Гликоген у грибов это: Гликоген в грибах — Справочник химика 21

Содержание

Гликоген в грибах - Справочник химика 21

    Все жизненные процессы сопровождаются гликолизом — биологическим расщеплением гликогена, приводящим к образованию молочной кислоты для животных организмов гликоген является одним из важнейших источников энергии. Он содержится во всех клетках животного организма. Наиболее богаты гликогеном печень (у упитанных животных до 10—20% гликогена) и мышцы (до 4%)- Он содержится также в некоторых низших растениях, например в дрожжах и грибах крахмал некоторых высших растений по свойствам близок к гликогену. [c.711]
    Гликоген содержится во всех животных тканях. Особенно его много в печени (до 20 о), в мышцах (до 4%). Ои содержится также в некоторых низших растениях, дрожжах и грибах. [c.256]

    Гликоген очень распространен в животных организмах. Наиболее богаты им печень (до 20%), в мышцах —до 4% от сырого веса. Много гликогена содержат дрожжи, высшие грибы и, в особенности, некоторые моллюски. Гликоген является резервным углеводом организма, играющим важнейшую роль в энергетическом его балансе. [c.362]

    УГЛЕВОДЫ. При наличии углеводов большинство клеток использует в качестве субстратов именно их. Полисахариды (крахмал у растений и гликоген у животных и грибов) вовлекаются в процесс дыхания лишь после того, как они будут гидролизованы до моносахаридов. [c.344]

    Питание. Практически все клетки независимо от их источника па 80% состоят из воды и на 20% из сухой массы. В сухой массе клетки — приблизительно 50—60% белка и 15—25% РНК (около 15% в растительных, животных клетках и у микроорганизмов, около 25% У бактерий). Содержание ДНК значительно варьирует. У бактерий относительное содержание ДНК наиболее велико — около 4% сухой массы. Почти во в сех растительных и животных клетках ДНК составляет приблизительно 1 % сухого веса, но в некоторых клетках, особенно у грибов, только 0,1%. Содержание полисахаридов (крахмал, гликоген, целлюлоза и т. д.) обычно составляет около 10%, а липидов — несколько процентов (за исклю- [c.71]

    Отдел объединяет бесхлорофилльные организмы, которые по своему строению и образу жизни занимают промежуточное положение между животными и грибами. Одни из них имеют микроскопически малые размеры и представлены одно- или многоядерной амебоидной клеткой, другие крупные, многоядерные, обычно подвижные (0,1—0,4 мм/мин), бесцветные или окрашенные, подчас достигающие более 30 см. В состав плазмодия входят белки, гликоген, жиры, пигменты и другие вещества. 

[c.144]

    Гликоген (животный крахмал). Содержится в печени (2—10%, в среднем 57о), скелетных и гладких мьпицах, головном молге. Значительные количества гликсзгена найдены у грибов- аскомицетов, фикомицетов, базидиоми-цетов. Гликоген в горячей воде образует коллоидные растворы, которые с иодом дают красно-бурое или Краснова то фиолетовое окрашивание. [c.216]

    Родственным растительному крахмалу веществом является живот ный крахмал — гликоген, который содержится в различных тканя и органах животных. Гликогена также много и в некоторых растениях в зерне сахарной кукурузы, дрожжах и грибах. В настоящее врем разработаны методы определения количества крахмала. Их можш разделить на пять групп методы, основанные на прямом определени  [c.162]

    Гликоген, называемый также животным крахмалом и содержащейся в печени, мускульной ткани и в особенно больших количествах в моллюсках, является двойником крахмала в животном Ш1ре и играет роль депо питательных веществ и запасного углевода животных тканей. В незначительных количествах гликоген содержится также в грибах и дрожжах. Гликогеноподобные полисахариды встречаются также в зёрнах злаков и в бактериях. Молекулярная масса гликогена составляет от 400 тыс. до 4 млн (по другим источникам от 270 тыс. до 100 млн) даже в одном препарате гликогена наблюдается широкий разброс по размерам молекул. Так, гликоген растворяется в горячей воде, образуя коллоидный раствор, дающий с иодом жёлто-красную окраску однако гликоген, извлекаемый из животных клеток, имеет частицы гораздо меньшего размера, а его легко образующаяся дисперсия в воде окрашивается иодом в красно-фиолетовый цвет (подобно амилопектину). При кислотном гидролизе гликоген превращается в В-глюкозу, так как является полисахаридом, образованным за счёт а-(1,3)-, а-(1,4)- и а-(1,6)-глюкозидных связей, причем 1,6-связи возникают и в ветвях гликогена. Из-за большей степени разветвлён-НОСТИ молекулы гликогена имеют более плотную, более компактную форму, чем молекулы амилопектина. Как и а шло-пектин, гликоген гидролизуется а-амилазами до мальтозы и изомальтозы 1,6-связи гликогена расщепляются бактериальным ферментом пуллуланазой. 

[c.101]


    Flavoba terium —Бактерии, часто встречающиеся в реакторах с активным илом, биофильтрах, а также в метантенках ГАО — Гликоген-аккумулирующие организмы, не накапливают фосфат Geotri hum — Род грибов, обитающих в реакторах с активным илом и биофильтрах [c.88]

    Клетки многих грибов содержат различные включения. Основным запасным веществом является гликоген, который обычно в виде мелких гранул равномерно распределяется в цитоплазме грибной клетки. В вакуолях накапливаются полифосфаты (метахроматин, волютин). В клетках грибов можно обнаружить липиды в виде капелек, которые называют липосомами (микросомами, сферосомами). [c.72]

    Биол. ф-ции П. разнообразны. Крахмал, гликоген, ламн-наран, инулин, нек-рые растит, слизи — энергетич. резерв клеток растений и животных. Целлюлоза и гемицеллюлозы в растениях, хитин в беспозвоночных и грибах, мукополисахариды соединит, тканей животных — опорные П. Капсульные П. микроорганизмов, гиалуроновая кислота и гепарин в животных тканях выполняют защитную ф-цию. Липополисахариды бактерий и гликопротеиды пов-сти животных клеток обеспечивают специфичность межклеточного взаимод. и иммунологич. р-ций организма. 

[c.466]

    Гликоген — резервный полисахарид, находящийся в различных органах и тканях многих животных. Подобный гликогену лолисахарид, обладающий всеми свойствами гликогена, обнаружен также у грибов, дрожжей и водорослей. У высших животных особенно много гликогена в печени. Гликоген по многим свойствам напоминает крахмал, но отличается от него растворимостью в воде и тем, что с йодом дает красновато-бурую окраску. По характеру этой окраски и по содержанию остатка фос- форной кислоты сходен с амилопектином. Молекулярный вес 110000—140000. -Ы96°. Гликоген очень устойчив к дей- [c.94]

    Г люкоамилаза (ос-1,4-глюкан — глюкогидролаза, К-Ф-3.2.1.3) гидролизует а-1,4-глюкановые связи в полисахаридах, последовательно отщепляя остатки глюкозы от нередуцирующих концов цепей. Как и остальные амилазы, действует на крахмал, гликоген и родственные поли- и олигосахариды с образованием преимущественно глюкозы и небольшого количества декстринов. Препараты глюкоамилазы выделяют из плесневых грибов, с помощью этих препаратов можно получать глюкозу, не прибегая к кислотному гидролизу крахмала. 

[c.96]

    Гликоген, (СвНюОб)п— животный крахмал, представитель полисахаридов, играющий роль депо питательных вэществ и запасного углевода животных тканей. Содержится в основном в печени около 10%) и мышцах (около 2%). В незначительных количествах найден в грибах, дрожжах и др. Мол. масса составляет от 400 тыс. до 4 млн. В организме находится в комплексе с белками. Гликоген в чистом виде — белый аморфный порошок, легко растворяется в горячей воде, образуя коллоидный раствор. С иодом дает желто-красную окраску. Раствор гликогена вращает плоскость поляризации вправо с углом удельного вращения - -196°. При гидролизе кислотами гликоген превращается в О-глюкозу. [c.175]

    Распространение этих соединений в растениях носит на себе тот же отпечаток закономерной связи с систематическим положением отдельных растений, как и распространение других вен еств, а именно можно легко заметить, что гликоген встречается только в грибах среди цветковых растений есть крахмалоиакопители и сахаронакопители инулин встречается преимущественно в представителях сложноцветных отдельные гемицеллю-лозы характерны для тех или иных растительных групп к совершенно определенным систематическим единицам приурочивается способность образовывать гумми и слизи. Еще больше, конечно, различий чисто количественного порядка. 

[c.172]

    Гликоген содержится также в мускульной ткани. Находят гликоген и в низших растениях, например, в грибах. Гликоген иодом окрашивается в фиолетовокоричневый цвет. Не восста-, навливает фелинговой жидкости. Как и крахмал, в результате гидролиза превращается в глюкозу. [c.406]

    Сапротрофами называются организмы, извлекающие питательные вещества из мертвого органического материала. Грибы, относящиеся к сап-ротрофам, образуют целый ряд пищеварительных ферментов. Если сапротроф способен секретировать пищеварительные ферменты трех основных классов, а именно 1) ферменты, расщепляющие углеводы, например амилазы (расщепляют крахмал, гликоген и родственные полисахариды), [c.45]

    Гликоген — это эквивалент крахмала, синтезируемый в животном организме, т. е. это тоже резервный полисахарид, построенный из остатков а-глюкозы встречается гликоген и в клетках многих грибов. У позвоночных гликоген содержится главным образом в печени и мышцах, иными словами в местах высокой метаболической активности, где он служит важным источником энергии. Обратное его превращение в глюкозу регулируется гормонами, главным образом инсулином (гл. 9). По своему строению гликоген весьма схож с амилопектином (рис. 3.13), но цепи его ветвятся еще сильнее. В клетках гликоген отлагается в виде крошечных гранул, которые обьгано бывают связаны с агра-нулярным (гладким) эндоплазматическим ретикулумом (рис. 5.12). 

[c.117]

    Гликоген (СбНю05)п называют животным крахмалом, так как он синтезируется организмом животных и человека и откладывается во всех тканях. Главные места отложения его — печень (от 2 до 10%) и мышцы (0,2—2,0% и более к весу органа). Он найден также в растениях, например кукурузе, грибах и дрожжах. [c.97]


    Полиазы. К полназам относятся а-амилаза, р-амилаза, целлюлаза, ину-линаза и некоторые другие ферменты. Из них наиболее важны амилазы, катализирующие гидролиз крахмала и гликогена (животного крахмала) а- и -амилазы отличаются друг от друга по своим свойствам, способу действия на крахмал и гликоген и по распространению. а-Амилаза содержится в слюне, в соке поджелудочной железы, в крови и в тканях животных (в печени, мозге, мышцах молодых животных), а также в проросших зернах злаков и в плесневых грибах. Ее называют декстрогенной амилазой, так как в результате ее действия получается мало мальтозы и много декстринов, из которых затем возникает мальтоза. Что же касается р-амилазы, то она катализирует расщепление крахмала с образованием, главным образом, мальтозы и небольшого количества декстринов. Как а-, так и р-амилаза катализируют гидролиз только 1,4 глюкозидных связей. В связи с этим расщепление амилопектина в результате их действия сопровождается образованием некоторого количества декстринов, имеющих в своей структуре 1,4 и 1,6 глюкозидные связи. Эти декстрины носят название пограничных декстринов. 
[c.179]

    Гликоген — (СвНи05)дг— Печеночный крахмал встречается яе только в грибах и дрожжах, но и в животных организмах, чем и отличается от других видов крахмала, являющихся исключительно продуктами растений. Обычно его получают из печени хорошо упитанного кролика. чень кипятят сконцентрированным раствором едкого кали,чем разрушается ткань печени, гликоген же остается нетронутым. Много гликогена также в устрицах. Он является аморфным, бесцветным порошком, набухающим в воде уже при обычной температуре и дающим опалвсцирующий раствор при гидролизе получается только [c.289]

    Крахмал, глюканы (гликоген, декстран) - запасные вещества растений выполняют опорную функцию или являются основой слизей и капсул, образуемых рядом микроорганизмов. Они представляют собой нера ветв-ленные цепи остатков О-глюкозы, соединенных а-гликозидными связями между углеродными атомами в положениях 1 и 4 (амилоза), либо разветвленные молекулы поли-а-1,4-В-глюкозы (амилопектин, гликоген, декстран). Гидролиз крахмала осуществляется микроорганизмами (грибами, бактериями) под действием ферментов амилаз (а-амилаза, р-амилаза, глюкоамилаза и др.). [c.405]

    Из числа углеводов, локализованных в клетках грибов, для них характерны гликоген, маннит, дисахарид трегалоза (или микоза). Количество гликогена в плодовых телах и мицелии грибов может варьировать от 1,5 до 40% в зависимости от вида гриба и возраста плодового тела. В молодых плодовых телах и культурах грибов его соответственно больше на целый порядок, чем в старых с созревшими спорами. 

[c.29]

    Из других, помимо упомянутых липидов, запасных веществ, используемых в энергетическом обмене, в цитоплазме клеток грибов часто встречается гликоген, в а-форме в виде звездчатых образований или в разветвленной р-форме (Камалетдинова, Васильев, [c.207]

    Склероции — плотные переплетения гиф мицелия — служат для перенесения неблагоприятных условий зимой, во время засухи и т. д. Они имеют различные формы (шаровидную, овальную, в виде рожков и др.), размеры (от 1 мм до 20—30 см в диаметре) и массу (до 20 кг). Клетки склероциев богаты запасными питательными веществами — гликогеном, жирами. В склероциях спорыньи, например, содержится до 30% жира. Склероции образуют многие сумчатые, базидиальные и несовершенные грибы. Формируются они либо свободно на поверхности мицелия, либо внутри пораженного органа. Из склероциев развиваются мицелий или органы спороношения. [c.136]

    В цитоплазме клеток грибов есть эндоплазматический ретикулум, рибосомы, аппарат Гольджи, митохондрии, лизосомы, вакуоли. В отличие от высших растений у них нет хлоропластов. В качестве запасных веществ выявляются гликоген в виде гранул, волютин, липиды, иногда кристаллы солей кальция. [c.133]

    Пшкоген служит резервным питательным веществом в организме человека и животных, вследствие чего за ним сохраняется название животный крахмал . Однако он найден также в грибах, дрожжах и зернах кукурузы, что ставит под сомнение его название животный . Содержание гликогена в печени животных достигает 20%, а в мышцах—4%. Распадаясь до простых продуктов довольно сложным путем, который называется гликогенолизом (см. с. 351), гликоген обеспечивает потребность организма в энергии и метаболитах. Таким образом, его биологическая роль весьма велика. [c.323]


Гликоген у растений - это... Что такое Гликоген у растений?

Гликоген у растений

встречается как в высших, так и в простейших грибах. Он имеет значение запасного питательного материала. Количество гликогена в пивных дрожжах достигает 30 процентов сухого вещества.

Энциклопедический словарь Ф.А. Брокгауза и И.А. Ефрона. — С.-Пб.: Брокгауз-Ефрон. 1890—1907.

  • Гликоген
  • Гликозин

Смотреть что такое "Гликоген у растений" в других словарях:

  • Гликоген — Гликоген, т. е. сахар образующее вещество, представляет углеводформулы С6Н10О5 встречающееся в животном теле в преимущественно в печениздоровых, упитанных животных; кроме того, Г. встречается в мышцах, белыхкровяных тельцах, в ворсинках… …   Энциклопедия Брокгауза и Ефрона

  • Гликоген — т. е. сахаробразующее вещество, представляет углевод формулы C6h20O5, встречающееся в животном теле и преимущественно в печени здоровых, упитанных животных; кроме того, Г. встречается в мышцах, белых кровяных тельцах, в ворсинках околоплодной… …   Энциклопедический словарь Ф.А. Брокгауза и И.А. Ефрона

  • Углеводы — Структурная формула лактозы  содержащегося в молоке дисахарида Углеводы (сахара, сахариды)  органические вещества, содержащие карбонильную гру …   Википедия

  • Грибы — Эта статья  о биологическом таксоне. Об обиходном понятии см. Гриб. Грибы …   Википедия

  • Полимер — (Polymer) Определение полимера, виды полимеризации, синтетические полимеры Информация об определении полимера, виды полимеризации, синтетические полимеры Содержание Содержание Определение Историческая справка Наука о Полимеризация Виды… …   Энциклопедия инвестора

  • МЕТАБОЛИЗМ — или обмен веществ, химические превращения, протекающие от момента поступления питательных веществ в живой организм до момента, когда конечные продукты этих превращений выделяются во внешнюю среду. К метаболизму относятся все реакции, в результате …   Энциклопедия Кольера

  • Метаболизм — У этого термина существуют и другие значения, см. Метаболизм (значения). Структура аденозинтрифосфата  главного посредника в энергетическом обмене веществ Метаболизм (от …   Википедия

  • УГЛЕВОДЫ — УГЛЕВОДЫ, органические соединения, состоящие из углерода, водорода и кислорода, причем два последние обычно находятся в том же отношении, как в воде. Это определение, как основанное на чисто формальном признаке, конечно недостаточно и правильнее… …   Большая медицинская энциклопедия

  • Семейство цекропиевые (Cecropiaceae) —         Эта сравнительно небольшая и очень своеобразная группа, известная ранее под названием коноцефалоидных (Conocephaloideae), была обособлена в самостоятельное семейство цекропиевых совсем недавно голландским исследователем К. К. Бергом… …   Биологическая энциклопедия

  • Медицина — I Медицина Медицина система научных знаний и практической деятельности, целями которой являются укрепление и сохранение здоровья, продление жизни людей, предупреждение и лечение болезней человека. Для выполнения этих задач М. изучает строение и… …   Медицинская энциклопедия

Введение в биологию (VIa) - caenogenesis — LiveJournal

Тема VI
УГЛЕВОДЫ (продолжение)

Все углеводы делятся на моносахариды (простые сахара), олигосахариды (цепочки, содержащие от 2 до 10 моносахаридных остатков) и полисахариды (полимеры, в которых число моносахаридных остатков может достигать многих тысяч). Один из самых известных полисахаридов - крахмал, представляющий собой длинную цепь остатков глюкозы, соединенных гликозидными связями. Это важнейшее запасное вещество у растений.


Животный аналог крахмала - гликоген, тоже важный запасной углевод. У нас он накапливается в первую очередь в печени и в случае надобности быстро расщепляется до мономеров глюкозы, которые уходят в кровь. Гликоген тоже состоит из остатков глюкозы, соединенных гликозидными связями. Серьезное отличие гликозидных связей, например, от пептидных - в том, что образованный с их помощью полимер может гораздо легче ветвиться. "По умолчанию" гликозидная связь образуется между гидроксилами 1-го и 4-го атомов углерода глюкозы (1-4-гликозидная связь), и тогде получается линейная цепочка. Но в глюкозе есть и другие гидроксилы, между которыми образование гликозидной связи тоже запросто возможно. На 1-6-гликозидной связи полимерная цепочка обычно как раз и разветвляется. В гликогене такое ветвление выражено сильнее, чем в крахмале, хотя оно есть и там и там.


Цвета на этой картинке, на самом деле, никакого значения сейчас не имеют, она просто красивая. Это - структура гликогена. Зеленым тут обозначен остаток глюкозы, с которого начинается боковая цепь, красным - концевые остатки, ну а все остальное нам сейчас уже должно быть понятно и так.
Совершенно особый интерес представляют полисахариды, участвующие в образовании клеточных стенок. Ни в коем случае нельзя путать клеточную стенку с клеточной мембраной! Клеточная стенка - это внеклеточная структура, состоящая из полимеров, расположенная снаружи от мембраны и заключающая в себе клетку целиком (не считая отверстий, обеспечивающих межклеточные контакты, если организм многоклеточный). Клеточная стенка может состоять из целлюлозы (у растений), из хитина (у грибов), из сложных полимеров, в состав которых входят углеводы и аминокислоты (у бактерий) или из белков (у архей). У некоторых организмов, например у животных, клеточных стенок нет вообще - это позволяет их клеткам легко менять форму.


Основной компонент клеточных стенок растений - целлюлоза - это полимер глюкозы, так же как и крахмал. Но, в отличие от крахмала, она состоит не из α-глюкозы, а из β-глюкозы. Кроме того, молекулы целлюлозы не ветвятся. Образующиеся между остатками β-глюкозы β-гликозидные связи - на схеме молекулы целлюлозы они выглядят зигзагообразными - гораздо прочнее α-гликозидных и расщепляются только очень немногими ферментами. Например, никто из животных, питающихся растениями, не может самостоятельно переваривать целлюлозу; тем, кто берется ее усваивать, приходится заводить для этой цели симбионтов-бактерий, у которых есть нужный фермент - целлюлаза (Гиляров, 2008).

Растительная клеточная стенка может быть гораздо толще мембраны. Если растение многоклеточное, то между клетками обычно есть плазмодесмы - проходящие сквозь отверстия в клеточных стенках цитоплазматические мостики (цитоплазмой называется все внутреннее содержимое клетки, кроме ядра). Через плазмодесмы растительные клетки общаются и обмениваются разными веществами.
На самом деле клеточная стенка растений вовсе не состоит из чистой целлюлозы. Во-первых, в нее еще входят короткие ветвящиеся полимеры, включающие не только глюкозу, но и другие моносахариды (эти полимеры собирательно называются гемицеллюлозами), а во-вторых - некоторые структурные белки. Целлюлоза вместе с гемицеллюлозами и белками образует сложную сеть, усиленную к тому же водородными связями - между длинными молекулами целлюлозы, в которых много гидроксильных групп, они возникают очень легко.


С точки зрения жизни на Земле в целом самая интересная составляющая клеточной стенки растений - это лигнин. Он не имеет никакой общей формулы. Лигнин - сложный полимер, сшитый из нескольких разновидностей спиртов с ароматическими ядрами и углеводородными цепочками. Все мономеры лигнина синтезируются из аминокислоты фенилаланина, которая превращается сначала в коричную кислоту - вещество, входящее в состав масла корицы, - а потом в разнообразные спирты (на схеме показаны только два из них):


Образование лигнина - признак сосудистых растений, то есть папоротников, плаунов, хвощей, хвойных и цветковых. Это эволюционное "изобретение", сделанное только после выхода растений на сушу, и то далеко не сразу. Дело в том, что лигнин придает клеточным стенкам огромную механическую прочность. Он необходим, чтобы сделать ствол наземного растения высоким, вплоть до многометрового, и создать транспортную систему из микроскопических трубочек, качающую воду на всю эту высоту. Именно с "изобретением" биосинтеза лигнина связано одно из крупнейших событий, поменявших лик Земли - появление лесов (Еськов, 2000).
Кроме того, появление лигнина сильно изменило глобальный круговорот углерода. Тут дело в том, что лигнин с его разнообразными мономерами и перепутанными химическими связями исключительно неподатлив к действию ферментов. Поэтому растительной тканью, в которой много лигнина, почти невозможно питаться. Из всех земных живых организмов эффективно разлагать лигнин "научились" только грибы, причем не все и не сразу (Robinson, 1990). Именно они и стали разрушителями мертвых деревьев. До этого вся огромная биомасса лигнифицированной древесины просто захоранивалась как есть, создавая залежи каменного угля, в честь которых получил название целый геологический период - каменноугольный, или карбон.

Карбоновые леса непрерывно вели фотосинтез и выделяли в атмосферу огромное, немыслимое в более ранние эпохи количество кислорода, который не расходовался на окисление стволов погибших деревьев, потому что перерабатывать их было еще некому. В результате доля кислорода в атмосфере достигла уникальной в истории Земли цифры 35% (Beerling et al., 2002). Как известно, современная атмосфера Земли содержит "всего" 21% кислорода. На самом деле по космическим меркам и это очень много, но в карбоне было в полтора раза больше. Связано это именно с тем, что огромная биомасса стволов деревьев со всеми содержащимися там полимерами не съедалась никакими живыми существами, в отличие от современной ситуации, когда упавшие стволы измельчаются насекомыми, перерабатываются грибами и в итоге их углеродные соединения окисляются дыханием до углекислого газа (CO2) - при этом расходуется кислород (O2), а углекислый газ уходит в атмосферу. А вот до той биомассы, которая успела захорониться в виде каменного угля до возникновения эффективных деструкторов, биосфера смогла "добраться" только с появлением человека, который неутомимо откапывает каменный уголь и жжет его. Процессы дыхания и горения описываются одним и тем же суммарным уравнением: C6H12O6 (глюкоза) + 6O2 → 6CO2 + 6H2O. Так что в итоге получается тот же самый углекислый газ, из которого фотосинтезирующие организмы (то есть растения) могут заново создать более сложные углеродные соединения, пригодные для построения тел живых существ.

