна для кожи правильная).

    Завданная 9

    Це развития ВПР с помощью 4 класса отменяется, так как ученик учится узнавать свои связи с людьми, которые чувствуют себя как на своей земле. На новом трудно ориентироваться, пока не зададут один-два приема пищи или просто не зададут два приема пищи: обсяг видповиди может стать близким 5 слов. Завдання от солидарности может быть такой:

    По 9-й траве во всех местах России проходят курс трассы.Бессмертный полк». Кому поручить переезд? Что так важно для жителей России? Как вы думаете, кого вы знаете, кто просто хорошие друзья? Чем важны мамы хороших друзей?

    Якшо дано дорого, хороший блок питания, можно полоскать 2 бала. Просто как бы ничего страшного, потому что просто пишет мир по теме, или не напрямую по блоку питания — 1 балл. Поставьте 0 баллов в первых.

    Завданная 10

    На десятом управленце, пересматриваются знания четвероклассников о том районе, вони тянутся.Есть три части для хранения; Всего за выступление можно набрать максимум 6 баллов.

    Перша часть Передбачає письменное название субъекта Российской Федерации (место, район, край республики), де жи уч.

    В другой части необходимо писать головня на месте региона, иначе, так как студент проживает на месте федерального значения- Район, проживает де вин.

    При правильном названии суб’єкта, если оно написано правильно, ему присуждается 2 балла, а если одно — 1 очко.

    У третьей части попросите еды, связанной с места проживания — например:

    Какие товары из вашего региона? Каковы воспоминания о природе и воспоминания об истории этой культуры в вашем регионе? Свидетельства об одном из цихских мемориалов. Abo: Какой самый последний в вашем регионе? Как ты можешь развиваться в природе своего края (назови не менее трех животных)? Опишите одно из этих животных. Чим личинки цеи звирь?

    Также можно поставить электроэнергию, которая изображена на гербе области, кого я не знаю на старости лет, поэтому важно соблюдать этот аспект.

    За первый прием пищи на первые два приема пищи ставится два бали (так за один прием пищи идет максимум один балл). Правильно на третий прием пищи можно принести 2 бали: например, описание из звуков одно и написано, что написано, что стоит 2 бали, но это всего один балл — 1 балл. Таким образом, за третью часть из 10 баллов можно отказаться всего от 6 баллов.

    HIF-1α и HIF-2α по-разному регулируют развитие опухоли и воспаление светлоклеточной почечно-клеточной карциномы у мышей

    Мыши

    Ранее описан Ksp1.3-CreER T2 ; Вхл фл/фл ;Trp53 фл/фл ; Rb1 fl/fl мыши 16 были скрещены с ранее описанным Ksp1.3-CreER T2 ;Vhl fl/fl
    94
    94 ; Trp53 фл/фл ; Hif1a фл/фл и Ksp1.3-CreER T2 ;Vhl фл/фл ; Trp53 фл/фл ; Hif2a fl/fl мыши 29 для получения экспериментального Ksp1. 3-CreER T2 ; Вхл фл/фл ;Trp53 фл/фл ; Rb1 фл/фл , Ксп1.3-CreER T2 ; Вхл фл/фл ;Trp53 фл/фл ; Rb1 фл/фл Hif1a фл/фл и Ksp1.3-CreER T2 ; Вхл фл/фл ;Trp53 фл/фл ; Rb1 fl/fl Hif2a fl/fl мышиные линии.Однопометные мыши, у которых отсутствовал трансген Cre, служили контролем дикого типа. Делеция гена у 6-недельных мышей была достигнута путем кормления пищей, содержащей тамоксифен (400 частей на миллион) в течение 2 недель. Скрещивание мышей и фенотипирование проводились по лицензии Центра обслуживания лабораторных животных Цюрихского университета, а исследования по мониторингу опухолей проводились по лицензии Z216/16 кантона Цюрих. Исследователи не были слепы к генотипу мышей.