Еще один очень распространенный в природе полисахарид - хитин, из которого состоят клеточные стенки грибов и наружные панцири очень многих многоклеточных животных. Это полимер, во многом похожий на целлюлозу. Он тоже состоит из остатков β-глюкозы, но только модифицированных. Хитин - азотсодержащий полисахарид. Его мономер - строго говоря, не глюкоза, а ацетилглюкозамин, производное глюкозы, где ко 2-му атому углерода вместо гидроксила присоединена аминоацетильная группа -NH-CO-CH3.

В состав клеточных стенок бактерий входят еще более сложные азотсодержащие производные глюкозы, к которым дополнительно ковалентно "пришиты" цепочки аминокислот. Такой многокомпонентный полимер называется пептидогликаном. Запоминать детали тут не имеет никакого смысла, единственное, что стоит обязательно отметить - в состав пептидогликанов входят не только L-, но и D-аминокислоты. Это тот редкий случай, когда D-аминокислоты в живых организмах все-таки встречаются. Пептидные цепочки, входящие в пептидогликан - именно пептиды, но не белки.

Со времен работавшего еще в XIX веке ученого-медика Ганса Христиана Грама (Hans Christian Joachim Gram) бактерий делят на грамположительных и грамотрицательных, в зависимости от того, окрашиваются ли они определенным химическим методом, который Грам изобрел. Чем они отличаются по строению клеток - показано на картинке; из еще не встречавшихся нам слов здесь стоит пояснить липопротеин (белок с липидной частью), липотейхоевую кислоту (спиртовой полимер, связанный с липидами) и порины - транспортные белки, создающие в мембране как бы поры для воды и растворенных в ней мелких молекул. Но эти детали не должны заслонять от нас интереснейшую проблему. У грамположительных бактерий снаружи от мембраны находится толстая пептидогликановая клеточная стенка - в этом плане их клетка похожа, скажем, на растительную, не считая того, что материал клеточной стенки другой. А вот у грамотрицательных бактерий есть две полноценные билипидные мембраны - внутренняя и наружная - и относительно тонкая пептидогликановая клеточная стенка между ними! Так не устроены никакие другие клетки. Есть гипотеза, что первые на Земле живые организмы были именно грамотрицательными бактериями, и только у их потомков вторая - наружная - мембрана исчезла (Cavalier-Smith, 2006). Независимо от того, верна эта гипотеза или нет, эволюционный зигзаг тут получился очень занятный.

Царство грибы | Дистанционные уроки

02-Янв-2013 | комментария 2 | Лолита Окольнова

Грибы — эукариотические организмы и их выделяют в отдельное царство.

 

Это уникальные организмы. У них есть признаки, присущие растениям. Грибы — эукариотические организмы и их выделяют в отдельное царство, есть некоторые признаки, которые присущи животным. Да и разные они все. Удивительные.

 

 


 

 

Строение клетки

 

  • Безусловно, грибы — эукариотические организмы. Т.е. в клетке есть четко оформленное ядро.
  • У организмов царства грибы есть клеточная стенка, т.е. мембрана имеет утолщение, содержащее запасное питательное вещество — хитин. Это углевод, присущий грибам и членистоногим;
    Еще характерным веществом грибов является гликоген —  тоже углевод.

 

Когда упоминают сходство грибов с растениями, то имеют ввиду именно клеточную стенку, у клеток животных организмов клеточной стенки нет.

 

 Питание грибов.

 

 Все представители царства грибов — гетеротрофы. Т.е. они потребляют органические вещества. И в этом они схожи с животными.

 

Помимо этого, грибы относят к редуцентам — они перерабатывают эти органические вещества в неорганические.

 

 Еще один термин, который характеризует питание грибов — осмотрофы. Т.е. организм питается растворенными веществами. В этом грибы тоже схожи с растениями.

 

Строение грибов

 

 

У низших грибов нет плодового тела — это именно то, что представляет интерес для грибников — ножка с шляпкой, то, как обычно дети рисуют гриб.

 

  • Есть одноклеточные грибы — дрожжи, например.

 

У других грибов клетки  клетки соединяются в нити (гифы), которые могут быть разделены перегородками на отдельные клетки или нет. Гифы объединяются в мицелий —  «вегетативное» тело гриба.

 

 

У мукора, например, гифы — одна, но очень сильно разветвленная клетка.

 

  • У высших грибов—  многоклеточная структура.

Самая большая удача для грибника — найти грибную поляну. Так вот эта поляна, точнее то, что под землей — это все мицелий — сеть ниточек — гифов. Т.е. вся площадь поляны — вегетативная часть гриба.

  • Шляпочные грибы — высшие. Это как раз те, за которыми «охотится» человек :). У них шляпка и ножка находятся на поверхности земли.

 
Ножка — связь с мицелием, а шляпка содержит споры.
 

Размножение организмов царства грибы

 

  • Вегетативное: гиф образует «почки», которые отделяются и разрастаются в новый гиф.
  • Бесполое: низшие грибы образуют споры из специальных клеток — спорангий;
    высшие —
    образуют споры — пыль, которая разноситься ветром или животными.
  • Половое размножение: оогонии — женские половые органы, производят женские гаплойдные (1n) гаметы;
    антеридии — мужские.
    Когда образуется зигота, она сначала покрывается жесткой оболочкой, некоторое время находится в состоянии покоя и только потом прорастает.

 

У аскомицетов сливаются не отдельные клетки, а половые органы.

 

Когда мы говорим о грибах, нужно запомнить термин сапротрофы.

 

САПРОТРОФЫ (от греческого sapros — гнилой и …троф), гетеротрофные организмы, использующие для питания органические соединения мёртвых тел или выделения (экскременты) животных. Участвуя в минерализации органических соединений, сапротрофы составляют важное звено в биологическом круговороте веществ и энергии.

 



 

Среди царства грибов есть паразитические организмы, симбионты (микориза — как раз пример такого симбиоза гриба с корнями растения), сапротрофы, есть даже хищники!

 

Есть грибы съедобные, есть ядовитые.

 

Человек использует грибы как в быту (дрожжи) и в медицине (пеницилл) для получения антибиотиков.

 

 


 
  • в ЕГЭ это вопрос А2 — Клеточная теория. Многообразие клеток
  • A5 — Разнообразие организмов
  • А32 — жизнедеятельность живых организмов
  • B2 —  Многообразие организмов и человек
  • В ГИА — А3 — Одноклеточные и многоклеточные организмы. Грибы

 


 
[TESTME 87]
 
 
 

Еще на эту тему:

Обсуждение: "Царство грибы"

(Правила комментирования)

Какое резервное питательное вещество характерно для грибов? / Справочник :: Бингоскул

Запасное питательное вещество у грибов такое же, как у животных. Они сочетают отдельные свойства животных и растительных организмов. Строение грибов позволяет считать их древнейшими организмами, возникшими в тот период развития Земли, когда органический мир не был разделен на растения и животные.

Особенности строения и жизнедеятельности

Грибы не относятся ни к растениям, ни к животным, это отдельное царство живой природы. Они являются эукариотами — организмами, клетки которых содержат одно или несколько ядер. К прокариотам относятся бактерии. Строение клеток и тип питания грибов — вопросы, которые часто встречаются в тестах и других заданиях на уроках биологии в 6–11 классах.


Особенности строения и жизнедеятельности грибов

Сходства грибов и растений  Сходства грибов и животных
Имеют плотную и прочную клеточную стенку, содержащую полисахарид (хитин). Питание — гетеротрофное, используют в пищу готовые органические вещества.
Поглощают растворенные в воде низкомолекулярные вещества. Могут быть паразитами, сапрофитами, симбионтами.
Неподвижны в вегетативном состоянии и способны к неограниченному росту. Накапливают гликоген — полимер, мономером которого является глюкоза.
Размножаются спорами. Выделяют мочевину — продукт жизнедеятельности.

Грибы поглощают пищу путем осмоса, подобно тому как растения всасывают воду и растворенные в ней минеральные соли. Благодаря этому свойству грибы могут получать готовые органические вещества.

К запасным питательным веществам у грибов относятся:

  • гликоген;

  • глюканы — полисахариды, состоящие из D-глюкозы;

  • полифосфат волютин;

  • липиды.

Углерод необходим для построения частей клеток, образования резервных запасов питательных веществ. Углеводы — важнейшие источники атомов углерода. Они легко усваиваются, служат источником энергии для жизнедеятельности грибов и материалом для построения молекул гликогена.

Какое резервное питательное вещество характерно для грибов

Гликоген или животный крахмал — полимер глюкозы. Запасное питательное вещество служит основным резервным углеводом у грибов. Гликоген — своеобразное депо питательных веществ. Углевод образует в цитоплазме грибной клетки мелкие гранулы.

Другим резервным веществом являются глюканы, например, декстран. Такие соединения не только служат запасом питания, но и выполняют опорную функцию. Многие грибы создают временный резерв питательных веществ в форме полифосфата волютина. Липиды в клетках тоже являются запасным веществом. Молекулы жиров объединяются в капельки — липосомы (микросомы).

Гликогеном и жирами богаты склероции грибов. Это плотные переплетения гиф мицелия, имеющие различную форму, размеры — от 1 мм до 20 см в диаметре, массу — от нескольких грамм до 20 кг. Склероции помогают грибам переносить низкие температуры, засуху и прочие неблагоприятные условия. Из склероциев развивается мицелий, дающий начало плодовому телу, а также органы спороношения гриба.


 

Смотри также: 

Общая характеристика грибов

еще царство собственно это последнее царство мы поговорили про вирусы про короче поговорили про растения про бактерии про животных нам осталось грибы а птица это животное досмотреть не надо путать слова животные и звери зверями называют только млекопитающих а вот животные это все начиная с простейших и заканчиваем млекопитающими птиц это животные ok значит грибы как выглядит грибы наверное вы представляете себе ну без домика конечно что то вот такое правда когда я говорю грибы что что вы представляете но на самом деле на грибы это гораздо более широкая группа живых существ до включаются как существа которых вы каждый день видите но вряд ли думайте что это грибы так и существа которые казалось бы очень простые вот это гриб да здорово ну гриб несъедобный явно даже выглядит как-то не съедобно но на самом деле это лишь очень небольшая часть гриба что ты хотела сказать да плесень это гриб да окей итак грибы и это существа которые чем-то похожи на животных о чем-то на растений мы это обсудим 250 тысяч видов то есть много действительно много больше пожалуй так у насекомых насекомых больше миллиона грибы живут везде где более или менее до насекомых винни более миллиона видов грибов 205 тысяч грибы живут везде где есть более или менее вода то есть им тяжело жить там где совсем сухо а так они живут в воде на суше в почве вот в основном да ну всмысле в воде да потому что ты да потому что пока на наш с тобой разговор сегодняшний не дошел до середины ты представляешь себе прислал гриб вот это а сейчас я покажу как выглядит грибы как бы на самом деле окей значит смотрите вот это вот не природные какие-то грибы посмотрите это рама железная на ней висят мешки полиэтиленовые в которых внутри опилки и они эти опилки туда вставлена грибница и это грибы который можно купить в любом магазине кто не знает как они называются нет ни опята вешанки вешанки выращивают вот искусственно выращивать два вида грибов вас нам-то шампиньоны они такие вот как обычные грибы выглядят и вешанки они вот такими вот гроздьями растят да да они вкусные до называется дождевик на вот значит чем грибы похожи на растения чем грибы похожи на растение как вы думаете корень это не совсем правда не просто говорите давайте чем до грибы похожи на растение тем что они растут на месте они введут до неподвижный прикрепленный образ жизни да хорошо вода нужна всем до запасают пищу все живые существа а в этом смысле ты прочитала да хорошо значит смотрите они неподвижны как кто как растение но они не умеют как растение добывать себе да энергию от солнца они питаются готовыми веществами как животные тоже не должны кого-то есть обычно грибы разлагают что-нибудь мертвые опавшую листву или какие-то трупы животных и так далее вот да кроме того они запасают в пищу как животные и растения запасают крахмал как в картошке а животные запасают другой сахар назвается гликоген вот у вас на пир в печени есть запас сахара специального чтобы вы могли протянуть в сутки без еды гликоген называется до гликоген это как бы то что дает глюкозу до хорошо а как они едят если они неподвижны они растворяют что-нибудь своими нитями я покажу как это выглядит вот значит у них есть клеток жесткая стенка как у кого как у растения у животных клетки мягкие ok грибы есть 4 разных групп самые известные вам грибы это те у которых есть плодовые тела трубчатые например белый или подосиновик или подберезовик если перевернуть шляпку внутри будет как будто губочка много маленьких трубочек а да если вы перевернете пластинчатый гриб синих сыроежки лисички много-много других опята то вы увидите пластиночки вот и те и другие грибы могут быть как съедобными так и не съедобными и ядовитыми вот грибы бывают ядовитыми а бывает несъедобную когда мы чем разница коралл это животное в чем разница между не съедобными и ядовитыми как ты думаешь она до от ядовитых можно умереть у них вентари токсичные вещества от несъедобных будет просто несварение как бы ну не хорошо но шансов умереть нет вот ok кроме того маленькие очень грибы у которых нет никаких плодовых тел разрушают всякие продукты питания плесень это то это одна из проблем почему долго не хранятся продукты от плесени можно защититься например высокой температурой или консервированием в соли или консервируем в уксусе или очень высоким содержанием сахара как в варенье до в воздухе летают маленькие споры они попадают на все вокруг часть вокруг безумное количество на всем твоем теле на парте на полу везде везде есть плиз споры плесени поэтому если ты просто оставишь кусок хлеба он заплесневеет через некоторое время хотя ты специально его ничем не мазал до да настоящая плесень просто особого сорта а и не туда специально вносят плесень потому что ждать долго да друзья если вы будете бухтеть так то я не буду отвечать на вопросы потому что бесполезно услышите все вопросы ответ сейчас вы попытаетесь или я не буду на них отвечать вопрос значит для того чтобы ответить на этот вопрос нужно понимать что такое грипп ты узнаешь это буквально в течение ближайших трех минут продолжим и еще одни грибы это грибы которые парни пожалуйста прекратите или и вас реально выгоню с конспектом параграфы вы мешаете ввести урок я не слышу чтобы она ворчала она тебе оно тебе мешает окей оно тебе мешает оно тебе мешает вот сюда пересядь она тебя не будет мешать очень простое решение для которой может додуматься любой человек окей тут нет стула ну ты можешь взять вот соседней и последнее грибы это одноклеточные например это кто дрожжи дрожжи используют выпечки хлеба они разрушают сахар и получается углекислый газ именно он дает пузырьки внутри хлеба и за час х тесто всходят кроме того дрожь используйте производства напитков безалкогольных типа кваса алкогольных типа пиво и так далее они и разрушают сахар и делают из него спирт этиловый вот то есть они широко применяются в производстве пищи теперь ответ на вопрос как долго живут грибы дело в том что то что вы видите это не сам грипп это все как будто представь себе что под землей растет гигантское яблони а над землей торчат только яблоки вот примерно так можно представить себе картину с грибами под землей тонкие белые нити которые могут простираться на десятки метров и это и есть грипп грибница или мицелий а то что вылезает наружу плодовое тело нужно только для размножения грибы в этом смысле подождите грибы в этом смысле похожи на водоросли они тоже сплетены из одинаковых простых штук но кажется что они сложны но посмотрите внутри гриб однородный он снаружи выглядит каким-то нарядным разным внутри просто белая штука одинаковая да если сильно повредить грибницу то гриб будет дольше вырастать но в но новые плодовые тела дольше их не будет до вопрос да ничего да конечно много грибов по то и поэтому если ты нашла крупный гриб рядом скорее всего будут ещё грибы до вопрос девушке напрягаете да да грибницу нет да только плодовые тела грибница это тонкие нити в почве их не получится собирать да и вырастет непременно если ты не будешь там все перекапывать и вырывать очень сильно ok итого у грибов у которых есть плодовые тела сам грипп живет под землей плодовое тело только способ размножаться да да знаешь бесконечные споры поводу того правильнее чем просто моста вымешаем там у людей важны разговора а мы их отвлекаем давай помолчим с этими нашими грибами дурацкими значит есть бесконечные споры вырывать или срезать и у тех и других людей есть доводы я не знаю то есть к и не уверен что есть реально какой-то вот правильное мнение на этот счет и так и так грибы вырастают что больше вредит неизвестно ok грибы разлагают мертвые останки это очень здорово они возвращают в почву минералы это помогает растениям расти грибы часто растут рядом с каким деревьями например да осины подосиновик березы подберезовик белые грибы там где дубов много часто растут до выйдем а на пять минут окей значит и дело в том что растений гриб сотрудничают гриб и корни растения переплетаются гриб отдают растению воду а россияне делится с ним сахаром это взаимовыгодное сотрудничество называется симбиоз сим вместе bio жить это взаимовыгодные отношения между разными видами живых существ какие-то вопросы нет да да можно взять кусочек грибницы они даже продаются и посадить ее на развиваться она будет нам месте долго несколько лет до первых плодовых тел то есть в тот же год никаких грибов не будет чтобы быстро выращивать грибы вот выращивают или шампиньоны или вешенки они быстро развиваются многие грибы да многие грибы используют в пищу однако на самом деле если съесть какой-нибудь гриб большая часть гриба эта вода и практически никакой питательной ценности в грибах нет и и очень мало и поэтому они священными калорийны но вкусные с другой стороны некоторые грибы вызывают заболевания например кожное заболевание а например частая причина появления перхоти когда шелушится кожа на голове это именно грибковые заболевания да обычные маленькие одноклеточные обычные шампуни от этого не помогает но бывают специальные ну как покупают именно в аптеках они всякие to have shown to school of в магазине не очень поможет вот дальше есть заболевание дело в том что грибы редко вызывают болезни именно болезни вот внутренние и и но иногда вызывают например заболевания дыхательных путей вот вроде до грибы но при этом у кого-то они вызывают а у кого-то нет довольно сложно предсказать почему у большинства людей этот гриб просто попадает в тело и ничего не происходит а у кого-то начинается заболевание что нет нет нет нет еще раз подосиновики живут в почве бывают одноклеточные грибы вроде плесени который могут вызывать заболевания у людей но делает это очень редко ты вдыхаешь воздухе сейчас куча спор плесени с каждым вдохом я думаю что уж несколько штук точно попадают в тебя но в этом нет проблемы это почти никогда не приводит к чему-то плохому до нет аллергия может быть на что угодно живое это не какое-то конкретное заболевание да их не очень много это теоретически возможно н таком не слышал обычно аллергия бывает на пожалуйста опять вместе со стулом вот сюда вы не можете сидеть вместе и не говорить при этом постоянно аллергий обычно бывает на цветение can appear много пыльцы да окей давайте сейчас немножко притих ним вопросы продолжим внутри кваса живут дрожжи они одноклеточные маленький они постоянно делятся и делают из сахара у вас делают из хлеба и сахара делают из сахара углекислый газ еще некоторые вещества да и получается такой вот необычный вкус и квасу придает именно хлеб если взять просто воду и сахар и дрожжи добавить вас получится никвас случае штуковина зайцы брага это будет просто такой довольно без вкусный напиток в котором будет по со временем повышаться количество алкоголя вот но собственно аквас и за счет хлеба не так активно бродит там очень мало спирта порядка одного процента всего лишь но при этом там получается из хлева много вкусных веществ поэтому вот квас как бы достаточно приятный напиток как сделать квас хлеб сахар дрожжи фактически это минимальный набор черный хлеб сахар дрожжи ну вода естественно да ну прости я как бы не подумал что получится продают в магазинах продают концентрат этот концерт основа сусла там уже смешано сахар и как бы экстракты с хлеба и можно сделать классным за неделю с другой стороны плесень-плесень например пенициллин ни цента самый распостраненный то такая синей ваты зеленая плесень вы можете легко ее дома вырастить просто оставив что-нибудь она вырастет сама хлеб плесневеет это фрукты плесневеть что угодно это маленькие грибы которые просто начинают разрушать вокруг себя фрукт или какую-то другую еду и разрастаться само по себе это не опасно но такие продукты отравлены как быть тем что плесень выделяет вокруг себя есть их уже не стоит сейчас что если нет если на хлебе выросла плесень то его не стоит есть давайте вас и правда лиам пейн сосредоточьтесь пожалуйста последняя тема но осталось всего 2 минуты чтобы я вас не задерживал и или не задавал конспект сейчас вопросов только после объяснения лишайники вы наверняка видели такие штуки которые растут в лесу на ветках на камнях еще где-то это лишайники вот не надо подходить я покажу а на перемене сможете подойти этот самые крупные вот это называется олений мох но на самом деле не мог это лишайник ну вот а вот бывает на камнях они почти неотличима это от ее тонкие пленки на камнях можно будет подойти и посмотреть аккуратно значит что такое лишайники и это ни один живой организм лишайник это гриб который живет вместе с водорослей они живут вместе гриб защищает водоросли дает ей воду а водоросли делает еду как она делает еду фото синтезирует до водоросли не смогла бы жить сама на поверхности потому что она бы высохла но гриб защищает ее выглядит это вот так здесь много разных наверное штук пять разных лишайников на камне лишайники отлично живут в очень холодных и тяжелых условиях они первыми заселяют нового образовавшуюся например острова как может образоваться новый остров да извержение вулкана до или подъем суши но бывает чё коралловые острова но там немножко по-другому все окей вот остров в холодном море на нем растут только всякие лишайниками хи и голосеменные потому что здесь довольно сурово лишайники могут выживать в очень суровом климате вот это самые простые как будто накипи на камне очень тонкий слой их невозможно отделить от поверхности но только разрушив это называется ли 100 ватт и они приподнимаются как листики над поверхностью и вот такие нравятся кустистые это вот как раз ягель ягель в принципе съедобен вот вот он так выглядит кей а так себе они на вкус

Читать "Структурная биохимия" - Бессолицына Екатерина Андреевна - Страница 5

В процессе переваривания пищи лактоза подвергается ферментативному гидролизу в результате воздействия лактазы, секретируемой мукозными клетками кишечника. У грудных младенцев активность этого фермента очень высока, однако в кишечнике взрослых людей лактазная активность наблюдается лишь у жителей севера Европы и некоторых африканских племен. У большинства взрослых людей, в том числе у жителей Востока, арабов, евреев, многих африканцев, индийцев и жителей Средиземноморья, лактазная активность в кишечнике очень низка, что часто приводит к непереносимости (интолерантности) лактозы. Описанная особенность обусловлена генетически. Причина непереносимости лактозы связана с тем, что этот дисахарид может всасываться в кишечнике только после гидролиза на моносахаридные компоненты: при низкой лактазной активности неусвоенная лактоза накапливается в кишечнике; в результате после потребления молока у человека с непереносимостью лактозы возникает тяжелый понос и боли в животе.

Трегалоза состоит из двух молекул α D-глюкозы, соединенных 1—1 α гликозидной связью. Трегалоза входит в состав гемолимфы насекомых, также выделяется из некоторых грибов. Является нередуцирующим дисахаридом (Рисунок 20). Трегалоза является транспортной формой моносахаридов в кровеносной системе насекомых.

Дисахариды растений

Сахароза – гетеродисахарид, состоящий из глюкозы и фруктозы, соединенных β (1—2) гликозидной связью (Рисунок 20). Сахароза является нередуцирующим сахаром. Сахарозу синтезируют многие растения, у высших же животных она отсутствует. В отличие от мальтозы и лактозы у сахарозы нет свободного аномерного атома углерода, поскольку оба аномерных атома моносахаридных остатков связаны друг с другом; поэтому сахароза не является восстанавливающим сахаром. Сахароза основной промежуточный продукт фотосинтеза. У многих растений именно в форме сахарозы транспортируются по сосудистой системе сахара из листьев к другим частям растения. Преимущество сахарозы перед глюкозой как транспортной формы сахаров заключается, вероятно, в том, что ее аномерные атомы углерода связаны друг с другом: это предохраняет сахарозу от атаки окислительных или гидролитических ферментов в процессе ее переноса из одной части растений в другую. Животные не могут усваивать сахарозу как таковую, однако она становится доступной для усвоения после воздействия фермента сахаразы (другое его название – инвертаза), локализованного в клетках, выстилающих тонкий кишечник. Этот фермент катализирует расщепление сахарозы на D-глюкозу и D-фруктозу, которые легко проникают в кровоток.

Полисахариды

В природе большинство углеводов представлено в виде полисахаридов с высокой молекулярной массой. Биологическое значение ряда полисахаридов состоит в том, что одни обеспечивают накопление моносахаридов для энергетического обмена в нерастворимой, а значит осмотически неактивной форме, другие же служат структурными элементами клеточных стенок и соединительной ткани. При полном гидролизе под действием кислоты или специфических ферментов полисахариды расщепляются с образованием моносахаридов или их производных.