    МикроКТ-визуализация

    Мониторинг роста опухоли у мышей проводили ежемесячно с помощью микроКТ, как описано ранее 16 .Размер опухоли оценивали путем измерения максимального диаметра во всех трех измерениях в соответствующих плоскостях ( x , y, и z — плоскость). Затем объемы были рассчитаны с использованием математической формулы эллипсоида:

    $$V\,=\,{\frac{4}{3}\,\times\,\pi\,\times\,{\rm{ радиус}}\влево( x \вправо)\,\times\,{\rm{радиус}}\влево( y \вправо)\,\times\,{\rm{радиус}}\влево( z \right) }.$$

    (1)

    Получение MEF и клеточной линии ccRCC мыши

    Выделение линий MEF 29 и получение первичных клеток почечного эпителия 15 были описаны ранее.MEF были инфицированы аденовирусом, экспрессирующим рекомбиназу Cre и GFP (Ad-Cre-GFP; Vector Biolabs; #1700) или только GFP (Ad-CMV-GFP; Vector Biolabs; #1060). Клеточная линия ccRCC мыши 2020 была выделена из кусочка опухолевой ткани мыши Vhl ∆/∆ Trp53 ∆/∆ Rb1 ∆/∆ , измельченной лезвием скальпеля и подвергнутой гидролизу в течение 70 мин при 37°С. с раствором коллагеназы II 1 мг/мл в 1× HBSS. Расщепление инактивировали 20 мл среды К-1 (модифицированная Дульбекко среда Игла) и Hams F12, смешанной 1:1, 2 мМ глутамина, 10 кЕд/мл пенициллина, 10 мкг/мл стрептомицина, смеси гормонов (5 мкг/мл инсулина, 1.25 нг/мл простагландина E 1 (PGE 1 ), 34 мкг/мл трийодтиронина (T3), 5 мкг/мл трансферрина, 1,73 нг/мл селенита натрия, 18 нг/мл гидрокортизона и 25 нг/мл. эпидермальный фактор роста) + 10% FCS. Затем клеточный раствор фильтровали через клеточный фильтр с размером ячеек 70 мкм, осаждали и высевали в среду К-1 + 10% FCS во влажном инкубаторе с 5% (об./об.) CO 2 и 20% O 2 при 37 °С. Среду меняли через 48 часов после посева. Клетки разделяли 1:5 при субконфлюэнтности.

    Ретровирусные и лентивирусные инфекции

    Ретровирусные и лентивирусные инфекции и селекцию клеток проводили, как описано ранее 84 . Клетки инфицировали ретровирусами pBabe-PURO (Vector) или pBabe-PURO-VHL30 (VHL30) или лентивирусами LKO.1, экспрессирующими несайленсерную контрольную кшРНК (кшРНК-нс), или кшРНК против Hif1a (TRCN0000232220, TRCN0000232222, или TRCN0000232223), соответственно называемые кшРНК- Hif1a #220, кшРНК- Hif1a #222 и кшРНК- Hif1a #223.

    Анализы пролиферации клеток MEF и ccRCC

    Анализы пролиферации клеток MEF 3T3 15 были описаны ранее. Всего 3000 клеток ccRCC 2020 мыши на лунку высевали в 96-луночные планшеты в шести повторах и инкубировали в течение 6 дней. Клетки культивировали в среде К-1 + 10% FCS, среду меняли через 3 дня инкубации. Пролиферацию клеток измеряли с помощью колориметрического анализа сульфородамина B (SRB) 15 . Через указанные моменты времени клетки фиксировали 10% (масса/объем) трихлоруксусной кислоты и окрашивали 0. 057% (мас./об.) раствора SRB. В целом, для солюбилизации SRB использовали 10 мМ раствор трис-основы (рН 10,5) с последующим измерением оптической плотности при 510 нм в считывающем устройстве для микропланшетов (Tecan Spark 10 M считывающее устройство для планшетов). Для анализа образования сфер клеточные суспензии фильтровали через 40-мкм клеточный фильтр и 1000 клеток высевали в шестилуночные планшеты с низким прикреплением (Corning). Клетки культивировали в среде К-1 + 10% FCS. Каждые 3 дня в лунки добавляли свежую среду. Через 14 сут микроскопические снимки образовавшихся сфер снимали камерой ДКМ 23У274, подключенной к микроскопу Eclipse Ц2Р-ФЛ (Nikon) при увеличении х20.Изображения были получены с помощью программного обеспечения IC Capture 2.4 и проанализированы с использованием программного обеспечения ImageJ.