Полисахариды, называемые также гликанами, отличаются друг от друга как природой составляющих их моносахаридных остатков, так и длиной и степенью разветвленности цепей. Их можно разделить на два типа: гомополисахариды, состоящие из остатков одного и того же моносахарида, и гетерополисахариды, содержащие остатки двух или большего числа моносахаридов. Пример гомополисахарида резервный углевод крахмал, состоящий из остатков только D-глюкозы. Примером гетерополисахарида может служить содержащаяся в соединительной ткани гиалуроновая кислота, которая состоит из чередующихся остатков двух разных моносахаридов.

В отличие от белков полисахариды нельзя характеризовать строго определенной молекулярной массой: как правило, они представлены смесями высокомолекулярных соединений; в зависимости от метаболических потребностей клеток моносахаридные остатки могут ферментативно присоединяться к полисахаридам или же отщепляться от них. Также, как и дисахариды, полисахариды делятся на редуцирующие и нередуцирующие. По наличию свободной альдегидной группы, которая, окисляясь, восстанавливает ионы некоторых металлов.

По функции полисахариды делят на структурные и запасающие.

Запасающие полисахариды обеспечивают накопление моносахаридов, участвующих в энергетическом обмене в виде компактных нерастворимых структур (включений). Нерастворимость обеспечивает отсутствие влияния на осмотическое давление в клетке.

Структурные полисахариды служат внеклеточными опорными элементами в стенках клеток одноклеточных микроорганизмов, грибов и высших растений, а также входят в состав соединительной ткани позвоночных и экзоскелета членистоногих. Структурные полисахариды защищают клетки, ткани и органы, придают им форму и поддерживают ее. У различных организмов запасающие и структурные полисахариды различаются.

Запасающие полисахариды животных и грибов

Рисунок 21. Структура гликогена

Гликоген – полисахарид, в виде которого углеводы запасаются в организме животного. Его часто называют животным крахмалом. В наибольшем количестве гликоген содержится в печени, где на его долю приходится до 7% общего веса органа; гликоген имеется также в скелетных мышцах. В клетках печени гликоген присутствует в виде крупных гранул, состоящих в свою очередь из меньших гранул; последние образованы единичными сильно разветвленными молекулами гликогена со средней молекулярной массой в несколько миллионов. С этими же гранулами прочно связаны ферменты, ответственные за синтез и распад гликогена. Гликоген откладывается в виде гранул в цитоплазме клетки.

У грибов гликоген запасается в клетках гифов.

Гликоген – редуцирующий гомополисахарид, образованный остатками α-D-глюкопиранозы. Гликоген характеризуется более разветвленной структурой, чем амилопектин, линейные отрезки цепи включают 11—18 остатков α-D-глюкопиранозы [соединенных α (1—4) -гликозидными связями], в точках ветвления остатки соединены α (1—6) -гликозидными связями (Рисунок 21).

Запасающие полисахариды бактерий

Самый распространенный полисахарид бактерий – гликоген, чья структура была рассмотрена в предыдущем разделе. Но также встречаются и другие типы (Рисунок 22).

Рисунок 22. Структура запасающих полисахаридов бактерий

Декстран.

Конец ознакомительного фрагмента.

Текст предоставлен ООО «ЛитРес».

Прочитайте эту книгу целиком, купив полную легальную версию на ЛитРес.

Безопасно оплатить книгу можно банковской картой Visa, MasterCard, Maestro, со счета мобильного телефона, с платежного терминала, в салоне МТС или Связной, через PayPal, WebMoney, Яндекс.Деньги, QIWI Кошелек, бонусными картами или другим удобным Вам способом.

Гены метаболизма гликогена участвуют в опосредованной трегалозой-6-фосфат-синтазой регуляции патогенности рисовым грибком Magnaporthe oryzae

Abstract

Нитчатый гриб Magnaporthe oryzae является возбудителем болезни рисового взрыва. Здесь мы показываем, что гены метаболизма гликогена играют важную роль в заражении растений M. oryzae . Нацеленная делеция AGL1 и GPh2 , которые кодируют амилоглюкозидазу и гликогенфосфорилазу, соответственно, препятствовала мобилизации запасов гликогена во время развития аппрессория и вызывала значительное снижение способности M.oryzae , чтобы вызвать болезнь, вызванную грибковой инфекцией риса. Напротив, целевая мутация GSN1 , кодирующая гликогенсинтазу, значительно снижает синтез внутриклеточного гликогена, но не влияет на патогенность грибов. Мы обнаружили, что потеря AGL1 и GPh2 привела к снижению экспрессии TPS1 и TPS3 , которые кодируют компоненты комплекса трегалоза-6-фосфатсинтаза, который действует как генетический переключатель в M. oryzae .Tps1 реагирует на уровни глюкозо-6-фосфата и баланс НАДФ / НАДФН, регулируя экспрессию генов, ассоциированную с вирулентностью, в сочетании с ингибиторами транскрипции Nmr. Мы показываем, что делеция гена ингибитора транскрипции NMR3 частично восстанавливает вирулентность мутанта Δ agl1Δgph2 , предполагая, что гены метаболизма гликогена необходимы для работы NADPH-зависимого генетического переключателя в M. oryzae .

Об авторе

Грибок Magnaporthe oryzae вызывает разрушительную болезнь риса, называемую взрывом.Ежегодно вирусная эпидемия риса уничтожает почти четверть потенциального урожая риса в мире. Грибок поражает рисовые растения, создавая особую инфекционную структуру, называемую аппрессорием, которая физически разрушает жесткую внешнюю кутикулу рисового листа. Magnaporthe может развивать аппрессории при отсутствии источника питательных веществ. Поэтому мы изучаем, как гриб использует запасы энергии в своих спорах для своего первоначального роста и развития. Гликоген является ключевым запасным соединением в грибах, и в этом исследовании мы исследовали, как происходит распад гликогена в грибах рисового бласта.Мы показали, что два основных фермента, разрушающих клеточные запасы гликогена, важны при болезни рисового бласта. Однако мы также обнаружили, что штамм гриба, у которого сильно нарушена способность синтезировать собственный гликоген, все еще может нормально инфицировать растения. Чтобы объяснить эти явно противоречивые результаты, мы исследовали регуляторную роль распада гликогена и предоставили доказательства того, что метаболизм гликогена является ключевым регулятором недавно описанного генетического переключателя, связанного с вирулентностью, в Магнапорте, который управляется ферментом, называемым трегалозо-6-фосфатсинтазой.

Введение

Райсовая болезнь является наиболее серьезным заболеванием культивируемого риса и в последние годы вызвала эпидемии в Южной Корее, Японии, Бутане и Китае [1], [2], что привело к серьезным потерям урожая. Поэтому понимание биологии рисовой пестициды важно для разработки надежных стратегий борьбы с этим заболеванием [2].

Рисовый грибок, Magnaporthe oryzae , вызывает заражение листьев риса, образуя специализированную инфекционную структуру, называемую аппрессорием [2].Это одноклеточная куполообразная структура, которая развивается из конца грибковой зародышевой трубки и отвечает за механическое повреждение кутикулы риса, позволяя грибку проникать в клетки растений. Развитие аппрессория регулируется клеточным циклом в M. oryzae с контрольными точками, регулирующими инициацию и созревание аппрессория [3], [4]. Дифференциация аппрессория сопровождается аутофагией в конидиуме, что приводит к запрограммированной гибели клеток и мобилизации содержимого трехклеточной споры в инфекционную клетку.Предотвращение аутофагии путем делеции любого из основных генов, связанных с неселективной макроаутофагией, делает гриб непатогенным, демонстрируя, что рециклинг содержимого конидия необходим для правильного функционирования аппрессория [3], [5 ].

Огромный тургор, создаваемый аппрессорием M. oryzae , является результатом накопления глицерина, который действует как совместимое растворенное вещество, вызывая приток воды в клетку для создания гидростатического давления [6].Отток глицерина предотвращается слоем меланина в клеточной стенке аппрессория, и мутанты, неспособные синтезировать меланин, не могут генерировать тургор и, следовательно, не являются патогенными. Ранее было показано, что запасы гликогена и липидные тела перемещаются из конидия в апрессорий M. oryzae до образования тургора [7] - [9]. Этот процесс контролируется Pmk1 MAP kinase pathway, который регулирует морфогенез appressorium [10] и, вероятно, связан с началом аутофагии в конидии [3].Распад липидов и гликогена в аппрессории контролируется путем ответа цАМФ, и мутанты cpkA , лишенные активности протеинкиназы А, обнаруживают значительные задержки в распаде липидов и гликогена [7]. Быстрые изменения первичного метаболизма во время созревания аппрессория, по-видимому, частично регулируются генетическим переключателем, опосредованным трегалозо-6-фосфатсинтазой (Tps), который реагирует на уровни глюкозо-6-фосфата (G6P) и баланс NADPH / NADP. в ячейках [11]. Tps-опосредованный переключатель генов взаимодействует с тремя ингибиторами транскрипции, которые регулируют экспрессию генов, связанных с вирулентностью, в ответ на преобладающие метаболические условия [11].

В этом исследовании мы исследовали роль метаболизма гликогена в функции аппрессория M. oryzae . Мы показываем, что запасы гликогена в споре быстро разрушаются во время прорастания спор в процессе, регулируемом путем ответа цАМФ. Мы демонстрируем, что гены гликогенфосфорилазы GPh2, и амилоглюкозидазы AGL1 , которые кодируют ферменты, необходимые для расщепления цитозольного гликогена, являются факторами вирулентности, участвующими в инфекции растений.Однако неожиданно мы также показали, что гликогенсинтаза, кодируемая геном GSN1 в M. oryzae , не обязательна для патогенности. Чтобы объяснить этот очевидный парадокс, мы приводим доказательства того, что потеря активности амилоглюкозидазы или гликогенфосфорилазы в M. oryzae приводит к снижению экспрессии TPS1 , тем самым влияя на регуляцию G6P / NADPH-зависимого гена [11] - [13] ]. В соответствии с этой идеей, мы показываем, что делеция NMR3 , одного из ингибиторов транскрипции, связанных с Tps1, частично восстанавливает вирулентность мутанта Δ gph2Δagl1 .Наши результаты показывают, что распад гликогена в аппрессории является важным фактором в регулировании экспрессии генов, связанных с вирулентностью.

Результаты

Мобилизация гликогена во время инфекционного развития

Magnaporthe oryzae

Чтобы исследовать роль мобилизации гликогена во время формирования аппрессория, мы сначала изучили клеточное распределение гранул гликогена в штамме M. oryzae дикого типа, Guy-11 и регуляторных мутантах, затронутых морфогенезом аппрессория.У Guy-11 непрораставшие конидии (0 ч инкубации) были богаты гликогеном, на что указывает темный осадок в каждой из трех конидиальных клеток после инкубации в растворе йода (), как описано ранее [7]. Во время прорастания и раннего образования аппрессория (2–4 ч) гликоген расщеплялся, а остаточный гликоген локализовался только в центральной клетке конидия. После 6 ч прорастания гликоген появился в зарождающемся апрессории, но быстро истощился во время созревания апрессория, пока через 24 часа не стали видны только темное кольцо меланина вокруг апрессория и небольшое количество зерен гликогена (, [7]).

Распределение клеток и количественный анализ гликогена во время морфогенеза аппрессоров у M. oryzae .

Микрофотографии мобилизации гликогена во время развития аппрессория M. oryzae . Конидии штаммов M. oryzae проращивали на гидрофобных пластиковых покровных стеклах. Образцы отбирали через 0 ч, 2 ч, 4 ч, 6 ч, 8 ч, 12 ч, 24 ч и 48 ч и окрашивали на наличие гликогена раствором йода. Желтовато-коричневые отложения гликогена сразу стали видны с помощью модулирующей оптики Хоффмана с микроскопом Nikon Optiphot-2. А . Штамм дикого типа Guy 11, проращенный в воде. В . ΔcpkA мутант DF51. С . Штамм дикого типа Guy 11 проращивали в полной среде (CM), содержащей 2% дрожжевого экстракта. Бар = 10 мкм. D – F Графики, показывающие биохимический анализ мобилизации гликогена во время формирования аппрессория M. oryzae Конидии проращивали в воде на гидрофобных пластиковых покровных стеклах и позволяли формировать аппрессории. Количество гликогена в пикограммах оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген. Д . Штамм дикого типа Guy 11. E . ΔcpkA мутант DF51. Ф . Δmac1 sum1-99 мутант DA-99. Каждая точка данных представляет собой среднее значение трех независимых повторов эксперимента. Планки погрешностей показывают стандартное отклонение.

Чтобы изучить роль пути цАМФ в мобилизации гликогена, мы исследовали мутант ΔcpkA (). CPKA кодирует каталитическую субъединицу цАМФ-зависимой протеинкиназы A [14], [15].Конидии изначально были богаты гликогеном, но деградация гликогена у мутантов ΔcpkA была отложена, гликоген все еще присутствовал в конидиях через 8 часов. Затем гликоген откладывался в деформированных аппрессориях ΔcpkA , но эти клетки не развивались полностью и гликоген не разрушался (). Мы пришли к выводу, что путь цАМФ регулирует эффективную деградацию гликогена во время прорастания и образования аппрессория. В соответствии с этой идеей, мутант супрессора обхода цАМФ Δmac1 sum1-99 [16], обнаруживает ускоренный распад гликогена в аппрессориях, как сообщалось ранее [7].

Чтобы определить, связана ли мобилизация гликогена с развитием аппрессориев, конидии Guy-11 проращивали в условиях с высоким содержанием питательных веществ (2% дрожжевой экстракт), которые подавляют образование аппрессориев [16]. Наблюдалась ограниченная деградация отложений гликогена, и через 48 ч гранулы гликогена можно было увидеть внутри разветвленных зародышевых трубок (). Таким образом, мобилизация гликогена из конидиума связана с морфогенезом аппрессория в условиях отсутствия питательных веществ.

Биохимический анализ мобилизации гликогена в развивающемся апрессории

Затем мы разработали анализ, позволяющий количественно оценить запасы гликогена, и обнаружили, что непроращенные конидии Guy11 содержат около 1200 пг гликогена ().Мы наблюдали 1500 пг гликогена проростков -1 через 2 часа прорастания, во время прорастания зародышевой трубочки, но между 2 и 12 часами после прорастания количество гликогена упало до 500 пг проростков -1 и оставалось на этом уровне во время созревания аппрессория. , что представляет собой среднее снижение на 988 пг с 95% семейным доверительным интервалом (667, 1310), p <0,001. За все 48 часов средний уровень гликогена снизился на 751 пг (95% ДИ 1073, 430 p <0.001). Сравнить эти результаты с предыдущими измерениями уровня гликогена в почкующихся дрожжах Saccharomyces cerevisiae [17], они должны быть преобразованы в фемтомоли (фмоль) на клетку. Количество клеток M. oryzae можно легко определить только через 0 ч (3-клеточный конидий) и 48 ч (одноклеточный апрессорий). Следовательно, непроращенный конидиум M. oryzae содержит в среднем 2363 фмоль клеток гликогена -1 , в то время как аппрессорий содержит 2450 фмоль клеток гликогена -1 .Значительная емкость гликогена клеток M. oryzae дикого типа подчеркивается, когда эти значения сравниваются с 19,5 фмоль гликогена, измеренным в дрожжевых клетках S. cerevisiae [17]. Мутант ΔcpkA содержал более низкие уровни гликогена, чем Guy11 (). В 0 ч мы обнаружили 800 мкг проростков гликогена -1 . Не было значительных изменений в уровнях гликогена ΔcpkA за весь период времени (общее среднее снижение на 13 пг [95% ДИ 354, 328 p = 1]).В цАМФ-независимом мутантном штамме PKA Δmac1 sum1-99 анализ гликогена выявил изначально высокие уровни гликогена в 1700 пг зародышей -1 (). Это продолжало увеличиваться до пика при 2100 пг проростков -1 через 4 часа (среднее увеличение от 0 до 4 часов для 450 пг [95% ДИ -265, 1164 p = 0,545]). Между 4 и 6 часами после прорастания, во время образования аппрессория, уровни гликогена быстро снижались в среднем на 986 пг проростков -1 (95% ДИ 1700, 272 p <0.001). Уровни снова повышались до 12 часов, достигая пика при более низком значении 1800 пг проростков -1 (среднее увеличение 646 пг [95% ДИ -152, 1445 p = 0,2156]. Затем гликоген постепенно снижался в среднем на 1340 пг за оставшиеся 36 часов (95% ДИ 2139, 541 p <0,001) до конечного значения примерно 400 пг проростки -1 через 48 ч. За весь период времени уровни гликогена в сумме Δmac11- 99 мутант уменьшился в среднем на 1230 пг (95% ДИ 1944, 516 p <0.001). Мы пришли к выводу, что путь ответа цАМФ регулирует мобилизацию гликогена во время развития аппрессория у M. oryzae .

Идентификация и характеристика

M. oryzae AGL1 и GPh2

Чтобы определить, необходима ли мобилизация гликогена для патогенности M. oryzae , мы идентифицировали основные ферменты, связанные с его расщеплением. Гликоген состоит из цепей глюкозы, связанных α-1,4-гликозидной связью, и примерно у каждого десятого остатка точка разветвления образована α-1,6-гликозидной связью.Амилоглюкозидаза (фермент разветвления гликогена) удаляет α-1,6-гликозидные связи из сильно разветвленного полимера, высвобождая глюкозу. Предполагаемый ген, кодирующий амилоглюкозидазу, AGL1 (MGG_00063.6), был идентифицирован в последовательности генома M. oryzae . [18]. AGL1 имеет открытую рамку считывания 4749 п.н., прерванную двумя интронами длиной 134 и 91 п.о., и кодирует предполагаемый белок из 1583 п.о. Сопоставление потенциального белка Agl1 M. oryzae с амилоглюкозидазами других организмов (рисунок S1) выявило 72% идентичности гипотетическому белку из Neurospora crassa и 47% идентичности ферменту разветвления гликогена Gdb1 S.cerevisiae [19]. Дальнейший анализ белковой последовательности выявил четыре консервативных участка аминокислот, присутствующих в α / β бочкообразном домене всех членов суперсемейства α-амилазы (данные не показаны). Разрушение гликогена также требует действия гликогенфосфорилазы. Этот фермент дополняет α-1,6-гликозидную активность амилоглюкозидазы, воздействуя на экзогликозидные α-1,4-гликогенные связи гликогена, последовательно отщепляя и фосфорилируя невосстанавливающие концы полимера.Был идентифицирован ген M. oryzae GPh2 (MGG_01819.6) и выявлена ​​ORF длиной 2664 п.о., кодирующая предполагаемый белок 888 аминокислотных остатков. В последовательности присутствовали два старт-сайта ATG в рамке считывания, самый 5'-из них имеет индикаторный нуклеотид старт-сайта, А, на -3 п.н. [20], который, вероятно, является сайтом инициации трансляции для GPh2 [21]. Белок показал 78% идентичности гипотетическому белку в N. crassa и 74% идентичности предполагаемой гликогенфосфорилазе из Aspergillus fumigatus (Рисунок S2).В S. cerevisiae сайт фосфорилирования присутствует в N-концевой области белка [22]. Белок M. oryzae демонстрирует высокую степень сходства с этой последовательностью, а остаток треонина, с которым связывается фосфат в дрожжевой гликогенфосфорилазе, является консервативным. Кроме того, все гликогенфосфорилазы обладают сайтом связывания для пиридоксаль-5'-фосфата, кофактора, участвующего в фосфорилировании. Альдегидная группа этого производного пиридоксина образует основание Шиффа со специфической лизиновой боковой цепью гликогенфосфорилазы [23].Аминокислотная последовательность, окружающая этот сайт, была идентифицирована в дрожжевой гликогенфосфорилазе [22] и является высококонсервативной в M. oryzae GPh2 с 17 из 18 остатков, идентичными у двух организмов (данные не показаны). Последовательность геномной ДНК длиной 3021 п.н. M. oryzae GPh2 также была идентифицирована из опубликованной последовательности генома [18]. Сравнение этой геномной последовательности с последовательностью кДНК GPh2 выявило присутствие четырех интронов.

Целенаправленная замена гена

M.oryzae AGL1 и GPh2

Чтобы изучить роль AGL1 и GPh2 в патогенности M. oryzae , мы выполнили целевую замену гена (рисунок S3A). Фрагмент Hin dIII размером 2,8 т.п.н. (рисунок S3B), содержащий большую часть 5'-области AGL1 , был удален и заменен кассетой гигромицинфосфотрансферазы [24], придающей устойчивость к гигромицину B. Полученная конструкция (рисунок S3B) ) вводили в Guy-11 и проверяли трансформанты с помощью гель-блоттинга ДНК (рис. S3C).Чтобы удалить GPh2 , часть кодирующей последовательности размером 3 т.п.н. в 2,2 т.п.н. была впоследствии заменена кассетой устойчивости 1,4 т.п.н. к гигромицин-фосфотрансферазе (рисунок S3D). Полученная кассета была введена в Guy-11 и отобраны трансформанты (Рисунок S3E).

Делецию каждого гена подтверждали измерением активности ферментов Agl1 и Gph2 (). Активность амилоглюкозидазы не была обнаружена в штамме Δ agl1 , а активность гликогенфосфорилазы не была обнаружена в мутантах Δ gph2 .Однако мы также наблюдали, что активность амилоглюкозидазы не может быть обнаружена в штаммах с делецией Δ gph2 . Амилоглюкозидаза расщепляет точки разветвления гликогена только тогда, когда они становятся доступными под действием гликогенфосфорилазы и, следовательно, не могут быть измерены в этом анализе.

Столбчатые диаграммы, показывающие активность амилоглюкозидазы и гликогенфосфорилазы у мутантов M. oryzae , метаболизирующих гликоген.

Подробнее о ферментативных анализах см. Материалы и методы. А . Активность амилоглюкозидазы не была обнаружена в мутантах Δ agl1 или, как следствие использованного анализа, в штаммах Δ gph2 . В . гликогенфосфорилазная активность отсутствовала у мутанта Δ gph2 .

Для создания двойного мутанта Δ agl1 Δ gph2 мы провели целевую делецию AGL1 в мутанте Δ gph2 , используя метод делеции гена маркера расщепления [25]. Конструкции с делецией генов трансформировали в Δ gph2 с использованием аллеля гена ацетолактатсинтазы, придающего устойчивость к сульфонилмочевине.Полученные трансформанты были отобраны и проанализированы с помощью гель-блоттинга ДНК (рис. S4). Кроме того, была проведена ОТ-ПЦР для подтверждения успешной делеции гена. В Guy11 и Δ gph2 был амплифицирован ампликон длиной 789 п.н., соответствующий транскрипту Agl1, но это не было обнаружено в мутантах Δ agl1 или двойных мутантах Δ agl1 Δ gph2 (рисунок S4D).

Δ

agl1 и Δ gph2 мутанты демонстрируют измененный метаболизм гликогена

Чтобы исследовать, затрагивается ли клеточное распределение гликогена у мутантов, несущих целевые делеции AGL1 и GPh2 , мы проанализировали мобилизацию гликогена во время образования Δagl1 , Δgph2 и Δ agl1 Δ gph2 ().Мобилизация гликогена замедлялась у мутантов Δ agl1 и Δ agl1 Δ gph2 , и гликоген не истощался из конидий до 24 часов по сравнению с 8–12 часами у Guy11. Напротив, мутанты Δ gph2 оказались менее подверженными мобилизации гликогена. Эти результаты предполагают, что амилоглюкозидаза более важна для эффективного разложения гликогена во время развития, связанного с инфекцией, чем гликогенфосфорилаза. Это может отражать способность недавно описанной глюкоамилазы выполнять α-1,4-гликозидную активность гликогенфосфорилазы и, таким образом, потенциально компенсировать потерю этой активности [25].Однако гликогенфосфорилаза важна для разрушения мицелиального гликогена, поскольку гликоген накапливается в штаммах Δ gph2 во время роста на минимальной среде (), но не в штаммах Δ agl1 .

Распределение клеток и количественная оценка гликогена во время морфогенеза аппрессория у мутантов Δ agl1 и Δ gph2 M. oryzae .