    Анализ аллотрансплантата

    Суспензии одиночных клеток готовили с помощью Accutase (Gibco) и 5 × 10 6 клеток ресуспендировали в 75 мкл RPMI после переноса в предварительно охлажденный инсулиновый шприц 30G, смешанный с 75 мкл Matrigel (Corning). Шприцы с клеточной суспензией хранили на льду во избежание затвердевания матригеля. Мышей SCID-Beige (Charles River Laboratories) анестезировали путем ингаляции 3% изофлурана с использованием кислорода в качестве газа-носителя.Мышей брили и вводили клетки подкожно в бок. Объемы опухолей измеряли еженедельно штангенциркулем. Эксперименты проводились по лицензии G-17/165 Regierungspräsidium Freiburg.

    Анализ пролиферации Т-клеток в кондиционированной среде

    Всего 10 000 клеток ccRCC 2020 мыши, RPTEC человека (от доктора Jiing-Kuan Yee), клеток 786-O (ATCC) или A498 (ATCC) ccRCC высевали в трех повторностях в шестилуночный планшет с 2 мл RPMI + 10% FCS и инкубировали во влажном инкубаторе с 5% (об./об.) CO 2 и 20% O 2 при 37°C в течение 2 дней.Два дня спустя селезенки мышей C57BL/6 извлекали, промывали в PBS и протирали через сито для клеток 100 мкм в буфере MACS (PBS 1x++2% FCS++2 мМ ЭДТА). Пюре из селезенки снова фильтровали через сито с ячейками 100 мкм в коническую пробирку объемом 50 мл и центрифугировали в течение 10 минут при 290× g . Осадок метили вручную с помощью магнитных CD8a (Ly-2) MicroBeads (Miltenyi Biotech). Изолированные CD8a + Т-клетки центрифугировали, ресуспендировали в среде для пролиферации (RPMI + 10% FCS с добавлением 25 мкМ β-меркаптоэтанола) и подсчитывали.Затем Т-клетки CD8a + окрашивали красителем CellTrace Violet Proliferation Dye (Thermo Fisher). Окрашенные CD8a + Т-клетки стимулировали CD3/CD28 Dynabeads (Thermo Fisher) и активировали интерлейкином-2 (IL-2). Кондиционированную среду распределяли по свежим шестилуночным планшетам и добавляли 2 × 10 5 окрашенных, стимулированных и активированных CD8a + Т-клеток. Смесь кондиционированной среды и Т-клеток инкубировали в течение 3 дней во влажном инкубаторе с 5% (об./об.) СО 2 и 20% О 2 при 37 °С.По истечении времени инкубации Т-клетки ресуспендировали и центрифугировали в 2-мл реакционной пробирке в течение 5 минут при 1600 об/мин и 4°С. Мертвые клетки в осадке окрашивали набором Live/Dead Fixable Aqua Dead Cell Stain Kit (Thermo Fisher), промывали 200 мкл буфера MACS и центрифугировали в течение 5 мин при 515 х г и 4°С, 25 мкл CD16/ Антитело 32 (Fisher Scientific, 14016185, разбавленное 1:25 в буфере MACS) добавляли к осадку для блокирования Fc-опосредованных реакций. После 10 мин инкубации при 4 °C в темноте к суспензии добавляли 25 мкл антитела к CD8a (APC-конъюгированные, Biolegend, 100712, разбавленные 1:100 в буфере MACS) и инкубировали в течение 30 мин при 4 °C в темнота.После этого Т-клетки дважды промывали буфером MACS и осадок ресуспендировали в 100 мкл буфера MACS. С помощью проточной цитометрии (BD LSRFortessa) мертвые/живые клетки измеряли с помощью экстинкционного лазера с длиной волны 405 нм (AmCyan), Т-клетки измеряли с помощью экстинкционного лазера с длиной волны 640 нм (APC), а краситель для пролиферации измеряли с помощью экстинкционного лазера с длиной волны 405 нм (Pacific Синий). Данные были обработаны и проанализированы с помощью программного обеспечения FlowJo.

    Иммуногистохимия

    Иммуногистохимическое окрашивание проводили, как описано ранее 10 .Первичные антитела против следующих белков или эпитопов использовали при следующих разведениях и условиях извлечения антигена: В220 (1:3000, BD Biosciences, 553084, Трис/ЭДТА 20 мин, 100°С), СА9 (1:2000, Invitrogen, PA1). -16592, цитрат, 10 мин, 110 °C), CD3 (1:250, Zytomed, RBK024, цитрат 30 мин, 95 °C), CD4 (1:1000, eBioscience, 14-9766, цитрат, 30 мин, 100 °C), CD8a (1:200, Invitrogen, 14-0808-82, цитратный буфер, 15 мин, 114 °C), CD10 (1:2000, Thermo Fisher Scientific, PA5-47075, цитратный буфер, 10 мин, 110 °С), CD68 (1:100, abcam ab125212, цитратный буфер, 30 мин, 95 °С), CD69 (1:1000, Bioss, bs-2499R, Трис/ЭДТА, 15 мин, 114 °С), F4/ 80 (1:250, Linaris Biologische Produkte, T-2006, BOND Enzyme Pretreatment Kit (Leica AR9551), 10 мин, 37 °C), HIF-1α (1:20000, Novus Biotechnologies, NB-100-105, цитратный буфер) , 10 мин, 110 °C, набор для каталитического усиления сигнала (DakoCytomation)), HIF-2α (1:1000, abcam ab109616, Трис/ЭДТА 15 мин, 114 °C), Ly-6G (1:800, BD, 551459 ), MHC II (1:500, Novus Biotechnologies, NBP1-43312, BOND Enzyme Pretreatment Kit (Leica AR9551), 10 мин, 37 °C), PD-1 (1:100, системы R&D, AF1021, Трис/ЭДТА 20 мин, 100 °C), перфорин ( 1:100, Биорбит, orb312827, Трис/ЭДТА, 15 мин, 114 °C), фосфо-Thr37/Thr46-4E-BP1 (1:800, Cell Signaling Technologies, 2855, цитратный буфер, 10 мин, 110 °C) . Следующие антитела против HIF-2α не давали специфических ядерных сигналов при иммуногистохимическом окрашивании с использованием методов поиска антигена цитратом или трис/ЭДТА: abcam ab199, Aviva Systems Biology ARP32253, Biorbyt orb96817, Sigma MAB3472, GeneTex GTX30114. Для анализа маркеров иммунных клеток срезы сканировали с использованием системы Nanozoomer Scansystem (Hamamatsu Photonics). Автоматические количественные оценки положительных клеток B220, CD3, CD4, CD8a и CD68 проводили из дублирующих красителей (определяли средние значения), как описано ранее 85 , с использованием пакета программного обеспечения VIS (Visiopharm, Hoersholm, Дания).Каждая опухоль была очерчена вручную. Плотность иммунных клеток рассчитывали как количество клеток на мм 2 на основе площади поверхности и количественного определения иммунных клеток. Количественную оценку клеток, окрашенных F4/80, проводили с использованием подсчета положительных пикселей и представляли в виде процента положительных пикселей. Окрашивание PD-1, перфорина, Ly-6G и CD69 определяли количественно путем ручной аннотации положительно окрашенных клеток.

    ПЦР в реальном времени мРНК и геномной ДНК и рекомбинационно-специфическая ПЦР геномной ДНК

    РНК выделяли из порошкообразных замороженных образцов с использованием набора NucleoSpin RNA (Machery Nagel), кДНК получали с использованием случайных гексамерных праймеров и Ready-To-Go You — Бусины Prime First-Strand (GE Healthcare).ПЦР в реальном времени проводили с использованием смеси LightCycler 480 SYBR Green Master (Roche) с использованием LightCycler 480 (Roche). Были использованы следующие наборы пар праймеров (последовательности, предусмотренные как 5′-3 ‘):

    18s (FWD GTTCCCCCATAACGATGCCCCAT)