А . Конидии инкубировали на гидрофобных стеклянных покровных стеклах, чтобы позволить апрессориям развиться до окрашивания раствором йода.Мутанты Δ agl1 и Δ agl1 Δ gph2 были нарушены в мобилизации гликогена из конидия в аппрессорий и в последующей деградации в аппрессории, тогда как мутант Δ gph2 был сравним с Guy11. Шкала шкалы = 10 мкм. В . Количественное определение гликогена в экстрактах мицелия дикого типа и метаболических мутантах гликогена M. oryzae . Штаммы выращивали либо в жидкой CM в течение 48 часов, либо в CM с последующим выращиванием в GMM в течение 16 часов.Культуры собирали, промывали 0,2% CaCl 2 и сушили вымораживанием. Количество гликогена, присутствующего в мицелии -1 нмольмг, оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген. Значения, обозначенные разными буквами (a, b,), статистически значимы при p <0,01. С . Тесты роста, чтобы показать использование крахмала и гликогена в качестве единственных источников углерода. Минимальную среду, содержащую глюкозу, крахмал или гликоген, засевали мицелиальной пробкой М.oryzae и инкубировали в течение 12 дней. Чашки с крахмалом и гликогеном заливали йодом, чтобы визуализировать разницу в использовании субстрата. Йод окрашивает крахмал в синий цвет, а гликоген в коричневый цвет. У мутантов гликогена была нарушена их способность использовать как крахмал, так и гликоген в качестве единственного источника углерода.

Чтобы определить, способны ли мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 использовать внешний гликоген в качестве единственного источника углерода, мы провели тесты роста на различных источниках углерода.Оба мутанта Δ agl1 и Δ gph2 вместе с двойным мутантом Δ agl1 Δ gph2 были способны утилизировать глюкозу, но их рост был нарушен на гликогене и крахмале (). Повторное введение AGL1 и GPh2 в соответствующие нуль-мутанты дополняло мутантный фенотип (рисунок S5). Мы пришли к выводу, что мутанты Δ agl1 и Δ gph2 обладают нарушенной способностью использовать как крахмал, так и гликоген в качестве единственного источника углерода.

Agl1 и Gph2 локализуются в цитоплазме конидий, аппрессорий и инвазивных гиф

Для определения субклеточного расположения Agl1p и Gph2p во время образования аппрессория, AGL1: GFP и GPh2: GFP экспрессировали слияниями генов Guy11. . Слияния Agl1-GFP и Gph2-GFP локализуются по всей цитоплазме в конидиях Guy11 и внутри зародышевых трубок и возникающих аппрессорий к 2 часам и 4 часам соответственно (). Через 8 часов флуоресцентный сигнал наблюдался преимущественно в развивающемся апрессории, а через 24 часа Agl1-GFP и Gph2-GFP были обнаружены исключительно в цитоплазме апрессория.Интересно, что Agl1-Gfp и Gph2-Gfp также были высоко экспрессированы во время заражения растений через 36 часов и локализовались в цитоплазме внутриклеточных инвазивных гиф грибов (2).

Локализация Agl1-GFP и Gph2-GFP на разных стадиях морфогенеза аппрессория и в росте planta с помощью M. oryzae .

А . Конидиям давали возможность сформировать аппрессории, и локализацию Agl1-GFP и Gph2-GFP наблюдали в течение 24 часов с использованием инвертированного эпифлуоресцентного микроскопа Olympus IX-81, снабженного камерой HQ 2 .Слитые белки были локализованы в цитоплазме в конидиях, зародышевой трубке и апрессории. Шкала шкалы = 10 мкм. В . Конидии собирали из штаммов Agl1-GFP и Gph2-GFP и инкубировали на оболочке рисового листа во влажной камере. Конфокальную систему лазерного сканирующего микроскопа Zeiss LSM510 Meta использовали для наблюдения экспрессии Agl1-GFP и Gph2-GFP в эпидермальной ткани риса через 36 часов после инкубации. Agl1-GFP и Gph2-GFP экспрессировались цитоплазматически в инвазивных гифах. Шкала шкалы = 20 мкм.

М.oryzae Δ agl1 , Δ gph2 , Δ agl1 Δ gph2 мутанты обладают нарушенной способностью вызывать болезнь рисового бласта

Чтобы определить роль AGL1 и gph2 в патогенности GPh2 засевали восприимчивый сорт риса CO-39 и сорт ячменя Golden Promise однородными суспензиями спор каждого мутанта и Guy-11 (). У мутантов Δ agl1 и Δ gph2 количество повреждений уменьшилось на 50.44 ± 6% ( P <0,0001) и 44,7 ± 2,4% ( P <0,001), соответственно, тогда как у штамма Δ agl1 Δ gph2 количество поражений уменьшилось на 75,44 ± 1,4% ( P <0,0001) (). У мутантов не обнаружено дефектов прорастания конидий и образования аппрессориев в условиях отсутствия питательных веществ, и частота образования аппрессориев также не пострадала (данные не показаны). Ранее предполагалось, что распад гликогена может быть значительным в генерации тургора аппрессория [6], [7], [26].Поэтому мы измерили тургор аппрессория у мутантных штаммов Δ agl1 и Δ gph2 , используя анализ зарождающегося циторриза [6]. Несмотря на различия в мобилизации гликогена у мутантных штаммов (), мы не обнаружили существенных различий в тургоре между аппрессориями мутантных штаммов и Guy-11 (не показано). Затем мы использовали анализ эпидермиса лука [27], чтобы определить, может ли наблюдаемое снижение вирулентности быть следствием нарушения функции аппрессория. Однако не наблюдали значительных различий в эпидермальном проникновении между Guy-11 и мутантными штаммами Δagl1 , Δgph2 и Δagl1Δgph2 , которые обычно вырабатывали штыри для проникновения (не показаны).Следовательно, уменьшение образования повреждений, наблюдаемое для Δ agl1 , Δ gph2 и Δagl1Δgph2 , не является следствием пониженного тургорного давления или нарушения функции аппрессора. Чтобы исследовать колонизацию тканей каждым мутантом, был проведен анализ оболочки рисового листа [28]. Мы обнаружили, что мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 не обладают способностью к инвазивному росту внутри клеток риса. Мутанты, метаболизирующие гликоген, образовывали необычные инвазивные гифы, которые были менее выпуклыми и разветвленными, чем обычно ().Мы пришли к выводу, что мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 способны нормально проникать в клетки риса, но не могут эффективно размножаться в тканях риса, что приводит к уменьшению симптомов заболевания.

Анализы заражения и проникновения мутантов Δ agl1 , Δ gph2 и Δ agl1Δgph2 M. oryzae .

А . Пятнадцатидневные проростки риса сорта СО-39 или 8-дневные проростки ячменя Golden Promise опрыскивали конидиальной суспензией из 5 × 10 -4 спор спор -1 мл и инкубировали при 24 ° C. при сильном освещении и влажности 90% в течение 5 дней.Показанные листья представляют типичные симптомы, связанные с каждым штаммом. Эксперимент был повторен шесть раз с аналогичными результатами. Столбчатые диаграммы показывают плотности поражений, полученные на инфицированных листьях риса, выбранных случайным образом. Односторонний анализ ANOVA показал, что у мутантных штаммов была значительная недостаточность их способности вызывать болезнь рисового бласта. Значения, обозначенные разными буквами (a, b, c), статистически значимы при p <0,01. В . Для исследования инвазии в ткани хозяина конидии инкубировали на оболочке рисового листа в течение 36 часов и наблюдали с помощью лазерной конфокальной микроскопии.Штамм дикого типа Guy11 показал рост с инвазивными луковичными и разветвленными гифами. Мутанты по метаболизму гликогена продуцировали менее луковичные и разветвленные инвазивные гифы внутри рисовых клеток. Шкала шкалы = 20 мкм.

Идентификация гена, кодирующего гликоген-синтазу

M. oryzae

Учитывая важность мобилизации гликогена для вирулентности, мы решили создать штамм M. oryzae , запасы гликогена истощены. Предполагаемый ген, кодирующий гликоген-синтазу, был идентифицирован из M.База данных генома oryzae (http://www.broadinstitute.org/annotation/fungi/magnaporthe/) с использованием алгоритма BLASTX [29], основанного на его предсказанной аминокислотной гомологии с гликоген-синтазами дрожжей и млекопитающих. Одна последовательность, MGG_07289.6, выровнена с гликогенсинтазами дрожжей и млекопитающих [30], [31]. Предсказанный ген, кодирующий гликоген-синтазу, который мы назвали GSN1 , присутствует как единичный ген в геноме M. oryzae и, по прогнозам, содержит пять экзонов, прерванных четырьмя интронами [29].Предсказанный ген кодирует белок из 708 аминокислот и показал высокое сходство последовательностей с Gsy1p и Gsy2p дрожжей [30] и Gys1p и Gys2p специфичных для мышц и печени форм гликогенсинтазы человека [31]. На рисунке S6 показан результат выравнивания ClustalW [32]. S. cerevisiae Gsy1 и Gsy2 показали 63% и 64% идентичности с M. oryzae GSN1 , соответственно, тогда как Homo sapiens Gys1 и Gys2 показали идентичность 60% и 55% соответственно. Сайты фосфорилирования, предположительно участвующие в посттрансляционной регуляции Gsy2p, консервативны в M.oryzae Гсн1п. В Gsy2p три сайта фосфорилирования присутствуют в S650, S654 и T667 на C-конце [33], тогда как в Gsn1p предсказанные остатки присутствуют в положениях S632, S636 и T645 на C-конце, как показано на дополнительном рисунке S5.

Синтез гликогена не влияет на патогенность

M. oryzae

Для создания нулевого мутанта Δ gsn1 M. oryzae , целевую замену гена GSN1 проводили с использованием метода делеции гена маркера расщепления (рисунок S6A) [25].Конструкции с делецией генов трансформировали в Guy11, и предполагаемые трансформанты подвергали скринингу на основании их устойчивости к гигромицину B (фигура S7). У мутантов Δ gsn1 отложения гликогена не могли четко наблюдаться (), в отличие от Guy11 (). Для дальнейшего исследования мы измерили гликоген с помощью ферментативного анализа и наблюдали значительное снижение ( P <0,01) гликогена в клетках мутанта Δ gsn1 (). Мы пришли к выводу, что синтез гликогена серьезно нарушен как в конидиях, так и в аппрессориях в отсутствие гена гликогенсинтазы GSN1 .

Распределение гликогена в клетках во время морфогенеза аппрессория у мутанта гликоген-синтазы Δ gsn1 из M. oryzae .

А . Конидиям давали возможность образовать аппрессории, а затем проводили окрашивание раствором йода. Отложения гликогена отсутствовали в конидиях и на всем протяжении развития аппрессория. Шкала шкалы = 10 мкм. В . Анализы заражения мутантами Δ gsn1 . Споры собирали из 12-дневных культур Guy11 и мутанта Δ gsn1 и инокулировали распылением в концентрации 5 × 10 4 конидий мл -1 на 3-недельные проростки риса и 8-дневные проростки. рассада ячменя.Растения инокулировали при 24 ° C, сильном освещении и влажности 90% в течение пяти дней. Листья собирали и оценивали на наличие симптомов взрыва риса. Не наблюдалось очевидной разницы между патогенностью штамма Guy11 дикого типа и мутанта гликоген-синтазы Δ gsn1 . Эксперимент повторяли три раза с идентичными результатами, и не наблюдали статистически значимых различий в плотности или степени поражения (не показано). C. Количественное определение гликогена в конидиях дикого типа и мутантах гликогенсинтазы M.oryzae . Конидии собирали с 12-дневных чашек дикого типа и двух мутантов с делецией Δ gsn1 и разбавляли до концентрации 1 × 10 6 мл -1 . Количество гликогена в конидиях -1 мг / мл оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген (+). Также показано количество глюкозы без добавления ферментов, расщепляющих гликоген (-). Значения с разными буквами (a, b,) статистически значимы при p <0.01.

Изучить роль GSN1 в прогрессировании болезни рисовой пигментации, проростков риса CO-39 и ячменя сорта. Каждый Golden Promise был инокулирован мутантом гликогенсинтазы Δ gsn1 и штаммом дикого типа Guy11. Мутант Δ gsn1 был способен вызывать симптомы болезни рисового бласта, которые были идентичны штамму дикого типа, из которого можно сделать вывод, что этот ген является незаменимым для заражения рисовым бластом как у риса, так и у ячменя ().Мы пришли к выводу, что синтез гликогена в качестве запасного продукта в спорах у M. oryzae не является существенным для патогенности.

Δ

agl1 , Δ gph2 и Δ agl1 Δ gph2 мутанты влияют на синтез трегалозы

Мы были заинтригованы, обнаружив, что нарушение синтеза гликогена не влияет на вирулентность M. oryzae. при условии, что оба мутанта Δ agl1 и Δ gph2 показали такие выраженные дефекты в их способности вызывать болезнь рисового взрыва.Поэтому мы решили определить, были ли другие биохимические различия очевидны у любого из метаболических мутантов гликогена. Интересно, что мы наблюдали, что оба мутанта Δ agl1 и Δ gph2 показали пониженные уровни трегалозы во время вегетативного роста на CM (). Это предполагает, что в M. oryzae предшественники трегалозы, по крайней мере, во время роста мицелия, могут быть получены в результате деградации гликогена или на них влияет потеря активности этих ферментов. Поэтому мы проанализировали экспрессию TPS1 и TPS3 в мутантах Guy11, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 . TPS1 кодирует трегалозо-6-фосфат (T6P) синтазу, а TPS3 кодирует субъединицу комплекса T6P-синтаза / трегалоза фосфатаза [34]. Экспрессия TPS1 была снижена в 5 раз у мутантов Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 по сравнению с Guy11 (), тогда как экспрессия TPS3 была снижена в 6 раз при Δ . agl1 , 9 раз в Δ gph2 и в 50 раз в мутанте Δ agl1 Δ gph2 ().Мы также исследовали экспрессию гена RSY1 , участвующего в пути биосинтеза меланина [35], поскольку известно, что TPS1 регулирует экспрессию нескольких генов, связанных с вирулентностью, включая гены биосинтеза меланина, через генетический ген TPS1 / NMR . переключатель [11]. Экспрессия RSY1 также подавлялась в независимых одиночных и двойных мутантах (не показаны).

Анализ синтеза трегалозы у метаболических мутантов гликогена M.oryzae .

А . Количественное определение трегалозы в экстрактах мицелия. Штаммы выращивали либо в жидкой CM в течение 48 часов, либо в CM с последующим выращиванием в GMM в течение 16 часов. Культуры собирали, промывали 0,2% CaCl 2 и сушили вымораживанием. Экстракты мицелия получали с метилендихлоридом и метанолом и анализировали на трегалозу. Уровни трегалозы были значительно снижены у мутантов метаболизма гликогена по сравнению с Guy11. Эксперимент был повторен трижды с аналогичными результатами.Значения, обозначенные разными буквами (a, b, c, d), статистически значимы при p <0,01. В . Анализ экспрессии генов TPS1 и C . TPS3 в мицелии с помощью сравнительной количественной ОТ-ПЦР в реальном времени. Уровни транскриптов TPS1 , TPS3 были подавлены у мутантов, метаболизирующих гликоген. Эксперимент повторяли дважды, каждый с тремя техническими повторами, с аналогичными результатами. Односторонний анализ ANOVA показал, что мутантные штаммы имели значительные дефекты в экспрессии гена биосинтеза трегалозы.Обилие транскриптов показано относительно экспрессии гена M. oryzae β -тубулина (MGG_00604). Значения, обозначенные разными буквами (a, b, c, d), статистически значимы при p <0,01.

Делеция

NMR3 частично восстанавливает Δ agl1 Δ gph2 фенотип двойного мутанта

Известно, что M. oryzae Tps1 действует как G6P-чувствительный белок, напрямую связываясь с G6P и NADPH для контроля экспрессии набор ассоциированных с вирулентностью генов, экспрессируемых при заражении растений [11].Мы предположили, что если гены метаболизма гликогена ( AGL1 и GPh2 ) регулируют экспрессию TPS1 во время инфекции, то делеция одного из генов ингибитора транскрипции, который, как было показано, взаимодействует с Tps1p, может частично компенсировать фенотипические дефекты, связанные с Δ agl1 Δ gph2 двойной мутант [11]. Делеции NMR1 , NMR2 или NMR3 , например, было показано, что достаточно для восстановления патогенности мутанта Δ tps1 [11].Поэтому мы провели целенаправленную делецию гена NMR3 в двойном мутанте Δ agl1 Δ gph2 , поскольку двойные мутанты Δ tps1 Δ nmr3 показали максимальное восстановление патогенности [11]. Мы использовали стратегию расщепления маркеров для нацеливания на локус NMR3 для делеции гена, как показано на рисунке S8A. [25]. После трансформации трансформантов M. oryzae были первоначально проверены на устойчивость к биалафосу [36], и делеция была подтверждена с помощью гель-блоттинга ДНК (рис. S8B).

Для проверки вирулентности Δ agl1 Δ gph2 Δ nmr3 на восприимчивом сорте риса CO-39 был проведен анализ патогенности с использованием Guy11, Δ agl1 Δ gph2. agl1 Δ gph2 Δ nmr3 мутант. Мы обнаружили, что делеция гена NMR3 восстанавливала способность мутанта Δ agl1 Δ gph2 вызывать бластную болезнь, как показано на рис. Не наблюдалось существенной разницы в количестве повреждений между Guy11 и Δ agl1 Δ gph2 Δ nmr3 при заражении риса ( P <0.05) или инфекции ячменя (). Мы пришли к выводу, что AGL1 и GPh2 могут влиять на работу Tps1-опосредованного механизма регуляции гена, который необходим для болезни рисового бласта.

Анализ рисового бласта Δ agl1 Δ gph2 и Δ agl1 Δ gph2 Δ nmr3 мутанта M. oryzae .

А . 3-недельные проростки риса сорта СО-39 опрыскивали суспензией спор 5 × 10 4 спор -1 мл и инкубировали в течение 5 дней при 24 ° C. В . Поражения оценивали на случайно выбранных инфицированных листьях. Показанные листья представляют типичные симптомы, связанные с каждым испытанным штаммом. Эксперименты повторяли шесть раз с идентичными результатами. У Δ agl1 Δ gph2 Δ nmr3 была частично восстановлена ​​его способность вызывать бластную болезнь. Значения, обозначенные разными буквами (a, b), статистически значимы при p <0,01. C. 8-дневные проростки ячменя Golden Promise опрыскивали конидиальной суспензией из 5 × 10 -4 спор спор -1 мл и инкубировали при 24 ° C, сильном освещении и влажности 90% в течение 5 дней.Показанные листья представляют типичные симптомы, связанные с каждым штаммом. Эксперимент был повторен трижды с аналогичными результатами.

Обсуждение

В этом исследовании мы намеревались изучить роль метаболизма гликогена в возникновении болезни рисового бласта, вызываемой M. oryzae . Предыдущие сообщения установили, что мобилизация гликогена происходит во время развития аппрессория и может зависеть от cAMP-зависимой протеинкиназы A и путей передачи сигналов MAP kinase Pmk1 [7].Запасы гликогена в аппрессории также были предложены в качестве потенциального субстрата для производства глицерина в аппрессории, способствуя генерации тургора для разрыва кутикулы растения [6], [7], [26]. Запасы гликогена в аппрессориях, например, явно используются во время созревания аппрессориев до заражения растений [26]. При совместном рассмотрении результаты, представленные в этом исследовании, свидетельствуют о том, что деградация цитозольного гликогена в M. oryzae , которая требует гликогенфосфорилазы и амилоглюкозидазы, играет важную роль в вирулентности этого гриба.Этот вывод основан на мутантных фенотипах Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 двойных мутантов, у которых нарушена их способность вызывать бластную болезнь. Однако кажется вероятным, что влияние на вирулентность является плейотропным, а не специфически связанным с использованием резервов гликогена, поскольку мутанты Δ gsn1 , запасы гликогена которых значительно уменьшены из-за отсутствия активности гликогенсинтазы, не подвержены вирулентности.Этот результат предполагает, что запасы гликогена в конидиях и аппрессориях не обязательны для генерации тургора аппрессория и заражения растений. Представленные здесь данные также предполагают, что потеря GPh2 и AGL1 снижает экспрессию TPS1 , который, как известно, интегрирует контроль углеродного и азотного метаболизма в M. oryzae в ответ на уровни G6P и NADPH / NADP [11] .

В начале этого исследования мы были особенно заинтересованы в понимании того, как мобилизация гликогена происходила во время развития аппрессория M.oryzae . Поэтому изначально мы провели цитологический и биохимический анализ, чтобы изучить движение и распад запасов гликогена. Результаты этих экспериментов согласуются, показывая, что гликоген быстро разлагается во время прорастания конидий и что этот процесс замедляется у мутантов Δ cpkA , лишенных каталитической субъединицы протеинкиназы A. Наоборот, Δ mac1 sum1-99 мутант, шунтирующий супрессор нулевого мутанта аденилатциклазы, который несет мутацию в цАМФ-связывающем кармане регуляторной субъединицы протеинкиназы A [16], демонстрирует неправильную регуляцию хранения гликогена в споре.Это согласуется с более ранними предположениями, основанными исключительно на микроскопии [7], что мутанты Δ mac1 sum1-99 ускоряют распад гликогена и липидов. Взятые вместе, эти наблюдения предполагают, что путь ответа цАМФ играет важную роль в регуляции цитозольного метаболизма гликогена.

Чтобы исследовать роль распада гликогена в заражении растений M. oryzae , мы создали мутанты с делецией гена, лишенные активности ферментов амилоглюкозидазы и гликогенфосфорилазы.Фенотипический анализ показал, что двойные мутанты Δ agl1 и Δ agl1 Δ gph2 имели серьезные дефекты в расщеплении гликогена в конидиях, и через 24 часа розетки гликогена оставались видимыми в конидиях обоих мутантных штаммов. Гиперакопление гликогена ранее наблюдалось у мутантов Δ agl1 и Δ gph2 S. cerevisiae . [37], [38], демонстрируя важность этих ферментов для использования запасов гликогена.Предыдущее сообщение показало, что вакуолярная глюкоамилаза, Sga1, в M. oryzae может вносить вклад в утилизацию гликогена во время конидиогенеза [39]. Мутанты, лишенные активности Sga1, показали пониженную конидиацию, что согласуется с ролью вакуолярного аутофагического гидролиза гликогена во время развития спор. Интересно отметить, что мутанты Δ sga1 , однако, не проявили какого-либо влияния на развитие или патогенность аппрессоров [39], предполагая, что M. oryzae может разлагать гликоген посредством вакуолярного аутофагического механизма во время развития спор, но в основном цитозольный путь во время спор. прорастание и развитие аппрессориев, даже несмотря на то, что большой всплеск аутофагии связан с прорастанием конидий, запрограммированной гибелью клеток и созреванием аппрессориев [3], [5].Слияния генов Agl1-GFP и Gph2-GFP, например, подтвердили, что оба фермента локализованы в цитоплазме внутри конидий, зародышевых трубок и аппрессорий.

Фенотипы мутантов Δ agl1 и Δ gph2 согласуются с мобилизацией и использованием гликогена, оказывающими значительное влияние на способность M. oryzae вызывать болезнь, вызываемую грибковой инфекцией риса. Однако делеция GSN1 , который кодирует гликогенсинтазу, привела к значительному снижению уровней гликогена в клетках, но не оказала никакого влияния на патогенность M.oryzae .. Липиды, гликоген и трегалоза являются основными запасами питательных веществ, используемых конидиями M. oryzae для прорастания и дифференциации аппрессориев (см. обзор [2]). Основываясь на результатах, представленных здесь, кажется, что использование гликогена не может быть таким значительным фактором созревания апрессория, как гидролиз триацилглицерина [9]. Активность триацилглицерин липазы, например, индуцируется во время развития аппрессория у M. oryzae . [7].