    HIF1A (FWD GGTTCCAGCAGACCCAGTTA, REV AGGCTCCTGATGATGACTTTT)

    HIF2A (FWD GAGGAAGGAGAAATCCCGTGA, rev CTGATGGCCAGGCGCATGATG)

    Vhl (fwd CAGCTACCGAGGTCATCTTTG, rev CTGTCCATCGACATTGAGGGA)

    Геномную ДНК выделяли из порошкообразных замороженных образцов с использованием набора GeneElute Mammalian Genomic DNA Miniprep (Sigma). В целом, 60 нг геномной ДНК на реакцию подвергали ПЦР в реальном времени с использованием смеси LightCycler 480 SYBR Green Master (Roche) с использованием LightCycler 480 (Roche) и температуре отжига 55 °C. Следующие наборы пар праймеров (последовательности представлены как 5′-3′) использовали для амплификации следующих флоксированных и нефлоксированных экзонов:

    Vhl Экзон 1 (флоксированный) (fwd ATAATGCCCCGGAAGGCAG, ред. TGAGCCACAAAGGCAGCAC)

    Vhl экзон 3 (не floxed) (вперед ACCCTGAAAGAGCGGTGCCTTC, об CGCTGTATGTCCTTCCGCACAC)

    Hif1a экзон 2 (floxed) (Fwd CGGCGAAGCAAAGAGTCTGAAG, об CGGCATCCAGAAGTTTTCTCACAC)

    Hif2 экзон 2 (floxed) (вперед GCTGAGGAAGGAGAAATCCCG, об CTTATGTGTCCGAAGGAAGCTG)

    Hif2a экзон 1 (не floxed) (Fwd TGGCGTCTTACAACCTCCTCCC, TCCGAGAGTCCCGCTCAATCAG)

    Trp53 экзон 4 (floxed) (Fwd TGAAGCCCTCCGAGTGTCAG, об AGCCCAGGTGGAAGCCATAG)

    Trp53 экзон 11 (не floxed) (ВПЕРЕД AGAAGGGCCAGTCTACTTCCCG, об AAAAGGCAGCAGAAGGGACCG)

    Rb1 Экзон 19 (флоксованный) (передний AATACAGACACACAAGCAGCC, ред. GAGCCACAACTTAACCTAGTCC)

    Следующие наборы праймеров использовали для ПЦР-амплификации продуктов ДНК, специфичных к Cre-рекомбинированным аллелям генов Hif1a 86 и Hif2a 87 .

    Hif1a (Fwd II GCAGTTAAGAGCACTAGTTG, Ред GGAGCTATCTCTCTAGACC,)

    Hif2a (Р1 CAGGCAGTATGCCTGGCTAATTCCAGTT, Р3 GCTAACACTGTACTGTCTGAAAGAGTAGC)

    девяносто одна тысяча восемьдесят-один Вестерн-блоттинга

    Антитела против следующих белков были использованы для вестерн-блоттинга: β-актина (1: 5000 , Sigma-Aldrich, A2228), HIF-1α (1:500, Novus Biologicals, NB-100-479), LAMIN-A/C (1:500, Santa Cruz, sc-376248), LDH-A (1: 500, Santa Cruz Biotechnology, sc-27230), PDK1 (1:1000, Assay Designs, KAP-PK112-0), VHL (1:1000, Cell Signaling Technologies, #68547), ВИНКУЛИН (1:5000, Abcam, ab130007) ).