Наиболее значимый вывод, который мы можем сделать относительно роли AGL1 и GPh2 в патогенности M.oryzae заключается в том, что отсутствие этих ферментных активностей снижает экспрессию гена TPS1 . Из M. oryzae известно, что активность Tps1 важна для болезни рисового бласта и формирует NADPH-зависимый генетический переключатель [11]. Мутанты, лишенные Tps1, способны продуцировать аппрессории, но они нефункциональны, и гриб не может колонизировать ткани риса [40]. Мутант Δ tps1 не продуцирует трегалозу или ее промежуточный трегалозо-6-фосфат (T6P), но нарушение патогенности происходит не просто из-за потери биосинтеза трегалозы.Мутации в G6P-связывающих карманах Tps1, например, сделали гриб непатогенным, в то время как мутации в каталитических сайтах, необходимых для синтеза T6P, не повлияли на его роль в заболевании, вызванном грибковой инфекцией риса, что позволяет предположить, что потеря связывания G6P связана с потерей патогенности [12]. Tps1 объединяет использование источников углерода и азота, а мутанты Δ tps1 неспособны расти на нитрате из-за воздействия на активность нитратредуктазы (NR) [34]. НАДФН является кофактором нитратредуктазы и обеспечивает восстанавливающую способность.Достаточные пулы НАДФН необходимы для функции NR и вырабатываются окислительным пентозофосфатным путем посредством активации дегидрогеназы G6P (G6PDH). Было показано, что как уровни НАДФН, так и активность G6PDH снижены у мутантов Δ tps1 , что указывает на то, что экспрессия G6PDH находится под контролем Tps1 [34]. Сверхэкспрессия G6PDH восстанавливает дефект патогенности мутантов Δ tps1 , а недавно было показано, что Tps1 непосредственно связывается с NADPH, что указывает на более широкую регуляторную роль в использовании углерода и азота [11].Также было показано, что Tps1 является позитивным регулятором трех факторов транскрипции GATA в процессе, который негативно регулируется тремя NADP-зависимыми белками-ингибиторами Nmr. Факторы транскрипции GATA положительно регулируют экспрессию связанной с вирулентностью экспрессии генов способом, модулируемым активностью белков-ингибиторов ЯМР, и, в конечном итоге, зависят от клеточных уровней NADPH / NADP и G6P [11]. Поразительно, что мы наблюдали, что мутанты Δ agl1 и Δ gph2 уменьшают накопление трегалозы.Более того, гены, кодирующие фермент биосинтеза трегалозы, TPS1 и TPS3 , подавляются у мутантов по метаболизму гликогена. Поэтому мы предположили, что Agl1 и Gph2 могут регулировать экспрессию Tps1 и Tps3. Делеции NMR3 было достаточно для восстановления вирулентности двойного мутанта Δ agl1 Δ gph2 , хотя и с небольшими повреждениями. Это предполагает, что метаболизм гликогена может вносить вклад в контроль NADPH-зависимого генетического переключателя Tps1.Это интересно, потому что было показано, что экспрессия гена AGL1 и GPh2 и оборот гликогена затрагиваются в штаммах Δ tps1 [34], что позволяет предположить, что у дикого типа может существовать механизм отрицательной обратной связи для регулирования обмена гликогена в ответ на зондирование G6P. Таким образом, при совместном рассмотрении наше исследование позволило получить фундаментальную новую информацию о роли метаболизма гликогена в грибковом грибке Magnaporthe oryzae . Представленные здесь результаты предполагают, что метаболизм гликогена играет более широкую регуляторную роль, чем первоначально предполагалось, но вряд ли существует прямая потребность в деградации гликогена для подпитки опосредованного аппрессорием проникновения в кутикулу.Вместо этого эффект Agl1p и Gph2p на Tps1-зависимый генетический переключатель предполагает важную и неожиданную регуляторную роль во время инфекции растений.

Материалы и методы

Штаммы грибов и условия культивирования

Изоляты Magnaporthe oryzae , использованные в этом исследовании, хранятся в лаборатории NJT. Описанные мутанты с целевой заменой генов изогены по отношению к рису дикого типа ( Oryza sativa ) патогенный Magnaporthe штамм Guy-11.Состав сред и процедуры для культивирования и поддержания грибов, экстракции нуклеиновых кислот и ДНК-опосредованной трансформации были описаны ранее [41].

Анализ внутриклеточного гликогена

Гликоген в развивающихся аппрессориях визуализировали с помощью йодной окраски, состоящей из 60 мг KI и 10 мг I 2 мл -1 в дистиллированной воде [42]. Свежесобранные конидии в концентрации приблизительно 1 × 10 5 мл -1 инкубировали на гидрофобных пластиковых покровных стеклах либо в стандартной питательной среде (CM) с добавлением 2% дрожжевого экстракта, либо в дистиллированной воде в течение определенного периода времени.Через несколько секунд контакта с желто-коричневым пятном отложения гликогена можно было наблюдать микроскопически. Для измерения количества гликогена, присутствующего на стадиях развития M. oryzae , был разработан протокол, основанный на экспериментах, проведенных на S. cerevisiae . [17], [43] - [46]. Спорулирующие культуры M. oryzae в возрасте 12 дней в возрасте заливали стерильной дистиллированной водой и соскребали стеклянным разбрасывателем. Полученную суспензию фильтровали через стерильный miracloth (Calbiochem) и конидии выделяли центрифугированием при 20 ° C (5000 г , 10 минут).После промывки в дистиллированной воде конидии концентрировали центрифугированием и разбавляли приблизительно до 1 × 10 6 конидий на мл -1 . Образцы разделяли и инкубировали на гидрофобных пластиковых покровных стеклах в течение периодов времени 0, 2, 4, 6, 8, 24 или 48 часов перед переносом в микроцентрифужные пробирки, нагревали до 100 ° C в течение 10 минут для остановки ферментативного действия и охлаждали на льду. . Затем конидии были разрушены с помощью 10-минутной обработки ультразвуком, выполняемой 10-секундными импульсами с использованием ультразвукового устройства Vibracell (Sonics and Materials Inc., Данбери, США). Фрагменты клеток осаждали центрифугированием и 760 мкл супернатанта удаляли в свежую пробирку. К этому добавляли 100 мкл 50 мМ CaCl 2 и 100 мкл 0,5 М NaOAc pH 5,0 вместе со следующими ферментами, которые превращают гликоген в глюкозу: 29 мкл амилоглюкозидазы (Roche, Германия), 10 мкл α-амилазы (Sigma). В контрольном эксперименте эти ферменты были заменены стерильной дистиллированной водой. Реакции инкубировали в течение ночи при 57 ° C при постоянном вращении перед центрифугированием при 5,000 g в течение 3 минут.Для каждой временной точки супернатант из двенадцати аликвот по 50 мкл анализировали с помощью набора для анализа глюкозооксидазы (Sigma Diagnostics), в котором конечная интенсивность цвета пропорциональна концентрации глюкозы. Значения оптической плотности образца измеряли при 450 нм с использованием планшет-ридера Dynex Technologies MRX II (Jencons-PLS). Контроль без добавления фермента использовали для измерения фонового уровня глюкозы. Полный эксперимент проводился в трех биологических повторностях в отдельные дни, и средние уровни гликогена рассчитывались для каждой временной точки.Уровни гликогена анализировали с помощью линейных моделей смешанных эффектов для каждого мутантного штамма индивидуально, с культивированием как случайным эффектом и временем (часами) как фиксированным эффектом. Затем все попарные сравнения были выполнены с помощью тестов Tukey HSD для поддержания общего тестового уровня 5%. Средние значения и различия в средних значениях представлены с 95% семейным доверительным интервалом и скорректированными по Тьюки p-значениями. Пакеты nlme и multcomp в R v2.15 использовались для выполнения статистического анализа.

Идентификация и целенаправленная замена гена

M.oryzae AGL1 и GPh2

Геномная ДНК из M. oryzae была использована для амплификации полимеразной цепной реакции (ПЦР) с праймерами AGL1 ( 5'-GCGTACATGGCCTGCTTTGAACGTA-3 ') и AGL2 ( 5'-TGCTCTGTGTGAGGAGT000), разработанными к консервативным областям последовательности метки экспрессированной последовательности AGL1 (EST) из базы данных Института генетики Университета Клемсона (CUGI) (http://www.genome.clemson.edu/). ПЦР проводили с применением 35 циклов амплификации.После начальной денатурации в течение 5 минут при 94 ° C использовали следующие условия амплификации: 45 секунд денатурации при 94 ° C, 1 минута отжига при 55 ° C, 1 минута элонгации при 72 ° C. Затем следовало последнее 10-минутное удлинение при 72 ° C. Затем полученный фрагмент геномной ДНК размером 513 п.н. использовали для скрининга библиотеки конидиальной кДНК Guy-11 [15]. Истинный стартовый кодон и 5'-последовательность идентифицированной кДНК AGL1 определяли с использованием стратегии 5'-быстрой амплификации концов кДНК (5'-RACE) [47].Скрининг геномной библиотеки λGEM-11 [41] с клоном кДНК AGL1 выявил геномный клон лямбда Kpn I размером 6,5 т.п.н., названный pLh2. Геномную последовательность этого клона получали с использованием стратегии Genome Priming System (GPS). Эта система на основе транспозона Tn7 использует комплекс транспозазы для случайной вставки транспраймера в мишень дцДНК [48], [49]. Производится популяция продуктов, каждый с транспраймером, вставленным в другое место, и уникальные сайты праймирования на конце каждого транспраймера позволяют секвенировать обе нити целевой ДНК в месте вставки.Для замены гена ампликон 6,0 т.п.н., состоящий из ORF AGL1 с 5'-флангом 1,0 т.п.н., был амплифицирован из геномной ДНК M. oryzae Guy-11 с праймерами AGLvectorF ( 5'-CCTGACGGATAATGGTGGGGTG-3 ') и AGLvectorR ( 5'-CTTCGTCCGCAT CCATGTAGAG-3 '), сконструированный для последовательности генома M. oryzae , штамм 70-15 (http://www.genome.wi.mit.edu/annotation/fungi/magnaporthe /). ПЦР выполняли при следующих условиях: начальная 1 минута денатурации при 95 ° C, затем 30 циклов 1 минута денатурации при 95 ° C, 1 минута отжига при 60 ° C и 6 минут элонгации при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон клонировали в вектор pGEM-T (Promega) для создания плазмиды pLh4. Затем pLh4 расщепляли Hin dIII для высвобождения фрагмента 2,8 т.п.н. ORF AGL1 и линеаризованную плазмиду лигировали с генной кассетой фосфотрансферазы Hin dIII, связанной с 1,4 т.п.н. .

Ген M. oryzae GPh2 был идентифицирован аналогично AGL1 .Праймеры GPh2 ( 5'-CTTCCTCCAGTCAGTAGAGCG-3 ') и GPh3 ( 5'-TTTGAGGAAGTCATAGCTACCG-3' ) были сконструированы из консервативных областей генов, кодирующих GPH, с использованием последовательности EST из базы данных CUGI, показывающей высокую степень сходства. к генам гликогенфосфорилазы из S. cerevisiae [50], [51] и другие организмы. Фрагмент длиной 319 п.н. M. oryzae GPh2 амплифицировали с помощью ПЦР-амплификации в следующих условиях: начальная денатурация в течение 5 минут при 94 ° C, затем 35 циклов амплификации, включающих: 45 секунд денатурации при 94 ° C, 1 минуту отжиг при 54 ° C, удлинение в течение 1 минуты 30 секунд при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон очищали в геле, клонировали в вектор pBluescript (Stratagene) и использовали для скрининга библиотеки конидиальной кДНК Guy-11 [15]. 5'-RACE [47] использовали для определения 5'-последовательности и стартового кодона GPh2 с использованием специфичного для гена праймера, сконструированного для последовательности самого длинного клона кДНК. Чтобы сконструировать вектор замены гена GPh2 , ампликон размером 5,1 т.п.н., содержащий ORF GPh2 с приблизительно 1.0 kb, амплифицировали из геномной ДНК M. oryzae с использованием праймеров GPHnestedF ( 5'-GTTGCACTGAACCTCGAGTCTAGA-3 ') и GPHnestedR ( 5'-TTCGCCAAGG ATGCTGGGCTCAAG-3' последовательности 9 штамм M. oryzae 70-15. Стандартный протокол ПЦР был адаптирован для включения системы Taq Plus® Long PCR (Stratagene), предназначенной для амплификации длинных продуктов. Образцы нагревали до 94 ° C в течение 5 минут, затем применяли следующие условия для 35 циклов: 30 секунд денатурации при 94 ° C, 30 секунд отжиг при 55 ° C, удлинение 9 минут при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон размером 5165 п.о. очищали в геле и клонировали в вектор pGEM-T (Promega) для создания плазмиды pLh5. Расщепление pLh5 с помощью Bst BI высвободило фрагмент гена размером 2,2 т.п.н., который был заменен кассетой гена Hph , связанной 1,4 т.п.н. Bst BI, связанной с 1,4 т.п.н., для создания вектора делеции гена pLh5 H . Плазмиды pLh4 H и pLh5 H трансформировали в штамм M. oryzae Guy-11.Вставка одной копии плазмидной ДНК была подтверждена для всех трансформантов с помощью гель-блоттинга ДНК.

Нацеленная замена гена AGL1 в штамме Δ gph2 маркером устойчивости к сульфонилмочевине, ILV1 , для генерации Δ agl1 Δ gph2 с использованием стратегии гена-маркера расщепления (Catlett et al. , 2003). Замена была достигнута путем замены 1 т.п.н. 5'-открытой рамки считывания AGL1 геном ILV1 размером 2,8 т.п.н.В первом раунде ПЦР 1 т.п.н. фланкирующей последовательности с каждой стороны кодирующей области гена (названной LF и RF) амплифицировали с использованием праймеров Agl1-50.1 / Agl1-m13F и Agl1-30.1 / Agl1-m13R в комбинации, с использованием геномной ДНК Guy11. Agl1-m13F и Agl1-m13R имеют дополнительные 5'-последовательности, соответствующие праймерам M13F / M13R. Эта дополнительная последовательность облегчила проведение ПЦР с перекрытием слияния во втором раунде. В параллельной реакции селектируемый маркер ILV1 амплифицировали в двух частях с использованием праймеров M13F / SUR-F и M13R / SUR-R из кассетного гена устойчивости к сульфонилмочевине [36], а затем клонировали в pBluescript (Stratagene).Эти два продукта были названы IL и LV из гена ILV1 . Первую ПЦР проводили в следующих условиях цикла в градиентном цикле Applied Biosystems GeneAmp PCR System: этап начальной денатурации при 94 ° C в течение 5 минут, за которым следовали 35 циклов параметров цикла ПЦР, 94 ° C в течение 30 секунд, 62 ° C или 30 секунд и 72 ° C в течение 1 минуты с последующим окончательным удлинением при 72 ° C в течение 10 минут. Каждая реакция ПЦР на 25 мкл содержала 1 мкл ДНК-матрицы (50 нг), 20 пмоль каждого праймера, от 2 до 4 мМ MgCl 2 ,2.5 мкл термофильного 10-кратного реакционного буфера без MgCl 2 (500 мМ KCl, 100 мМ Tris-HCl [pH 9 при 25 ° C] и 1% Triton X-100), 2 мМ всех четырех дезоксинуклеозидтрифосфатов (dNTPs, Amersham BioSciences), 0,3 мкл Taq и 0,2 мкл ДНК-полимеразы Pfu . Полученный продукт анализировали гель-электрофорезом и очищали в геле. Во втором раунде ПЦР каждый фланг сливали с одной половиной селектируемого маркера (LF / IL и RF / LV) с использованием вложенных праймеров Agl1-nesF / IL, расщепления и Agl1-NesR / LV.Условия были установлены как начальная денатурация при 94 ° C в течение 5 минут с последующими 35 циклами параметров цикла ПЦР, 94 ° C в течение 30 секунд, 62 ° C в течение 30 секунд, 72 ° C в течение 3 минут, с последующим окончательным продлением при 72 ° C в течение 10 мин. Полученный продукт анализировали гель-электрофорезом и очищали в геле, готовым к грибковой трансформации. Гомологичная рекомбинация между перекрывающимися областями селектируемого маркера и хромосомной ДНК приводит к целенаправленной делеции гена [25]. Трансформанты подвергали скринингу с помощью ДНК-блоттинга.Последовательности праймеров, использованных в исследовании, показаны в таблице S1.

Анализы активности ферментов

Потеря активности амилоглюкозидазы в штаммах Δ agl1 и потеря активности гликогенфосфорилазы в штаммах Δ gph2 была подтверждена ферментативно с использованием белков, экстрагированных из Δ agl1 и Δ gph2, сравниваемых штаммов. к Guy11. Штаммы выращивали в GMM в течение 16 часов с последующей сушкой вымораживанием и подготовкой образцов, как описано ранее [12].Вкратце, 10 мг высушенного мицелия на штамм в трех экземплярах были тонко измельчены и повторно суспендированы в 1 мл стерильной дистиллированной H 2 O. Каждый образец был мгновенно заморожен в жидком азоте для разрушения мицелиальных клеток и высвобождения всех клеток. белок и центрифугировали 3 мин. После центрифугирования образцы хранили на льду. 50 мкл этого раствора, содержащего общий клеточный белок, аспирировали в трех экземплярах из каждого образца и добавляли к 1 мл каждого ферментного анализа. Все ферментные анализы проводили при 22 ° C.Все компоненты анализа были приобретены у Sigma. Активность ферментов определяли спектрофотометрически в трех экземплярах и выражали как концентрацию продукта, образованного за одну минуту общим клеточным белком из 1 мг мицелия. Активность амилоглюкозидазы [52] определяли путем инкубации 50 мкл каждого раствора общего клеточного белка с 1% раствором крахмала, избытком очищенной гексокиназы и избытком очищенной глюкозо-6-фосфатдегидрогеназы. Agl1 в образце белка высвобождает глюкозу из крахмала, который фосфорилируется гексокиназой, и образующийся глюкозо-6-фосфат используется для генерации НАДФН из НАДФ с использованием глюкозо-6-фосфатдегидрогеназы.Скорость увеличения НАДФН по мере продвижения ферментного анализа, измеренная спектрофотометрически при A 340 и сравниваемая со скоростью продукции НАДФН в анализах, не содержащих крахмала или экстракта вареного мицелиального белка, была измерена для расчета активности Agl1 в каждом образце. Для определения активности гликогенфосфорилазы [52] 50 мкл белкового экстракта из каждого образца добавляли к 1 мл ферментного анализа в трех экземплярах. Каждый анализ содержал 4% гликогена, избыток очищенной фосфоглюкомутазы и избыток очищенной глюкозо-6-фосфатдегидрогеназы.Gph2 высвобождает глюкозо-1-фосфат из гликогена, который фосфоглюкомутазой превращается в глюкозо-6-фосфат. Глюкозо-6-фосфатдегидрогеназа преобразовывала НАДФ в НАДФН с использованием глюкозо-6-фосфата, и скорость увеличения НАДФН по мере продвижения ферментативного анализа, измеренная при A 340 и по сравнению с контрольными реакциями без гликогена или белкового экстракта, использовалась для расчета активность Gph2 в каждом образце. Протоколы были получены с веб-сайта Sigma (www.sigma.com). Концентрации трегалозы измеряли, как описано ранее [12].Вкратце, образцы обрабатывали треалазой для высвобождения глюкозы из трегалозы, а глюкозу измеряли с использованием избытка очищенной гексокиназы для образования глюкозо-6-фосфата, который использовался избытком глюкозо-6-фосфатдегидрогеназы для образования НАДФН из НАДФ. Количество НАДФН, образованного в образцах, обработанных треалазой, по сравнению с теми же образцами, не обработанными треалазой, измеряли по A 340 и рассчитывали количество трегалозы в каждом образце.

Создание конструкции слитой плазмиды Agl1: sGFP

Ген AGL1 амплифицировали из геномной ДНК изогенного штамма Guy11 дикого типа с праймерами Agl1-Pro-U / Agl1-Fus-D, 2.Аллель гена ацетолактатсинтазы размером 8 т.п.н. ( ILV1 ), придающий устойчивость к сульфонилмочевине, был амплифицирован с праймерами Sur-U / Sur-D из pCB1532 [36], а 1,4 т.п.н. sGFP: trpC амплифицирован с праймерами GFP-U / TrpC-D. из pNOX1sGFP. Последовательности праймеров показаны в дополнительной таблице S1. Фрагменты ПЦР трансформировали дрожжами pNEB1284 Spe I / Hin dIII в S. cerevisiae . Слияние генов было сконструировано путем клонирования с восстановлением разрывов в дрожжах на основе гомологичной рекомбинации в дрожжах [53].Полученную плазмиду трансформировали в изогенный штамм дикого типа Guy11.

Создание конструкции слитой плазмиды Gph2: sGFP

Ампликон 4,1 т.п.н., состоящий из промотора M. oryzae GPh2 и открытой рамки считывания, амплифицировали с помощью ПЦР из геномной ДНК Guy11 с праймерами Gph2-P-SacII и Gph2-SpeI-D и клонировали в pGEM®-T (Promega). Фрагмент вырезали с помощью сайтов рестрикции Sac II / Spe I и клонировали в pCB1532, состоящую из аллеля гена устойчивости к сульфонилмочевине (ацетолактатсинтаза или ILV1 ), для получения pGPh2.Фрагмент 1,4 т.п.н. кассеты sGFP: trpC (Chiu et al. , 1996) амплифицировали с помощью ПЦР с использованием праймеров GFP-SpeI-U и TrpC-ClaI-D (дополнительная таблица S1) и затем клонировали в pGPh2 с Spe I ограничивающие сайты для создания слияния pGPh2sGFP. Плазмиду слияния трансформировали изогенным Guy11 из M. oryzae .

Фенотипический анализ мутантов

Для определения скорости вегетативного роста диаметр колонии измеряли через 12 дней роста на полной среде [41].Частоту и характер прорастания конидий и образования аппрессориев определяли микроскопически путем подсчета количества зародышевых трубок и / или аппрессорий, образовавшихся из конидий после инкубации на гидрофобных пластиковых покровных стеклах в течение различных периодов времени.

Мобилизацию гликогена визуализировали под микроскопом, как описано выше.

Влияние делеции каждого гена на патогенность грибов определяли путем распыления 5 × 10 4 спор / мл на чувствительные к CO-39 линии риса и восприимчивые линии ячменя Golden Promise, как описано ранее [41].

Для исследования генерации аппрессорного тургора был использован метод зарождающегося циторриза (клеточного коллапса) [54], [55]. Конидии в концентрации 2 × 10 4 мл -1 инкубировали на гидрофобных пластиковых покровных стеклах для индукции образования аппрессория. Затем удаляли окружающую воду и заменяли равным объемом раствора глицерина в диапазоне концентраций от 0,5 до 5,0 М. После 10 минут инкубации регистрировали количество разрушившихся аппрессорий.Проникновение аппрессорий в кутикулу изучали с помощью эпидермального пилинга лука, как описано Chida and Sisler (1987). Конидиям с концентрацией 5 × 10 4 спор / мл позволяли прорасти на эпидермисе лука, и скорость успешного апрессориум-опосредованного проникновения в эпидермис оценивали с помощью световой микроскопии. Все эксперименты проводили в трех повторностях.

Аппрессориум-опосредованное проникновение в оболочку рисового листа оценивали с использованием процедуры, основанной на процедуре Канканала и др. , 2007 [28].Конидиальную суспензию с концентрацией 1 × 10 5 спор мл -1 собирали в 0,25% желатине и инокулировали на оболочки листьев над средней жилкой. Инокулированные оболочки оставляли во влажных чашках Петри на 24, 36 и 48 ч в горизонтальном положении, чтобы суспензия оставалась на среднем участке вены. Когда они были готовы к микроскопии, оболочки были обрезаны вручную, чтобы удалить боковые стороны и нижнюю поверхность, чтобы обнажить одноклеточный эпидермальный слой средней вены (толщиной 2–3 клетки).Этот эпидермальный слой помещали на предметное стекло и наблюдали с помощью системы сканирующего конфокального света (CLSM) Zeiss LSM510 Meta.

Целенаправленная замена гена

GSN1 и NMR3

Нацеленная замена гена GSN1 и NMR3 была проведена в Guy11 и Δ agl1 Δ gph2 , соответственно, с использованием стратегии расщепленных маркеров, как объяснялось ранее, где GSN1 был заменен на резистентность к гигромицину B. Маркер hph и NMR3 был заменен селективным маркером устойчивости к биалафосу bar .Последовательности праймеров, использованных в исследовании, показаны в дополнительной таблице S1. После трансформации трансформанты подвергали скринингу в присутствии гигромицина B (200 мг / мл -1 ) на устойчивость к гигромицину и глюфосината аммония (100 мг / мл -1 ) на устойчивость к баялафосу. Замены генов подтверждали анализом ДНК-блоттинга.

Анализ экспрессии генов

Количественная ОТ-ПЦР была использована для характеристики экспрессии генов TPS1 и TPS3 у Guy-11, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2.Для анализа экспрессии генов мицелия, выращенного в полной среде, изогенный Guy-11 дикого типа, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 был инокулирован в CM 48 часов с последующей экстракцией РНК [41] , синтез кДНК и анализ QRT-PCR. Синтез кДНК выполняли с использованием набора для синтеза кДНК AffinityScript QPCR (Stratagene) в соответствии с протоколом производителя. Анализ экспрессии генов выполняли с использованием набора Brilliant Green QPCR Master Mix от Stratagene и прибора MX3005P (Stratagene) в соответствии с протоколом производителя.Экспрессию TPS1 , TPS3 и RSY1 анализировали с использованием праймеров Tps1-qRT-5 '( 5'-CTTATCGTCAACCCCTGGAAC-3' ) и Tps1-3 '( 5'-TCCCTTCCGTCTTC ), Tps3-qRT-5 '( 5'-CACATCAACGACGCCTGCGA-3 ) и Tps3-3' ( 5'-ATGTAGCTCTTGCCTCTGTGTT-3 ') и Rsy1-qRT-5' ( 5'CGAGTC ) и Rsy1-qRT-3 '( 5'-TTATTTGTCGCCAAAGGTCTCC-3' ). Экспрессия была нормализована относительно β-тубулина (MGG_00604.6) экспрессия гена с использованием праймеров QRT.PCR.BTubF ( CGCGGCCTCAAGATGTCGT ) и QRT.PCR.BTubR ( GCCTCCTCCTCGTACTCCTCTTCC ). Условиями ПЦР были 94 ° C в течение 30 секунд, 62 ° C в течение 30 секунд и 72 ° C в течение 30 секунд.

Дополнительная информация

Рисунок S3

Нацеленная делеция гена AGL1 и GPh2 в M. oryzae Guy11. А . Организация AGL1 , показывающая сайты рестрикции и ориентацию кодирующей области. В . Целевые векторы для замены гена с делецией гена AGL1 , демонстрирующие образование нулевых мутантов. С . ДНК-гель-блоттинг-анализ мутантов M. oryzae Δ agl1 . ДНК расщепляли Nhe I, фракционировали, блотировали и зондировали с помощью 2,8 т.п.н. Hin dIII- Hin dIII AGL1 удаленный фрагмент, 1,7 кб Hin dIII- Hin dIII AGL1 фрагмент промотора или кассету 1,4 кб Hph .Дорожка 1, Guy11; Дорожка 2–5, Δ agl1 мутанты; Дорожки 6 и 7, эктопические трансформанты agl1 . Д . Организация локуса ГПх2 Е . Целевые векторы для замены гена для делеции гена GPh2 , показывающие и генерирующие нулевые мутанты F . ДНК-гель-блот-анализ мутантов M. oryzae Δ gph2 . ДНК расщепляли Sph I, фракционировали, блотировали и зондировали удаленным фрагментом GPh2 в 2,2 т.п.н., a 1.Фрагмент промотора GPh2 размером 4 т.п.н. или кассета Hph размером 1,4 т.п.н. Дорожка 1, Guy11; Дорожки 2, 4 и 5, мутанты Δ gph2 ; Дорожки 3 и 6, эктопические трансформанты gph2 .

(PDF)

Рисунок S4

Направленное разрушение гена AGL1 в мутанте Δ gph2 из M. oryzae . А . Схематическое изображение локуса AGL1 , показывающее сайты рестрикции и ориентацию кодирующей области.ДНК выделяли и проверяли на предмет успешной целевой гомологичной рекомбинации в месте события B . ПЦР-анализ. Два праймера, Agl1-50.1 и Agl1-30.1, использовали для обнаружения разницы в размерах между эктопическими трансформантами и потенциальными двойными мутантами Δ agl1 Δ gph2 . L = 1 т.п.н. плюс ДНК-лестница (Invitrogen), G = геномная ДНК от Guy11, дорожки 1–10 геномной ДНК от предполагаемых трансформантов Δ agl1 Δ gph2 . Дорожки 6, 7, 10 = предполагаемые двойные мутанты Δ agl1 Δ gph2 . С . Предполагаемые мутанты Δ agl1 Δ gph2 проверяли с помощью гибридизационного анализа по Саузерну. Дорожка G = Guy11; Дорожка g = Δ gph2 ; дорожка 2 = эктопический трансформант 2; Дорожки 6, 7, 10 = предполагаемые двойные мутанты Δ agl1 Δ gph2 . Блот исследовали с удаленной областью AGL1 . Д . Была выделена общая РНК и синтезирована кДНК. 5'-кодирующая область AGL1 (789 п.н.) амплифицировали в неколичественной реакции ОТ-ПЦР.Все три анализа подтвердили успешное разрушение гена AGL1 в фоновом мутанте Δ gph2 . Трансформант 6 (AG-6) был выбран для дальнейшего фенотипического анализа и в дальнейшем обозначен как Δ agl1 Δ gph2 . L = 1 т.п.н. плюс ДНК-лестница, G = Guy11 (дикий тип), g = Δ gph2 , a = Δ agl1 , гДНК = геномная ДНК Guy11.

(PDF)

Рисунок S5

Комплементация Δ agl1 и Δ gph2 мутантов M.oryzae восстанавливает рост на крахмале. Полноразмерные гены AGL1 и GPh2 под контролем их нативных промоторов трансформировали в мутанты Δ gph2 и Δ gph2 соответственно и отобрали трансформанты. Анализы на планшете проводили на минимальной среде с крахмалом в качестве единственного источника углерода. Повторное введение каждого гена восстановило их способность расти на крахмале.

(PDF)

Рисунок S6

Аминокислотное выравнивание предсказанных M.oryzae Gsn1 с описанными гликогенсинтазами. Предсказанная аминокислотная последовательность M. oryzae GSN1 (MGG_07829.6) была сопоставлена ​​с продуктами транслирования Homo sapiensf , Gys1 & Gys2 и Saccharomyces cerevisiae , Gsy1 (YFR015C) и Gsy2 (YLR258W). Последовательности были идентифицированы из базы данных NCBI и SGD (http://www.yeastgenome.org/), выровнены с использованием ClustalW (Thompson et al. , 1994) и закрашены с помощью GeneDoc Version 2.6.002. Остатки в черном цвете идентичны для всех перечисленных белков, консервативные изменения показаны серым, а те, что на белом фоне, не показывают никакого сходства.Консервативные предполагаемые остатки серина или треонина, которые являются кандидатами на посттрансляционное фосфорилирование, показаны синим цветом.

(DOC)

Рисунок S7

Целенаправленная делеция гена GSN1 в M. oryzae Guy11. А . Схематическое изображение локуса GSN1 . В . ДНК выделяли, расщепляли Stu I и фракционировали в 0,8% агарозном геле. Гель обрабатывали методом саузерн-блоттинга и зондировали с помощью 2.Фрагмент 35 т.п.н. кодирующей области GSN1 , чтобы показать присутствие или отсутствие кодирующей области. Фрагмент 0,96 т.п.н. верхней фланкирующей области также использовали в качестве зонда для демонстрации полиморфизма длины рестрикционного фрагмента, показанного на нижней панели. Трансформанты G3, G10, G12 и G13 являются предполагаемыми мутантами Δ gsn1 . L = 1 т.п.н. плюс ДНК-лестница (Invitrogen). G2 и G4 = эктопические трансформанты.

(PDF)

Рисунок S8

Целенаправленная делеция гена NMR3 в мутанте M. Δ agl1 Δ gph2 .oryzae . А . Организация локуса NMR3 для демонстрации сайтов рестрикции Pst I и схематическое изображение, показывающее механизм делеции гена NMR3 с использованием стратегии расщепления маркеров. ДНК выделяли из трансформантов Δ agl1 Δ gph2 и предполагаемых Δ agl1 Δ gph2 Δ nmr3 и расщепляли Pst I. Расщепленную ДНК фракционировали в 0,8% агарозном геле и переносили в Hybond. -N. В . Мембрану зондировали 5'-фланкирующим фрагментом ДНК размером 1 т.п.н. для подтверждения мутантов Δ agl1 Δ gph2 Δ nmr3 на основе полиморфизма длины рестрикционного фрагмента. Трансформант 10 был выбран для дальнейшего фенотипического анализа и в дальнейшем назван Δ agl1 Δ gph2 Δ nmr3 . WT = Guy11, 1–11 = предполагаемый Δ agl1 Δ gph2 Δ nmr3 трансформантов и AG6 = Δ agl1 Δ gph2 .

(PDF)

Таблица S1

Олигонуклеотидные праймеры, использованные в этом исследовании.

(DOCX)

Гены метаболизма гликогена участвуют в регуляции патогенности, опосредованной трегалозой-6-фосфат-синтазой, грибком рисового взрыва Magnaporthe oryzae

Abstract

Нитчатый гриб Magnaporthe oryzae болезнь. Здесь мы показываем, что гены метаболизма гликогена играют важную роль в заражении растений M.oryzae . Нацеленная делеция AGL1 и GPh2 , которые кодируют амилоглюкозидазу и гликогенфосфорилазу, соответственно, предотвращала мобилизацию запасов гликогена во время развития аппрессория и вызывала значительное снижение способности M. oryzae вызывать болезнь рисового бласта. Напротив, целевая мутация GSN1 , кодирующая гликогенсинтазу, значительно снижает синтез внутриклеточного гликогена, но не влияет на патогенность грибов.Мы обнаружили, что потеря AGL1 и GPh2 привела к снижению экспрессии TPS1 и TPS3 , которые кодируют компоненты комплекса трегалоза-6-фосфатсинтаза, который действует как генетический переключатель в M. oryzae . Tps1 реагирует на уровни глюкозо-6-фосфата и баланс НАДФ / НАДФН, регулируя экспрессию генов, ассоциированную с вирулентностью, в сочетании с ингибиторами транскрипции Nmr. Мы показываем, что делеция гена ингибитора транскрипции NMR3 частично восстанавливает вирулентность мутанта Δ agl1Δgph2 , предполагая, что гены метаболизма гликогена необходимы для работы NADPH-зависимого генетического переключателя в M.oryzae .

Об авторе

Грибок Magnaporthe oryzae вызывает разрушительную болезнь риса, называемую взрывом. Ежегодно вирусная эпидемия риса уничтожает почти четверть потенциального урожая риса в мире. Грибок поражает рисовые растения, создавая особую инфекционную структуру, называемую аппрессорием, которая физически разрушает жесткую внешнюю кутикулу рисового листа. Magnaporthe может развивать аппрессории при отсутствии источника питательных веществ. Поэтому мы изучаем, как гриб использует запасы энергии в своих спорах для своего первоначального роста и развития.Гликоген является ключевым запасным соединением в грибах, и в этом исследовании мы исследовали, как происходит распад гликогена в грибах рисового бласта. Мы показали, что два основных фермента, разрушающих клеточные запасы гликогена, важны при болезни рисового бласта. Однако мы также обнаружили, что штамм гриба, у которого сильно нарушена способность синтезировать собственный гликоген, все еще может нормально инфицировать растения. Чтобы объяснить эти явно противоречивые результаты, мы исследовали регуляторную роль распада гликогена и предоставили доказательства того, что метаболизм гликогена является ключевым регулятором недавно описанного генетического переключателя, связанного с вирулентностью, в Магнапорте, который управляется ферментом, называемым трегалозо-6-фосфатсинтазой.

Введение

Райсовая болезнь является наиболее серьезным заболеванием культивируемого риса и в последние годы вызвала эпидемии в Южной Корее, Японии, Бутане и Китае [1], [2], что привело к серьезным потерям урожая. Поэтому понимание биологии рисовой пестициды важно для разработки надежных стратегий борьбы с этим заболеванием [2].

Рисовый грибок, Magnaporthe oryzae , вызывает заражение листьев риса, образуя специализированную инфекционную структуру, называемую аппрессорием [2].Это одноклеточная куполообразная структура, которая развивается из конца грибковой зародышевой трубки и отвечает за механическое повреждение кутикулы риса, позволяя грибку проникать в клетки растений. Развитие аппрессория регулируется клеточным циклом в M. oryzae с контрольными точками, регулирующими инициацию и созревание аппрессория [3], [4]. Дифференциация аппрессория сопровождается аутофагией в конидиуме, что приводит к запрограммированной гибели клеток и мобилизации содержимого трехклеточной споры в инфекционную клетку.Предотвращение аутофагии путем делеции любого из основных генов, связанных с неселективной макроаутофагией, делает гриб непатогенным, демонстрируя, что рециклинг содержимого конидия необходим для правильного функционирования аппрессория [3], [5 ].

Огромный тургор, создаваемый аппрессорием M. oryzae , является результатом накопления глицерина, который действует как совместимое растворенное вещество, вызывая приток воды в клетку для создания гидростатического давления [6].Отток глицерина предотвращается слоем меланина в клеточной стенке аппрессория, и мутанты, неспособные синтезировать меланин, не могут генерировать тургор и, следовательно, не являются патогенными. Ранее было показано, что запасы гликогена и липидные тела перемещаются из конидия в апрессорий M. oryzae до образования тургора [7] - [9]. Этот процесс контролируется Pmk1 MAP kinase pathway, который регулирует морфогенез appressorium [10] и, вероятно, связан с началом аутофагии в конидии [3].Распад липидов и гликогена в аппрессории контролируется путем ответа цАМФ, и мутанты cpkA , лишенные активности протеинкиназы А, обнаруживают значительные задержки в распаде липидов и гликогена [7]. Быстрые изменения первичного метаболизма во время созревания аппрессория, по-видимому, частично регулируются генетическим переключателем, опосредованным трегалозо-6-фосфатсинтазой (Tps), который реагирует на уровни глюкозо-6-фосфата (G6P) и баланс NADPH / NADP. в ячейках [11]. Tps-опосредованный переключатель генов взаимодействует с тремя ингибиторами транскрипции, которые регулируют экспрессию генов, связанных с вирулентностью, в ответ на преобладающие метаболические условия [11].

В этом исследовании мы исследовали роль метаболизма гликогена в функции аппрессория M. oryzae . Мы показываем, что запасы гликогена в споре быстро разрушаются во время прорастания спор в процессе, регулируемом путем ответа цАМФ. Мы демонстрируем, что гены гликогенфосфорилазы GPh2, и амилоглюкозидазы AGL1 , которые кодируют ферменты, необходимые для расщепления цитозольного гликогена, являются факторами вирулентности, участвующими в инфекции растений.Однако неожиданно мы также показали, что гликогенсинтаза, кодируемая геном GSN1 в M. oryzae , не обязательна для патогенности. Чтобы объяснить этот очевидный парадокс, мы приводим доказательства того, что потеря активности амилоглюкозидазы или гликогенфосфорилазы в M. oryzae приводит к снижению экспрессии TPS1 , тем самым влияя на регуляцию G6P / NADPH-зависимого гена [11] - [13] ]. В соответствии с этой идеей, мы показываем, что делеция NMR3 , одного из ингибиторов транскрипции, связанных с Tps1, частично восстанавливает вирулентность мутанта Δ gph2Δagl1 .Наши результаты показывают, что распад гликогена в аппрессории является важным фактором в регулировании экспрессии генов, связанных с вирулентностью.

Результаты

Мобилизация гликогена во время инфекционного развития

Magnaporthe oryzae

Чтобы исследовать роль мобилизации гликогена во время формирования аппрессория, мы сначала изучили клеточное распределение гранул гликогена в штамме M. oryzae дикого типа, Guy-11 и регуляторных мутантах, затронутых морфогенезом аппрессория.У Guy-11 непрораставшие конидии (0 ч инкубации) были богаты гликогеном, на что указывает темный осадок в каждой из трех конидиальных клеток после инкубации в растворе йода (), как описано ранее [7]. Во время прорастания и раннего образования аппрессория (2–4 ч) гликоген расщеплялся, а остаточный гликоген локализовался только в центральной клетке конидия. После 6 ч прорастания гликоген появился в зарождающемся апрессории, но быстро истощился во время созревания апрессория, пока через 24 часа не стали видны только темное кольцо меланина вокруг апрессория и небольшое количество зерен гликогена (, [7]).

Распределение клеток и количественный анализ гликогена во время морфогенеза аппрессоров у M. oryzae .

Микрофотографии мобилизации гликогена во время развития аппрессория M. oryzae . Конидии штаммов M. oryzae проращивали на гидрофобных пластиковых покровных стеклах. Образцы отбирали через 0 ч, 2 ч, 4 ч, 6 ч, 8 ч, 12 ч, 24 ч и 48 ч и окрашивали на наличие гликогена раствором йода. Желтовато-коричневые отложения гликогена сразу стали видны с помощью модулирующей оптики Хоффмана с микроскопом Nikon Optiphot-2. А . Штамм дикого типа Guy 11, проращенный в воде. В . ΔcpkA мутант DF51. С . Штамм дикого типа Guy 11 проращивали в полной среде (CM), содержащей 2% дрожжевого экстракта. Бар = 10 мкм. D – F Графики, показывающие биохимический анализ мобилизации гликогена во время формирования аппрессория M. oryzae Конидии проращивали в воде на гидрофобных пластиковых покровных стеклах и позволяли формировать аппрессории. Количество гликогена в пикограммах оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген. Д . Штамм дикого типа Guy 11. E . ΔcpkA мутант DF51. Ф . Δmac1 sum1-99 мутант DA-99. Каждая точка данных представляет собой среднее значение трех независимых повторов эксперимента. Планки погрешностей показывают стандартное отклонение.

Чтобы изучить роль пути цАМФ в мобилизации гликогена, мы исследовали мутант ΔcpkA (). CPKA кодирует каталитическую субъединицу цАМФ-зависимой протеинкиназы A [14], [15].Конидии изначально были богаты гликогеном, но деградация гликогена у мутантов ΔcpkA была отложена, гликоген все еще присутствовал в конидиях через 8 часов. Затем гликоген откладывался в деформированных аппрессориях ΔcpkA , но эти клетки не развивались полностью и гликоген не разрушался (). Мы пришли к выводу, что путь цАМФ регулирует эффективную деградацию гликогена во время прорастания и образования аппрессория. В соответствии с этой идеей, мутант супрессора обхода цАМФ Δmac1 sum1-99 [16], обнаруживает ускоренный распад гликогена в аппрессориях, как сообщалось ранее [7].

Чтобы определить, связана ли мобилизация гликогена с развитием аппрессориев, конидии Guy-11 проращивали в условиях с высоким содержанием питательных веществ (2% дрожжевой экстракт), которые подавляют образование аппрессориев [16]. Наблюдалась ограниченная деградация отложений гликогена, и через 48 ч гранулы гликогена можно было увидеть внутри разветвленных зародышевых трубок (). Таким образом, мобилизация гликогена из конидиума связана с морфогенезом аппрессория в условиях отсутствия питательных веществ.

Биохимический анализ мобилизации гликогена в развивающемся апрессории

Затем мы разработали анализ, позволяющий количественно оценить запасы гликогена, и обнаружили, что непроращенные конидии Guy11 содержат около 1200 пг гликогена ().Мы наблюдали 1500 пг гликогена проростков -1 через 2 часа прорастания, во время прорастания зародышевой трубочки, но между 2 и 12 часами после прорастания количество гликогена упало до 500 пг проростков -1 и оставалось на этом уровне во время созревания аппрессория. , что представляет собой среднее снижение на 988 пг с 95% семейным доверительным интервалом (667, 1310), p <0,001. За все 48 часов средний уровень гликогена снизился на 751 пг (95% ДИ 1073, 430 p <0.001). Сравнить эти результаты с предыдущими измерениями уровня гликогена в почкующихся дрожжах Saccharomyces cerevisiae [17], они должны быть преобразованы в фемтомоли (фмоль) на клетку. Количество клеток M. oryzae можно легко определить только через 0 ч (3-клеточный конидий) и 48 ч (одноклеточный апрессорий). Следовательно, непроращенный конидиум M. oryzae содержит в среднем 2363 фмоль клеток гликогена -1 , в то время как аппрессорий содержит 2450 фмоль клеток гликогена -1 .Значительная емкость гликогена клеток M. oryzae дикого типа подчеркивается, когда эти значения сравниваются с 19,5 фмоль гликогена, измеренным в дрожжевых клетках S. cerevisiae [17]. Мутант ΔcpkA содержал более низкие уровни гликогена, чем Guy11 (). В 0 ч мы обнаружили 800 мкг проростков гликогена -1 . Не было значительных изменений в уровнях гликогена ΔcpkA за весь период времени (общее среднее снижение на 13 пг [95% ДИ 354, 328 p = 1]).В цАМФ-независимом мутантном штамме PKA Δmac1 sum1-99 анализ гликогена выявил изначально высокие уровни гликогена в 1700 пг зародышей -1 (). Это продолжало увеличиваться до пика при 2100 пг проростков -1 через 4 часа (среднее увеличение от 0 до 4 часов для 450 пг [95% ДИ -265, 1164 p = 0,545]). Между 4 и 6 часами после прорастания, во время образования аппрессория, уровни гликогена быстро снижались в среднем на 986 пг проростков -1 (95% ДИ 1700, 272 p <0.001). Уровни снова повышались до 12 часов, достигая пика при более низком значении 1800 пг проростков -1 (среднее увеличение 646 пг [95% ДИ -152, 1445 p = 0,2156]. Затем гликоген постепенно снижался в среднем на 1340 пг за оставшиеся 36 часов (95% ДИ 2139, 541 p <0,001) до конечного значения примерно 400 пг проростки -1 через 48 ч. За весь период времени уровни гликогена в сумме Δmac11- 99 мутант уменьшился в среднем на 1230 пг (95% ДИ 1944, 516 p <0.001). Мы пришли к выводу, что путь ответа цАМФ регулирует мобилизацию гликогена во время развития аппрессория у M. oryzae .

Идентификация и характеристика

M. oryzae AGL1 и GPh2

Чтобы определить, необходима ли мобилизация гликогена для патогенности M. oryzae , мы идентифицировали основные ферменты, связанные с его расщеплением. Гликоген состоит из цепей глюкозы, связанных α-1,4-гликозидной связью, и примерно у каждого десятого остатка точка разветвления образована α-1,6-гликозидной связью.Амилоглюкозидаза (фермент разветвления гликогена) удаляет α-1,6-гликозидные связи из сильно разветвленного полимера, высвобождая глюкозу. Предполагаемый ген, кодирующий амилоглюкозидазу, AGL1 (MGG_00063.6), был идентифицирован в последовательности генома M. oryzae . [18]. AGL1 имеет открытую рамку считывания 4749 п.н., прерванную двумя интронами длиной 134 и 91 п.о., и кодирует предполагаемый белок из 1583 п.о. Сопоставление потенциального белка Agl1 M. oryzae с амилоглюкозидазами других организмов (рисунок S1) выявило 72% идентичности гипотетическому белку из Neurospora crassa и 47% идентичности ферменту разветвления гликогена Gdb1 S.cerevisiae [19]. Дальнейший анализ белковой последовательности выявил четыре консервативных участка аминокислот, присутствующих в α / β бочкообразном домене всех членов суперсемейства α-амилазы (данные не показаны). Разрушение гликогена также требует действия гликогенфосфорилазы. Этот фермент дополняет α-1,6-гликозидную активность амилоглюкозидазы, воздействуя на экзогликозидные α-1,4-гликогенные связи гликогена, последовательно отщепляя и фосфорилируя невосстанавливающие концы полимера.Был идентифицирован ген M. oryzae GPh2 (MGG_01819.6) и выявлена ​​ORF длиной 2664 п.о., кодирующая предполагаемый белок 888 аминокислотных остатков. В последовательности присутствовали два старт-сайта ATG в рамке считывания, самый 5'-из них имеет индикаторный нуклеотид старт-сайта, А, на -3 п.н. [20], который, вероятно, является сайтом инициации трансляции для GPh2 [21]. Белок показал 78% идентичности гипотетическому белку в N. crassa и 74% идентичности предполагаемой гликогенфосфорилазе из Aspergillus fumigatus (Рисунок S2).В S. cerevisiae сайт фосфорилирования присутствует в N-концевой области белка [22]. Белок M. oryzae демонстрирует высокую степень сходства с этой последовательностью, а остаток треонина, с которым связывается фосфат в дрожжевой гликогенфосфорилазе, является консервативным. Кроме того, все гликогенфосфорилазы обладают сайтом связывания для пиридоксаль-5'-фосфата, кофактора, участвующего в фосфорилировании. Альдегидная группа этого производного пиридоксина образует основание Шиффа со специфической лизиновой боковой цепью гликогенфосфорилазы [23].Аминокислотная последовательность, окружающая этот сайт, была идентифицирована в дрожжевой гликогенфосфорилазе [22] и является высококонсервативной в M. oryzae GPh2 с 17 из 18 остатков, идентичными у двух организмов (данные не показаны). Последовательность геномной ДНК длиной 3021 п.н. M. oryzae GPh2 также была идентифицирована из опубликованной последовательности генома [18]. Сравнение этой геномной последовательности с последовательностью кДНК GPh2 выявило присутствие четырех интронов.

Целенаправленная замена гена

M.oryzae AGL1 и GPh2

Чтобы изучить роль AGL1 и GPh2 в патогенности M. oryzae , мы выполнили целевую замену гена (рисунок S3A). Фрагмент Hin dIII размером 2,8 т.п.н. (рисунок S3B), содержащий большую часть 5'-области AGL1 , был удален и заменен кассетой гигромицинфосфотрансферазы [24], придающей устойчивость к гигромицину B. Полученная конструкция (рисунок S3B) ) вводили в Guy-11 и проверяли трансформанты с помощью гель-блоттинга ДНК (рис. S3C).Чтобы удалить GPh2 , часть кодирующей последовательности размером 3 т.п.н. в 2,2 т.п.н. была впоследствии заменена кассетой устойчивости 1,4 т.п.н. к гигромицин-фосфотрансферазе (рисунок S3D). Полученная кассета была введена в Guy-11 и отобраны трансформанты (Рисунок S3E).