    РНК-секвенирование

    РНК была изолирована из порошковых замороженных образцов WT Cortex Cortex Управление из CRE отрицательные мыши в VHL FL / FL TRP53 FL / FL RB1 fl/fl фон и из опухолей различного генетического фона с использованием набора РНК NucleoSpin (Machery Nagel). Секвенирование РНК с парными концами выполняли на устройстве Illumina HISEQ4000 в основном центре Немецкого центра исследования рака (DKFZ) в Гейдельберге с помощью набора для подготовки библиотеки Illumina TruSeq Stranded RNA.Ранее опубликованные данные секвенирования коры WT и опухолей мышиной модели Vhl ∆/∆ Trp53 ∆/∆ Rb1 ∆/∆ также были включены для последующего анализа 16 . Fastq-файлы необработанных данных были предварительно обработаны с помощью trimmomatic 88 для обеспечения достаточного качества считывания путем удаления адаптеров и оснований в областях сегмента низкого качества (конец считываний) с базовым качеством ниже 20. Перед обрезкой среднее количество число прочтений составило 48309915 ± 12246964 [26804116,70620322], после обрезки среднее число прочтений составило 45451780 ± 13975818 [20629675,70032834].Следовательно, в среднем 93,2%   ±   10,5% необработанных прочтений пережили этап обрезки (дополнительная рис. 6a). Общее качество баз и ридов было хорошим. После контроля качества и обрезки чтения были выровнены за 2 прохода с использованием выравнивателя STAR 89 и эталонного генома GRCm38 от Ensembl. В общей сложности 85,1%   ±   3,3% прочтений были однозначно сопоставлены и учтены (дополнительная рис. 6b). За стадией выравнивания следовала нормализация и дифференциальный анализ экспрессии с помощью пакета R/Bioconductor 90 DESeq2 91 .Нормализация числа необработанных прочтений была выполнена с помощью DESeq2 с учетом размера библиотеки. Кроме того, из набора данных были удалены все гены с низким числом во всех выборках, т. е. сумма строк гена была ниже 5 в гене по выборочной матрице. После предварительной обработки и фильтрации 19 723 гена были дополнительно проанализированы и сопоставлены с отрицательной биномиальной обобщенной линейной моделью с последующей статистикой Вальда для выявления дифференциально экспрессируемых генов. Гены считались значимыми при скорректированном значении p  < 0. 001 (Бенджамини-Хохберг). Необработанные данные секвенирования РНК были загружены в GEO с идентификатором GSE150983 [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE150983].

    Анализ обогащения набора генов

    Обогащение сигнальных путей выполнено в пакете R/Bioconductor GAGE ​​ 92 сигнальными путями из Gene Ontology 93,94 , ConsensusPathDB 95 и MSigDB 913 Идентификаторы генов человека из путей MSigDB были картированы на гомологах мыши с помощью пакета R/Bioconductor GeneAnswers (версия пакета R 2.28.0). Пути считались значимыми при скорректированном значении p  < 0,05 (Бенджамини-Хохберг).

    Анализ иммунной деконволюции ssGSEA

    Необработанные прочитанные последовательности RNA-seq были сопоставлены со сборкой генома мыши mm10 с помощью двухэтапного выравнивания STAR 89 . Затем на основе результатов выравнивания с помощью RSeQC рассчитывали показатели контроля качества, например общую статистику секвенирования, характеристики генов и охват тела. Значения количества генов RNA-seq рассчитывали с использованием пакета R GenomicAlignments 97 по выровненным считываниям с UCSC KnownGene 98 в мм10 в качестве базовой модели гена.Использовался режим подсчета Union, и учитывались только сопоставленные парные чтения после фильтрации качества выравнивания. Генный уровень FPKM (фрагментов на килобазовый миллион) и необработанные значения количества прочтений были рассчитаны пакетом R DESeq2 91 . Одиночный образец GSEA 99 был использован для анализа иммунной деконволюции на основе значений экспрессии FPKM для оценки количества типов иммунных клеток 44 , экспрессии антиген-презентирующего аппарата MHC класса I, оценки Т-клеточной инфильтрации, оценки иммунной инфильтрации 43 , и иммуноцитолитическая оценка 100 , а также сигнатуры eTME 42 , которые были разработаны на основе данных секвенирования РНК ксенотрансплантата, полученных от пациентов с ПКР. В дополнение к подходу деконволюции на основе генной сигнатуры, CIBERSORT 48 , который представляет собой метод, основанный на регрессии, с использованием алгоритма машины опорных векторов, также применялся с использованием либо панели генов человека, либо специальной эталонной панели мыши, ImmuCC 45 .