Делецию каждого гена подтверждали измерением активности ферментов Agl1 и Gph2 (). Активность амилоглюкозидазы не была обнаружена в штамме Δ agl1 , а активность гликогенфосфорилазы не была обнаружена в мутантах Δ gph2 .Однако мы также наблюдали, что активность амилоглюкозидазы не может быть обнаружена в штаммах с делецией Δ gph2 . Амилоглюкозидаза расщепляет точки разветвления гликогена только тогда, когда они становятся доступными под действием гликогенфосфорилазы и, следовательно, не могут быть измерены в этом анализе.

Столбчатые диаграммы, показывающие активность амилоглюкозидазы и гликогенфосфорилазы у мутантов M. oryzae , метаболизирующих гликоген.

Подробнее о ферментативных анализах см. Материалы и методы. А . Активность амилоглюкозидазы не была обнаружена в мутантах Δ agl1 или, как следствие использованного анализа, в штаммах Δ gph2 . В . гликогенфосфорилазная активность отсутствовала у мутанта Δ gph2 .

Для создания двойного мутанта Δ agl1 Δ gph2 мы провели целевую делецию AGL1 в мутанте Δ gph2 , используя метод делеции гена маркера расщепления [25]. Конструкции с делецией генов трансформировали в Δ gph2 с использованием аллеля гена ацетолактатсинтазы, придающего устойчивость к сульфонилмочевине.Полученные трансформанты были отобраны и проанализированы с помощью гель-блоттинга ДНК (рис. S4). Кроме того, была проведена ОТ-ПЦР для подтверждения успешной делеции гена. В Guy11 и Δ gph2 был амплифицирован ампликон длиной 789 п.н., соответствующий транскрипту Agl1, но это не было обнаружено в мутантах Δ agl1 или двойных мутантах Δ agl1 Δ gph2 (рисунок S4D).

Δ

agl1 и Δ gph2 мутанты демонстрируют измененный метаболизм гликогена

Чтобы исследовать, затрагивается ли клеточное распределение гликогена у мутантов, несущих целевые делеции AGL1 и GPh2 , мы проанализировали мобилизацию гликогена во время образования Δagl1 , Δgph2 и Δ agl1 Δ gph2 ().Мобилизация гликогена замедлялась у мутантов Δ agl1 и Δ agl1 Δ gph2 , и гликоген не истощался из конидий до 24 часов по сравнению с 8–12 часами у Guy11. Напротив, мутанты Δ gph2 оказались менее подверженными мобилизации гликогена. Эти результаты предполагают, что амилоглюкозидаза более важна для эффективного разложения гликогена во время развития, связанного с инфекцией, чем гликогенфосфорилаза. Это может отражать способность недавно описанной глюкоамилазы выполнять α-1,4-гликозидную активность гликогенфосфорилазы и, таким образом, потенциально компенсировать потерю этой активности [25].Однако гликогенфосфорилаза важна для разрушения мицелиального гликогена, поскольку гликоген накапливается в штаммах Δ gph2 во время роста на минимальной среде (), но не в штаммах Δ agl1 .

Распределение клеток и количественная оценка гликогена во время морфогенеза аппрессория у мутантов Δ agl1 и Δ gph2 M. oryzae .

А . Конидии инкубировали на гидрофобных стеклянных покровных стеклах, чтобы позволить апрессориям развиться до окрашивания раствором йода.Мутанты Δ agl1 и Δ agl1 Δ gph2 были нарушены в мобилизации гликогена из конидия в аппрессорий и в последующей деградации в аппрессории, тогда как мутант Δ gph2 был сравним с Guy11. Шкала шкалы = 10 мкм. В . Количественное определение гликогена в экстрактах мицелия дикого типа и метаболических мутантах гликогена M. oryzae . Штаммы выращивали либо в жидкой CM в течение 48 часов, либо в CM с последующим выращиванием в GMM в течение 16 часов.Культуры собирали, промывали 0,2% CaCl 2 и сушили вымораживанием. Количество гликогена, присутствующего в мицелии -1 нмольмг, оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген. Значения, обозначенные разными буквами (a, b,), статистически значимы при p <0,01. С . Тесты роста, чтобы показать использование крахмала и гликогена в качестве единственных источников углерода. Минимальную среду, содержащую глюкозу, крахмал или гликоген, засевали мицелиальной пробкой М.oryzae и инкубировали в течение 12 дней. Чашки с крахмалом и гликогеном заливали йодом, чтобы визуализировать разницу в использовании субстрата. Йод окрашивает крахмал в синий цвет, а гликоген в коричневый цвет. У мутантов гликогена была нарушена их способность использовать как крахмал, так и гликоген в качестве единственного источника углерода.

Чтобы определить, способны ли мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 использовать внешний гликоген в качестве единственного источника углерода, мы провели тесты роста на различных источниках углерода.Оба мутанта Δ agl1 и Δ gph2 вместе с двойным мутантом Δ agl1 Δ gph2 были способны утилизировать глюкозу, но их рост был нарушен на гликогене и крахмале (). Повторное введение AGL1 и GPh2 в соответствующие нуль-мутанты дополняло мутантный фенотип (рисунок S5). Мы пришли к выводу, что мутанты Δ agl1 и Δ gph2 обладают нарушенной способностью использовать как крахмал, так и гликоген в качестве единственного источника углерода.

Agl1 и Gph2 локализуются в цитоплазме конидий, аппрессорий и инвазивных гиф

Для определения субклеточного расположения Agl1p и Gph2p во время образования аппрессория, AGL1: GFP и GPh2: GFP экспрессировали слияниями генов Guy11. . Слияния Agl1-GFP и Gph2-GFP локализуются по всей цитоплазме в конидиях Guy11 и внутри зародышевых трубок и возникающих аппрессорий к 2 часам и 4 часам соответственно (). Через 8 часов флуоресцентный сигнал наблюдался преимущественно в развивающемся апрессории, а через 24 часа Agl1-GFP и Gph2-GFP были обнаружены исключительно в цитоплазме апрессория.Интересно, что Agl1-Gfp и Gph2-Gfp также были высоко экспрессированы во время заражения растений через 36 часов и локализовались в цитоплазме внутриклеточных инвазивных гиф грибов (2).

Локализация Agl1-GFP и Gph2-GFP на разных стадиях морфогенеза аппрессория и в росте planta с помощью M. oryzae .

А . Конидиям давали возможность сформировать аппрессории, и локализацию Agl1-GFP и Gph2-GFP наблюдали в течение 24 часов с использованием инвертированного эпифлуоресцентного микроскопа Olympus IX-81, снабженного камерой HQ 2 .Слитые белки были локализованы в цитоплазме в конидиях, зародышевой трубке и апрессории. Шкала шкалы = 10 мкм. В . Конидии собирали из штаммов Agl1-GFP и Gph2-GFP и инкубировали на оболочке рисового листа во влажной камере. Конфокальную систему лазерного сканирующего микроскопа Zeiss LSM510 Meta использовали для наблюдения экспрессии Agl1-GFP и Gph2-GFP в эпидермальной ткани риса через 36 часов после инкубации. Agl1-GFP и Gph2-GFP экспрессировались цитоплазматически в инвазивных гифах. Шкала шкалы = 20 мкм.

М.oryzae Δ agl1 , Δ gph2 , Δ agl1 Δ gph2 мутанты обладают нарушенной способностью вызывать болезнь рисового бласта

Чтобы определить роль AGL1 и gph2 в патогенности GPh2 засевали восприимчивый сорт риса CO-39 и сорт ячменя Golden Promise однородными суспензиями спор каждого мутанта и Guy-11 (). У мутантов Δ agl1 и Δ gph2 количество повреждений уменьшилось на 50.44 ± 6% ( P <0,0001) и 44,7 ± 2,4% ( P <0,001), соответственно, тогда как у штамма Δ agl1 Δ gph2 количество поражений уменьшилось на 75,44 ± 1,4% ( P <0,0001) (). У мутантов не обнаружено дефектов прорастания конидий и образования аппрессориев в условиях отсутствия питательных веществ, и частота образования аппрессориев также не пострадала (данные не показаны). Ранее предполагалось, что распад гликогена может быть значительным в генерации тургора аппрессория [6], [7], [26].Поэтому мы измерили тургор аппрессория у мутантных штаммов Δ agl1 и Δ gph2 , используя анализ зарождающегося циторриза [6]. Несмотря на различия в мобилизации гликогена у мутантных штаммов (), мы не обнаружили существенных различий в тургоре между аппрессориями мутантных штаммов и Guy-11 (не показано). Затем мы использовали анализ эпидермиса лука [27], чтобы определить, может ли наблюдаемое снижение вирулентности быть следствием нарушения функции аппрессория. Однако не наблюдали значительных различий в эпидермальном проникновении между Guy-11 и мутантными штаммами Δagl1 , Δgph2 и Δagl1Δgph2 , которые обычно вырабатывали штыри для проникновения (не показаны).Следовательно, уменьшение образования повреждений, наблюдаемое для Δ agl1 , Δ gph2 и Δagl1Δgph2 , не является следствием пониженного тургорного давления или нарушения функции аппрессора. Чтобы исследовать колонизацию тканей каждым мутантом, был проведен анализ оболочки рисового листа [28]. Мы обнаружили, что мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 не обладают способностью к инвазивному росту внутри клеток риса. Мутанты, метаболизирующие гликоген, образовывали необычные инвазивные гифы, которые были менее выпуклыми и разветвленными, чем обычно ().Мы пришли к выводу, что мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 способны нормально проникать в клетки риса, но не могут эффективно размножаться в тканях риса, что приводит к уменьшению симптомов заболевания.

Анализы заражения и проникновения мутантов Δ agl1 , Δ gph2 и Δ agl1Δgph2 M. oryzae .

А . Пятнадцатидневные проростки риса сорта СО-39 или 8-дневные проростки ячменя Golden Promise опрыскивали конидиальной суспензией из 5 × 10 -4 спор спор -1 мл и инкубировали при 24 ° C. при сильном освещении и влажности 90% в течение 5 дней.Показанные листья представляют типичные симптомы, связанные с каждым штаммом. Эксперимент был повторен шесть раз с аналогичными результатами. Столбчатые диаграммы показывают плотности поражений, полученные на инфицированных листьях риса, выбранных случайным образом. Односторонний анализ ANOVA показал, что у мутантных штаммов была значительная недостаточность их способности вызывать болезнь рисового бласта. Значения, обозначенные разными буквами (a, b, c), статистически значимы при p <0,01. В . Для исследования инвазии в ткани хозяина конидии инкубировали на оболочке рисового листа в течение 36 часов и наблюдали с помощью лазерной конфокальной микроскопии.Штамм дикого типа Guy11 показал рост с инвазивными луковичными и разветвленными гифами. Мутанты по метаболизму гликогена продуцировали менее луковичные и разветвленные инвазивные гифы внутри рисовых клеток. Шкала шкалы = 20 мкм.

Идентификация гена, кодирующего гликоген-синтазу

M. oryzae

Учитывая важность мобилизации гликогена для вирулентности, мы решили создать штамм M. oryzae , запасы гликогена истощены. Предполагаемый ген, кодирующий гликоген-синтазу, был идентифицирован из M.База данных генома oryzae (http://www.broadinstitute.org/annotation/fungi/magnaporthe/) с использованием алгоритма BLASTX [29], основанного на его предсказанной аминокислотной гомологии с гликоген-синтазами дрожжей и млекопитающих. Одна последовательность, MGG_07289.6, выровнена с гликогенсинтазами дрожжей и млекопитающих [30], [31]. Предсказанный ген, кодирующий гликоген-синтазу, который мы назвали GSN1 , присутствует как единичный ген в геноме M. oryzae и, по прогнозам, содержит пять экзонов, прерванных четырьмя интронами [29].Предсказанный ген кодирует белок из 708 аминокислот и показал высокое сходство последовательностей с Gsy1p и Gsy2p дрожжей [30] и Gys1p и Gys2p специфичных для мышц и печени форм гликогенсинтазы человека [31]. На рисунке S6 показан результат выравнивания ClustalW [32]. S. cerevisiae Gsy1 и Gsy2 показали 63% и 64% идентичности с M. oryzae GSN1 , соответственно, тогда как Homo sapiens Gys1 и Gys2 показали идентичность 60% и 55% соответственно. Сайты фосфорилирования, предположительно участвующие в посттрансляционной регуляции Gsy2p, консервативны в M.oryzae Гсн1п. В Gsy2p три сайта фосфорилирования присутствуют в S650, S654 и T667 на C-конце [33], тогда как в Gsn1p предсказанные остатки присутствуют в положениях S632, S636 и T645 на C-конце, как показано на дополнительном рисунке S5.

Синтез гликогена не влияет на патогенность

M. oryzae

Для создания нулевого мутанта Δ gsn1 M. oryzae , целевую замену гена GSN1 проводили с использованием метода делеции гена маркера расщепления (рисунок S6A) [25].Конструкции с делецией генов трансформировали в Guy11, и предполагаемые трансформанты подвергали скринингу на основании их устойчивости к гигромицину B (фигура S7). У мутантов Δ gsn1 отложения гликогена не могли четко наблюдаться (), в отличие от Guy11 (). Для дальнейшего исследования мы измерили гликоген с помощью ферментативного анализа и наблюдали значительное снижение ( P <0,01) гликогена в клетках мутанта Δ gsn1 (). Мы пришли к выводу, что синтез гликогена серьезно нарушен как в конидиях, так и в аппрессориях в отсутствие гена гликогенсинтазы GSN1 .

Распределение гликогена в клетках во время морфогенеза аппрессория у мутанта гликоген-синтазы Δ gsn1 из M. oryzae .

А . Конидиям давали возможность образовать аппрессории, а затем проводили окрашивание раствором йода. Отложения гликогена отсутствовали в конидиях и на всем протяжении развития аппрессория. Шкала шкалы = 10 мкм. В . Анализы заражения мутантами Δ gsn1 . Споры собирали из 12-дневных культур Guy11 и мутанта Δ gsn1 и инокулировали распылением в концентрации 5 × 10 4 конидий мл -1 на 3-недельные проростки риса и 8-дневные проростки. рассада ячменя.Растения инокулировали при 24 ° C, сильном освещении и влажности 90% в течение пяти дней. Листья собирали и оценивали на наличие симптомов взрыва риса. Не наблюдалось очевидной разницы между патогенностью штамма Guy11 дикого типа и мутанта гликоген-синтазы Δ gsn1 . Эксперимент повторяли три раза с идентичными результатами, и не наблюдали статистически значимых различий в плотности или степени поражения (не показано). C. Количественное определение гликогена в конидиях дикого типа и мутантах гликогенсинтазы M.oryzae . Конидии собирали с 12-дневных чашек дикого типа и двух мутантов с делецией Δ gsn1 и разбавляли до концентрации 1 × 10 6 мл -1 . Количество гликогена в конидиях -1 мг / мл оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген (+). Также показано количество глюкозы без добавления ферментов, расщепляющих гликоген (-). Значения с разными буквами (a, b,) статистически значимы при p <0.01.

Изучить роль GSN1 в прогрессировании болезни рисовой пигментации, проростков риса CO-39 и ячменя сорта. Каждый Golden Promise был инокулирован мутантом гликогенсинтазы Δ gsn1 и штаммом дикого типа Guy11. Мутант Δ gsn1 был способен вызывать симптомы болезни рисового бласта, которые были идентичны штамму дикого типа, из которого можно сделать вывод, что этот ген является незаменимым для заражения рисовым бластом как у риса, так и у ячменя ().Мы пришли к выводу, что синтез гликогена в качестве запасного продукта в спорах у M. oryzae не является существенным для патогенности.

Δ

agl1 , Δ gph2 и Δ agl1 Δ gph2 мутанты влияют на синтез трегалозы

Мы были заинтригованы, обнаружив, что нарушение синтеза гликогена не влияет на вирулентность M. oryzae. при условии, что оба мутанта Δ agl1 и Δ gph2 показали такие выраженные дефекты в их способности вызывать болезнь рисового взрыва.Поэтому мы решили определить, были ли другие биохимические различия очевидны у любого из метаболических мутантов гликогена. Интересно, что мы наблюдали, что оба мутанта Δ agl1 и Δ gph2 показали пониженные уровни трегалозы во время вегетативного роста на CM (). Это предполагает, что в M. oryzae предшественники трегалозы, по крайней мере, во время роста мицелия, могут быть получены в результате деградации гликогена или на них влияет потеря активности этих ферментов. Поэтому мы проанализировали экспрессию TPS1 и TPS3 в мутантах Guy11, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 . TPS1 кодирует трегалозо-6-фосфат (T6P) синтазу, а TPS3 кодирует субъединицу комплекса T6P-синтаза / трегалоза фосфатаза [34]. Экспрессия TPS1 была снижена в 5 раз у мутантов Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 по сравнению с Guy11 (), тогда как экспрессия TPS3 была снижена в 6 раз при Δ . agl1 , 9 раз в Δ gph2 и в 50 раз в мутанте Δ agl1 Δ gph2 ().Мы также исследовали экспрессию гена RSY1 , участвующего в пути биосинтеза меланина [35], поскольку известно, что TPS1 регулирует экспрессию нескольких генов, связанных с вирулентностью, включая гены биосинтеза меланина, через генетический ген TPS1 / NMR . переключатель [11]. Экспрессия RSY1 также подавлялась в независимых одиночных и двойных мутантах (не показаны).

Анализ синтеза трегалозы у метаболических мутантов гликогена M.oryzae .

А . Количественное определение трегалозы в экстрактах мицелия. Штаммы выращивали либо в жидкой CM в течение 48 часов, либо в CM с последующим выращиванием в GMM в течение 16 часов. Культуры собирали, промывали 0,2% CaCl 2 и сушили вымораживанием. Экстракты мицелия получали с метилендихлоридом и метанолом и анализировали на трегалозу. Уровни трегалозы были значительно снижены у мутантов метаболизма гликогена по сравнению с Guy11. Эксперимент был повторен трижды с аналогичными результатами.Значения, обозначенные разными буквами (a, b, c, d), статистически значимы при p <0,01. В . Анализ экспрессии генов TPS1 и C . TPS3 в мицелии с помощью сравнительной количественной ОТ-ПЦР в реальном времени. Уровни транскриптов TPS1 , TPS3 были подавлены у мутантов, метаболизирующих гликоген. Эксперимент повторяли дважды, каждый с тремя техническими повторами, с аналогичными результатами. Односторонний анализ ANOVA показал, что мутантные штаммы имели значительные дефекты в экспрессии гена биосинтеза трегалозы.Обилие транскриптов показано относительно экспрессии гена M. oryzae β -тубулина (MGG_00604). Значения, обозначенные разными буквами (a, b, c, d), статистически значимы при p <0,01.

Делеция

NMR3 частично восстанавливает Δ agl1 Δ gph2 фенотип двойного мутанта

Известно, что M. oryzae Tps1 действует как G6P-чувствительный белок, напрямую связываясь с G6P и NADPH для контроля экспрессии набор ассоциированных с вирулентностью генов, экспрессируемых при заражении растений [11].Мы предположили, что если гены метаболизма гликогена ( AGL1 и GPh2 ) регулируют экспрессию TPS1 во время инфекции, то делеция одного из генов ингибитора транскрипции, который, как было показано, взаимодействует с Tps1p, может частично компенсировать фенотипические дефекты, связанные с Δ agl1 Δ gph2 двойной мутант [11]. Делеции NMR1 , NMR2 или NMR3 , например, было показано, что достаточно для восстановления патогенности мутанта Δ tps1 [11].Поэтому мы провели целенаправленную делецию гена NMR3 в двойном мутанте Δ agl1 Δ gph2 , поскольку двойные мутанты Δ tps1 Δ nmr3 показали максимальное восстановление патогенности [11]. Мы использовали стратегию расщепления маркеров для нацеливания на локус NMR3 для делеции гена, как показано на рисунке S8A. [25]. После трансформации трансформантов M. oryzae были первоначально проверены на устойчивость к биалафосу [36], и делеция была подтверждена с помощью гель-блоттинга ДНК (рис. S8B).

Для проверки вирулентности Δ agl1 Δ gph2 Δ nmr3 на восприимчивом сорте риса CO-39 был проведен анализ патогенности с использованием Guy11, Δ agl1 Δ gph2. agl1 Δ gph2 Δ nmr3 мутант. Мы обнаружили, что делеция гена NMR3 восстанавливала способность мутанта Δ agl1 Δ gph2 вызывать бластную болезнь, как показано на рис. Не наблюдалось существенной разницы в количестве повреждений между Guy11 и Δ agl1 Δ gph2 Δ nmr3 при заражении риса ( P <0.05) или инфекции ячменя (). Мы пришли к выводу, что AGL1 и GPh2 могут влиять на работу Tps1-опосредованного механизма регуляции гена, который необходим для болезни рисового бласта.

Анализ рисового бласта Δ agl1 Δ gph2 и Δ agl1 Δ gph2 Δ nmr3 мутанта M. oryzae .

А . 3-недельные проростки риса сорта СО-39 опрыскивали суспензией спор 5 × 10 4 спор -1 мл и инкубировали в течение 5 дней при 24 ° C. В . Поражения оценивали на случайно выбранных инфицированных листьях. Показанные листья представляют типичные симптомы, связанные с каждым испытанным штаммом. Эксперименты повторяли шесть раз с идентичными результатами. У Δ agl1 Δ gph2 Δ nmr3 была частично восстановлена ​​его способность вызывать бластную болезнь. Значения, обозначенные разными буквами (a, b), статистически значимы при p <0,01. C. 8-дневные проростки ячменя Golden Promise опрыскивали конидиальной суспензией из 5 × 10 -4 спор спор -1 мл и инкубировали при 24 ° C, сильном освещении и влажности 90% в течение 5 дней.Показанные листья представляют типичные симптомы, связанные с каждым штаммом. Эксперимент был повторен трижды с аналогичными результатами.

Обсуждение

В этом исследовании мы намеревались изучить роль метаболизма гликогена в возникновении болезни рисового бласта, вызываемой M. oryzae . Предыдущие сообщения установили, что мобилизация гликогена происходит во время развития аппрессория и может зависеть от cAMP-зависимой протеинкиназы A и путей передачи сигналов MAP kinase Pmk1 [7].Запасы гликогена в аппрессории также были предложены в качестве потенциального субстрата для производства глицерина в аппрессории, способствуя генерации тургора для разрыва кутикулы растения [6], [7], [26]. Запасы гликогена в аппрессориях, например, явно используются во время созревания аппрессориев до заражения растений [26]. При совместном рассмотрении результаты, представленные в этом исследовании, свидетельствуют о том, что деградация цитозольного гликогена в M. oryzae , которая требует гликогенфосфорилазы и амилоглюкозидазы, играет важную роль в вирулентности этого гриба.Этот вывод основан на мутантных фенотипах Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 двойных мутантов, у которых нарушена их способность вызывать бластную болезнь. Однако кажется вероятным, что влияние на вирулентность является плейотропным, а не специфически связанным с использованием резервов гликогена, поскольку мутанты Δ gsn1 , запасы гликогена которых значительно уменьшены из-за отсутствия активности гликогенсинтазы, не подвержены вирулентности.Этот результат предполагает, что запасы гликогена в конидиях и аппрессориях не обязательны для генерации тургора аппрессория и заражения растений. Представленные здесь данные также предполагают, что потеря GPh2 и AGL1 снижает экспрессию TPS1 , который, как известно, интегрирует контроль углеродного и азотного метаболизма в M. oryzae в ответ на уровни G6P и NADPH / NADP [11] .

В начале этого исследования мы были особенно заинтересованы в понимании того, как мобилизация гликогена происходила во время развития аппрессория M.oryzae . Поэтому изначально мы провели цитологический и биохимический анализ, чтобы изучить движение и распад запасов гликогена. Результаты этих экспериментов согласуются, показывая, что гликоген быстро разлагается во время прорастания конидий и что этот процесс замедляется у мутантов Δ cpkA , лишенных каталитической субъединицы протеинкиназы A. Наоборот, Δ mac1 sum1-99 мутант, шунтирующий супрессор нулевого мутанта аденилатциклазы, который несет мутацию в цАМФ-связывающем кармане регуляторной субъединицы протеинкиназы A [16], демонстрирует неправильную регуляцию хранения гликогена в споре.Это согласуется с более ранними предположениями, основанными исключительно на микроскопии [7], что мутанты Δ mac1 sum1-99 ускоряют распад гликогена и липидов. Взятые вместе, эти наблюдения предполагают, что путь ответа цАМФ играет важную роль в регуляции цитозольного метаболизма гликогена.