    Массовая спектрометрия на основе протеома Profify

    сечения ткани Wt почек Cortex управление от CRE отрицательные мыши в VHL FL / FL TRP53 FL / FL RB1 fl background и из опухолей различного генетического фона гомогенизировали ультразвуком (Diagenode, 4102 Seraing, Бельгия) в 100 мМ HEPES, pH 8.0,4% (вес/объем) SDS, 10 мМ ДТТ с последующей инкубацией при нагревании (95 °С, 10 мин), центрифугированием (16 000 × г , 10 мин), алкилированием цистеина и заменой буфера на 100 мМ HEPES. , pH 8,0 с последующей трипсинизацией 100 мкг протеома на основе протокола подготовки проб с фильтрацией 101 . В целом, 24 образца (шесть мышей из четырех генотипов) были распределены по трем наборам и по-разному помечены аминореактивными метками тандемной массы (TMT11plex, Thermo/Pierce, Rockford, llL, USA), включая объединенный образец для нормализации.Краткую информацию о схеме маркировки можно найти в Интернете как часть заявки ProteomeXchange (подробности см. ниже). Каждую партию фракционировали с помощью обращенно-фазовой хроматографии с высоким pH (колонка XBridge C18, 3,5 мкм, 150 мм × 4,5 мм (Уотерс, Массачусетс, США)). Оба элюента A (вода) и B (70% ацетонитрила) содержали 10 мМ формиата аммония, рН которого доводили до 10 с помощью гидроксида аммония. Скорость потока составляла 0,3 мл/мин. После промывки 16% B образцы элюировали линейным градиентом от 16 до 55% B в течение 40 мин. Элюирование пептида контролировали по поглощению в УФ/видимой области спектра при 214 нм.Всего было собрано 16 фракций, которые были объединены в восемь окончательных фракций (схема пула: 1 + 9, 2 + 10, 3 + 11, 4 + 12, 5 + 13, 6 + 14, 7 + 15 и 8 + 16). Для анализа методом жидкостной хроматографии-тандем-масс-спектрометрии (ЖХ-МС/МС) фракции разделяли на системе EASY nano-LC 1000 (Thermo Fisher Scientific, Waltham, MA, USA) и на колонке EASY-Spray™ C18 ( 250 мм × 75 мкм, частицы размером 2 мкм, нагретые до 50 °C, Thermo Fisher Scientific, Уолтем, Массачусетс, США). Оба элюента A (вода) и B (ацетонитрил) содержали 0.1% муравьиной кислоты. Программа градиента состояла из следующих шагов: линейное увеличение B на 2–25% в течение 60 мин и на 25–60% B в течение 30 мин, обеспечивая окно разделения 90 мин при скорости потока 300 нл/мин. Пептиды анализировали с использованием масс-спектрометра Oribtrap Q-Exactive Plus (Thermo Fisher Scientific, Уолтем, Массачусетс, США), работающего в режиме сбора данных, зависящем от данных. Обзорные сканы были выполнены с разрешением 70 000, целевым значением AGC 3e6 и максимальным временем впрыска 50 мс с последующим нацеливанием на десять первых ионов-предшественников для сканирования фрагментации с разрешением 35 000 с 1. Окна изоляции 2 m/z, NCE 32 и время динамического исключения 40 с. Для всех сканирований MS2 порог интенсивности был установлен на 1000, AGC на 1e5, максимальное время введения 100  мс и фиксированная первая масса на 100 m/z. Данные анализировали с помощью MaxQuant v 1.6.013 со следующими настройками: триптическая специфичность, до двух пропущенных расщеплений, ТМТ-модификация N-концевых и лизиновых боковых цепей пептида; карбамидометилирование цистеина, проверенные последовательности на мышах (загружены с Uniprot 26 августа 2019 г.), 1% FDR для пептидов и белков, доля интенсивности предшественника   =  0.5, один или несколько уникальных пептидов для количественного определения белков. Выходные данные MaxQuant были дополнительно обработаны MSStatsTMT 102 для нормализации, удаления партий и сборки белков. Дифференциальное содержание белка оценивали с использованием линейных моделей анализа микрочипов. Данные доступны через PRIDE/ProteomeXchange с идентификатором PXD016630 103 .

    Author: alexxlab

    Добавить комментарий

    Ваш адрес email не будет опубликован.