Чтобы исследовать роль распада гликогена в заражении растений M. oryzae , мы создали мутанты с делецией гена, лишенные активности ферментов амилоглюкозидазы и гликогенфосфорилазы.Фенотипический анализ показал, что двойные мутанты Δ agl1 и Δ agl1 Δ gph2 имели серьезные дефекты в расщеплении гликогена в конидиях, и через 24 часа розетки гликогена оставались видимыми в конидиях обоих мутантных штаммов. Гиперакопление гликогена ранее наблюдалось у мутантов Δ agl1 и Δ gph2 S. cerevisiae . [37], [38], демонстрируя важность этих ферментов для использования запасов гликогена.Предыдущее сообщение показало, что вакуолярная глюкоамилаза, Sga1, в M. oryzae может вносить вклад в утилизацию гликогена во время конидиогенеза [39]. Мутанты, лишенные активности Sga1, показали пониженную конидиацию, что согласуется с ролью вакуолярного аутофагического гидролиза гликогена во время развития спор. Интересно отметить, что мутанты Δ sga1 , однако, не проявили какого-либо влияния на развитие или патогенность аппрессоров [39], предполагая, что M. oryzae может разлагать гликоген посредством вакуолярного аутофагического механизма во время развития спор, но в основном цитозольный путь во время спор. прорастание и развитие аппрессориев, даже несмотря на то, что большой всплеск аутофагии связан с прорастанием конидий, запрограммированной гибелью клеток и созреванием аппрессориев [3], [5].Слияния генов Agl1-GFP и Gph2-GFP, например, подтвердили, что оба фермента локализованы в цитоплазме внутри конидий, зародышевых трубок и аппрессорий.

Фенотипы мутантов Δ agl1 и Δ gph2 согласуются с мобилизацией и использованием гликогена, оказывающими значительное влияние на способность M. oryzae вызывать болезнь, вызываемую грибковой инфекцией риса. Однако делеция GSN1 , который кодирует гликогенсинтазу, привела к значительному снижению уровней гликогена в клетках, но не оказала никакого влияния на патогенность M.oryzae .. Липиды, гликоген и трегалоза являются основными запасами питательных веществ, используемых конидиями M. oryzae для прорастания и дифференциации аппрессориев (см. обзор [2]). Основываясь на результатах, представленных здесь, кажется, что использование гликогена не может быть таким значительным фактором созревания апрессория, как гидролиз триацилглицерина [9]. Активность триацилглицерин липазы, например, индуцируется во время развития аппрессория у M. oryzae . [7].

Наиболее значимый вывод, который мы можем сделать относительно роли AGL1 и GPh2 в патогенности M.oryzae заключается в том, что отсутствие этих ферментных активностей снижает экспрессию гена TPS1 . Из M. oryzae известно, что активность Tps1 важна для болезни рисового бласта и формирует NADPH-зависимый генетический переключатель [11]. Мутанты, лишенные Tps1, способны продуцировать аппрессории, но они нефункциональны, и гриб не может колонизировать ткани риса [40]. Мутант Δ tps1 не продуцирует трегалозу или ее промежуточный трегалозо-6-фосфат (T6P), но нарушение патогенности происходит не просто из-за потери биосинтеза трегалозы.Мутации в G6P-связывающих карманах Tps1, например, сделали гриб непатогенным, в то время как мутации в каталитических сайтах, необходимых для синтеза T6P, не повлияли на его роль в заболевании, вызванном грибковой инфекцией риса, что позволяет предположить, что потеря связывания G6P связана с потерей патогенности [12]. Tps1 объединяет использование источников углерода и азота, а мутанты Δ tps1 неспособны расти на нитрате из-за воздействия на активность нитратредуктазы (NR) [34]. НАДФН является кофактором нитратредуктазы и обеспечивает восстанавливающую способность.Достаточные пулы НАДФН необходимы для функции NR и вырабатываются окислительным пентозофосфатным путем посредством активации дегидрогеназы G6P (G6PDH). Было показано, что как уровни НАДФН, так и активность G6PDH снижены у мутантов Δ tps1 , что указывает на то, что экспрессия G6PDH находится под контролем Tps1 [34]. Сверхэкспрессия G6PDH восстанавливает дефект патогенности мутантов Δ tps1 , а недавно было показано, что Tps1 непосредственно связывается с NADPH, что указывает на более широкую регуляторную роль в использовании углерода и азота [11].Также было показано, что Tps1 является позитивным регулятором трех факторов транскрипции GATA в процессе, который негативно регулируется тремя NADP-зависимыми белками-ингибиторами Nmr. Факторы транскрипции GATA положительно регулируют экспрессию связанной с вирулентностью экспрессии генов способом, модулируемым активностью белков-ингибиторов ЯМР, и, в конечном итоге, зависят от клеточных уровней NADPH / NADP и G6P [11]. Поразительно, что мы наблюдали, что мутанты Δ agl1 и Δ gph2 уменьшают накопление трегалозы.Более того, гены, кодирующие фермент биосинтеза трегалозы, TPS1 и TPS3 , подавляются у мутантов по метаболизму гликогена. Поэтому мы предположили, что Agl1 и Gph2 могут регулировать экспрессию Tps1 и Tps3. Делеции NMR3 было достаточно для восстановления вирулентности двойного мутанта Δ agl1 Δ gph2 , хотя и с небольшими повреждениями. Это предполагает, что метаболизм гликогена может вносить вклад в контроль NADPH-зависимого генетического переключателя Tps1.Это интересно, потому что было показано, что экспрессия гена AGL1 и GPh2 и оборот гликогена затрагиваются в штаммах Δ tps1 [34], что позволяет предположить, что у дикого типа может существовать механизм отрицательной обратной связи для регулирования обмена гликогена в ответ на зондирование G6P. Таким образом, при совместном рассмотрении наше исследование позволило получить фундаментальную новую информацию о роли метаболизма гликогена в грибковом грибке Magnaporthe oryzae . Представленные здесь результаты предполагают, что метаболизм гликогена играет более широкую регуляторную роль, чем первоначально предполагалось, но вряд ли существует прямая потребность в деградации гликогена для подпитки опосредованного аппрессорием проникновения в кутикулу.Вместо этого эффект Agl1p и Gph2p на Tps1-зависимый генетический переключатель предполагает важную и неожиданную регуляторную роль во время инфекции растений.

Материалы и методы

Штаммы грибов и условия культивирования

Изоляты Magnaporthe oryzae , использованные в этом исследовании, хранятся в лаборатории NJT. Описанные мутанты с целевой заменой генов изогены по отношению к рису дикого типа ( Oryza sativa ) патогенный Magnaporthe штамм Guy-11.Состав сред и процедуры для культивирования и поддержания грибов, экстракции нуклеиновых кислот и ДНК-опосредованной трансформации были описаны ранее [41].

Анализ внутриклеточного гликогена

Гликоген в развивающихся аппрессориях визуализировали с помощью йодной окраски, состоящей из 60 мг KI и 10 мг I 2 мл -1 в дистиллированной воде [42]. Свежесобранные конидии в концентрации приблизительно 1 × 10 5 мл -1 инкубировали на гидрофобных пластиковых покровных стеклах либо в стандартной питательной среде (CM) с добавлением 2% дрожжевого экстракта, либо в дистиллированной воде в течение определенного периода времени.Через несколько секунд контакта с желто-коричневым пятном отложения гликогена можно было наблюдать микроскопически. Для измерения количества гликогена, присутствующего на стадиях развития M. oryzae , был разработан протокол, основанный на экспериментах, проведенных на S. cerevisiae . [17], [43] - [46]. Спорулирующие культуры M. oryzae в возрасте 12 дней в возрасте заливали стерильной дистиллированной водой и соскребали стеклянным разбрасывателем. Полученную суспензию фильтровали через стерильный miracloth (Calbiochem) и конидии выделяли центрифугированием при 20 ° C (5000 г , 10 минут).После промывки в дистиллированной воде конидии концентрировали центрифугированием и разбавляли приблизительно до 1 × 10 6 конидий на мл -1 . Образцы разделяли и инкубировали на гидрофобных пластиковых покровных стеклах в течение периодов времени 0, 2, 4, 6, 8, 24 или 48 часов перед переносом в микроцентрифужные пробирки, нагревали до 100 ° C в течение 10 минут для остановки ферментативного действия и охлаждали на льду. . Затем конидии были разрушены с помощью 10-минутной обработки ультразвуком, выполняемой 10-секундными импульсами с использованием ультразвукового устройства Vibracell (Sonics and Materials Inc., Данбери, США). Фрагменты клеток осаждали центрифугированием и 760 мкл супернатанта удаляли в свежую пробирку. К этому добавляли 100 мкл 50 мМ CaCl 2 и 100 мкл 0,5 М NaOAc pH 5,0 вместе со следующими ферментами, которые превращают гликоген в глюкозу: 29 мкл амилоглюкозидазы (Roche, Германия), 10 мкл α-амилазы (Sigma). В контрольном эксперименте эти ферменты были заменены стерильной дистиллированной водой. Реакции инкубировали в течение ночи при 57 ° C при постоянном вращении перед центрифугированием при 5,000 g в течение 3 минут.Для каждой временной точки супернатант из двенадцати аликвот по 50 мкл анализировали с помощью набора для анализа глюкозооксидазы (Sigma Diagnostics), в котором конечная интенсивность цвета пропорциональна концентрации глюкозы. Значения оптической плотности образца измеряли при 450 нм с использованием планшет-ридера Dynex Technologies MRX II (Jencons-PLS). Контроль без добавления фермента использовали для измерения фонового уровня глюкозы. Полный эксперимент проводился в трех биологических повторностях в отдельные дни, и средние уровни гликогена рассчитывались для каждой временной точки.Уровни гликогена анализировали с помощью линейных моделей смешанных эффектов для каждого мутантного штамма индивидуально, с культивированием как случайным эффектом и временем (часами) как фиксированным эффектом. Затем все попарные сравнения были выполнены с помощью тестов Tukey HSD для поддержания общего тестового уровня 5%. Средние значения и различия в средних значениях представлены с 95% семейным доверительным интервалом и скорректированными по Тьюки p-значениями. Пакеты nlme и multcomp в R v2.15 использовались для выполнения статистического анализа.

Идентификация и целенаправленная замена гена

M.oryzae AGL1 и GPh2

Геномная ДНК из M. oryzae была использована для амплификации полимеразной цепной реакции (ПЦР) с праймерами AGL1 ( 5'-GCGTACATGGCCTGCTTTGAACGTA-3 ') и AGL2 ( 5'-TGCTCTGTGTGAGGAGT000), разработанными к консервативным областям последовательности метки экспрессированной последовательности AGL1 (EST) из базы данных Института генетики Университета Клемсона (CUGI) (http://www.genome.clemson.edu/). ПЦР проводили с применением 35 циклов амплификации.После начальной денатурации в течение 5 минут при 94 ° C использовали следующие условия амплификации: 45 секунд денатурации при 94 ° C, 1 минута отжига при 55 ° C, 1 минута элонгации при 72 ° C. Затем следовало последнее 10-минутное удлинение при 72 ° C. Затем полученный фрагмент геномной ДНК размером 513 п.н. использовали для скрининга библиотеки конидиальной кДНК Guy-11 [15]. Истинный стартовый кодон и 5'-последовательность идентифицированной кДНК AGL1 определяли с использованием стратегии 5'-быстрой амплификации концов кДНК (5'-RACE) [47].Скрининг геномной библиотеки λGEM-11 [41] с клоном кДНК AGL1 выявил геномный клон лямбда Kpn I размером 6,5 т.п.н., названный pLh2. Геномную последовательность этого клона получали с использованием стратегии Genome Priming System (GPS). Эта система на основе транспозона Tn7 использует комплекс транспозазы для случайной вставки транспраймера в мишень дцДНК [48], [49]. Производится популяция продуктов, каждый с транспраймером, вставленным в другое место, и уникальные сайты праймирования на конце каждого транспраймера позволяют секвенировать обе нити целевой ДНК в месте вставки.Для замены гена ампликон 6,0 т.п.н., состоящий из ORF AGL1 с 5'-флангом 1,0 т.п.н., был амплифицирован из геномной ДНК M. oryzae Guy-11 с праймерами AGLvectorF ( 5'-CCTGACGGATAATGGTGGGGTG-3 ') и AGLvectorR ( 5'-CTTCGTCCGCAT CCATGTAGAG-3 '), сконструированный для последовательности генома M. oryzae , штамм 70-15 (http://www.genome.wi.mit.edu/annotation/fungi/magnaporthe /). ПЦР выполняли при следующих условиях: начальная 1 минута денатурации при 95 ° C, затем 30 циклов 1 минута денатурации при 95 ° C, 1 минута отжига при 60 ° C и 6 минут элонгации при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон клонировали в вектор pGEM-T (Promega) для создания плазмиды pLh4. Затем pLh4 расщепляли Hin dIII для высвобождения фрагмента 2,8 т.п.н. ORF AGL1 и линеаризованную плазмиду лигировали с генной кассетой фосфотрансферазы Hin dIII, связанной с 1,4 т.п.н. .

Ген M. oryzae GPh2 был идентифицирован аналогично AGL1 .Праймеры GPh2 ( 5'-CTTCCTCCAGTCAGTAGAGCG-3 ') и GPh3 ( 5'-TTTGAGGAAGTCATAGCTACCG-3' ) были сконструированы из консервативных областей генов, кодирующих GPH, с использованием последовательности EST из базы данных CUGI, показывающей высокую степень сходства. к генам гликогенфосфорилазы из S. cerevisiae [50], [51] и другие организмы. Фрагмент длиной 319 п.н. M. oryzae GPh2 амплифицировали с помощью ПЦР-амплификации в следующих условиях: начальная денатурация в течение 5 минут при 94 ° C, затем 35 циклов амплификации, включающих: 45 секунд денатурации при 94 ° C, 1 минуту отжиг при 54 ° C, удлинение в течение 1 минуты 30 секунд при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон очищали в геле, клонировали в вектор pBluescript (Stratagene) и использовали для скрининга библиотеки конидиальной кДНК Guy-11 [15]. 5'-RACE [47] использовали для определения 5'-последовательности и стартового кодона GPh2 с использованием специфичного для гена праймера, сконструированного для последовательности самого длинного клона кДНК. Чтобы сконструировать вектор замены гена GPh2 , ампликон размером 5,1 т.п.н., содержащий ORF GPh2 с приблизительно 1.0 kb, амплифицировали из геномной ДНК M. oryzae с использованием праймеров GPHnestedF ( 5'-GTTGCACTGAACCTCGAGTCTAGA-3 ') и GPHnestedR ( 5'-TTCGCCAAGG ATGCTGGGCTCAAG-3' последовательности 9 штамм M. oryzae 70-15. Стандартный протокол ПЦР был адаптирован для включения системы Taq Plus® Long PCR (Stratagene), предназначенной для амплификации длинных продуктов. Образцы нагревали до 94 ° C в течение 5 минут, затем применяли следующие условия для 35 циклов: 30 секунд денатурации при 94 ° C, 30 секунд отжиг при 55 ° C, удлинение 9 минут при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон размером 5165 п.о. очищали в геле и клонировали в вектор pGEM-T (Promega) для создания плазмиды pLh5. Расщепление pLh5 с помощью Bst BI высвободило фрагмент гена размером 2,2 т.п.н., который был заменен кассетой гена Hph , связанной 1,4 т.п.н. Bst BI, связанной с 1,4 т.п.н., для создания вектора делеции гена pLh5 H . Плазмиды pLh4 H и pLh5 H трансформировали в штамм M. oryzae Guy-11.Вставка одной копии плазмидной ДНК была подтверждена для всех трансформантов с помощью гель-блоттинга ДНК.

Нацеленная замена гена AGL1 в штамме Δ gph2 маркером устойчивости к сульфонилмочевине, ILV1 , для генерации Δ agl1 Δ gph2 с использованием стратегии гена-маркера расщепления (Catlett et al. , 2003). Замена была достигнута путем замены 1 т.п.н. 5'-открытой рамки считывания AGL1 геном ILV1 размером 2,8 т.п.н.В первом раунде ПЦР 1 т.п.н. фланкирующей последовательности с каждой стороны кодирующей области гена (названной LF и RF) амплифицировали с использованием праймеров Agl1-50.1 / Agl1-m13F и Agl1-30.1 / Agl1-m13R в комбинации, с использованием геномной ДНК Guy11. Agl1-m13F и Agl1-m13R имеют дополнительные 5'-последовательности, соответствующие праймерам M13F / M13R. Эта дополнительная последовательность облегчила проведение ПЦР с перекрытием слияния во втором раунде. В параллельной реакции селектируемый маркер ILV1 амплифицировали в двух частях с использованием праймеров M13F / SUR-F и M13R / SUR-R из кассетного гена устойчивости к сульфонилмочевине [36], а затем клонировали в pBluescript (Stratagene).Эти два продукта были названы IL и LV из гена ILV1 . Первую ПЦР проводили в следующих условиях цикла в градиентном цикле Applied Biosystems GeneAmp PCR System: этап начальной денатурации при 94 ° C в течение 5 минут, за которым следовали 35 циклов параметров цикла ПЦР, 94 ° C в течение 30 секунд, 62 ° C или 30 секунд и 72 ° C в течение 1 минуты с последующим окончательным удлинением при 72 ° C в течение 10 минут. Каждая реакция ПЦР на 25 мкл содержала 1 мкл ДНК-матрицы (50 нг), 20 пмоль каждого праймера, от 2 до 4 мМ MgCl 2 ,2.5 мкл термофильного 10-кратного реакционного буфера без MgCl 2 (500 мМ KCl, 100 мМ Tris-HCl [pH 9 при 25 ° C] и 1% Triton X-100), 2 мМ всех четырех дезоксинуклеозидтрифосфатов (dNTPs, Amersham BioSciences), 0,3 мкл Taq и 0,2 мкл ДНК-полимеразы Pfu . Полученный продукт анализировали гель-электрофорезом и очищали в геле. Во втором раунде ПЦР каждый фланг сливали с одной половиной селектируемого маркера (LF / IL и RF / LV) с использованием вложенных праймеров Agl1-nesF / IL, расщепления и Agl1-NesR / LV.Условия были установлены как начальная денатурация при 94 ° C в течение 5 минут с последующими 35 циклами параметров цикла ПЦР, 94 ° C в течение 30 секунд, 62 ° C в течение 30 секунд, 72 ° C в течение 3 минут, с последующим окончательным продлением при 72 ° C в течение 10 мин. Полученный продукт анализировали гель-электрофорезом и очищали в геле, готовым к грибковой трансформации. Гомологичная рекомбинация между перекрывающимися областями селектируемого маркера и хромосомной ДНК приводит к целенаправленной делеции гена [25]. Трансформанты подвергали скринингу с помощью ДНК-блоттинга.Последовательности праймеров, использованных в исследовании, показаны в таблице S1.

Анализы активности ферментов

Потеря активности амилоглюкозидазы в штаммах Δ agl1 и потеря активности гликогенфосфорилазы в штаммах Δ gph2 была подтверждена ферментативно с использованием белков, экстрагированных из Δ agl1 и Δ gph2, сравниваемых штаммов. к Guy11. Штаммы выращивали в GMM в течение 16 часов с последующей сушкой вымораживанием и подготовкой образцов, как описано ранее [12].Вкратце, 10 мг высушенного мицелия на штамм в трех экземплярах были тонко измельчены и повторно суспендированы в 1 мл стерильной дистиллированной H 2 O. Каждый образец был мгновенно заморожен в жидком азоте для разрушения мицелиальных клеток и высвобождения всех клеток. белок и центрифугировали 3 мин. После центрифугирования образцы хранили на льду. 50 мкл этого раствора, содержащего общий клеточный белок, аспирировали в трех экземплярах из каждого образца и добавляли к 1 мл каждого ферментного анализа. Все ферментные анализы проводили при 22 ° C.Все компоненты анализа были приобретены у Sigma. Активность ферментов определяли спектрофотометрически в трех экземплярах и выражали как концентрацию продукта, образованного за одну минуту общим клеточным белком из 1 мг мицелия. Активность амилоглюкозидазы [52] определяли путем инкубации 50 мкл каждого раствора общего клеточного белка с 1% раствором крахмала, избытком очищенной гексокиназы и избытком очищенной глюкозо-6-фосфатдегидрогеназы. Agl1 в образце белка высвобождает глюкозу из крахмала, который фосфорилируется гексокиназой, и образующийся глюкозо-6-фосфат используется для генерации НАДФН из НАДФ с использованием глюкозо-6-фосфатдегидрогеназы.Скорость увеличения НАДФН по мере продвижения ферментного анализа, измеренная спектрофотометрически при A 340 и сравниваемая со скоростью продукции НАДФН в анализах, не содержащих крахмала или экстракта вареного мицелиального белка, была измерена для расчета активности Agl1 в каждом образце. Для определения активности гликогенфосфорилазы [52] 50 мкл белкового экстракта из каждого образца добавляли к 1 мл ферментного анализа в трех экземплярах. Каждый анализ содержал 4% гликогена, избыток очищенной фосфоглюкомутазы и избыток очищенной глюкозо-6-фосфатдегидрогеназы.Gph2 высвобождает глюкозо-1-фосфат из гликогена, который фосфоглюкомутазой превращается в глюкозо-6-фосфат. Глюкозо-6-фосфатдегидрогеназа преобразовывала НАДФ в НАДФН с использованием глюкозо-6-фосфата, и скорость увеличения НАДФН по мере продвижения ферментативного анализа, измеренная при A 340 и по сравнению с контрольными реакциями без гликогена или белкового экстракта, использовалась для расчета активность Gph2 в каждом образце. Протоколы были получены с веб-сайта Sigma (www.sigma.com). Концентрации трегалозы измеряли, как описано ранее [12].Вкратце, образцы обрабатывали треалазой для высвобождения глюкозы из трегалозы, а глюкозу измеряли с использованием избытка очищенной гексокиназы для образования глюкозо-6-фосфата, который использовался избытком глюкозо-6-фосфатдегидрогеназы для образования НАДФН из НАДФ. Количество НАДФН, образованного в образцах, обработанных треалазой, по сравнению с теми же образцами, не обработанными треалазой, измеряли по A 340 и рассчитывали количество трегалозы в каждом образце.

Создание конструкции слитой плазмиды Agl1: sGFP

Ген AGL1 амплифицировали из геномной ДНК изогенного штамма Guy11 дикого типа с праймерами Agl1-Pro-U / Agl1-Fus-D, 2.Аллель гена ацетолактатсинтазы размером 8 т.п.н. ( ILV1 ), придающий устойчивость к сульфонилмочевине, был амплифицирован с праймерами Sur-U / Sur-D из pCB1532 [36], а 1,4 т.п.н. sGFP: trpC амплифицирован с праймерами GFP-U / TrpC-D. из pNOX1sGFP. Последовательности праймеров показаны в дополнительной таблице S1. Фрагменты ПЦР трансформировали дрожжами pNEB1284 Spe I / Hin dIII в S. cerevisiae . Слияние генов было сконструировано путем клонирования с восстановлением разрывов в дрожжах на основе гомологичной рекомбинации в дрожжах [53].Полученную плазмиду трансформировали в изогенный штамм дикого типа Guy11.

Создание конструкции слитой плазмиды Gph2: sGFP

Ампликон 4,1 т.п.н., состоящий из промотора M. oryzae GPh2 и открытой рамки считывания, амплифицировали с помощью ПЦР из геномной ДНК Guy11 с праймерами Gph2-P-SacII и Gph2-SpeI-D и клонировали в pGEM®-T (Promega). Фрагмент вырезали с помощью сайтов рестрикции Sac II / Spe I и клонировали в pCB1532, состоящую из аллеля гена устойчивости к сульфонилмочевине (ацетолактатсинтаза или ILV1 ), для получения pGPh2.Фрагмент 1,4 т.п.н. кассеты sGFP: trpC (Chiu et al. , 1996) амплифицировали с помощью ПЦР с использованием праймеров GFP-SpeI-U и TrpC-ClaI-D (дополнительная таблица S1) и затем клонировали в pGPh2 с Spe I ограничивающие сайты для создания слияния pGPh2sGFP. Плазмиду слияния трансформировали изогенным Guy11 из M. oryzae .

Фенотипический анализ мутантов

Для определения скорости вегетативного роста диаметр колонии измеряли через 12 дней роста на полной среде [41].Частоту и характер прорастания конидий и образования аппрессориев определяли микроскопически путем подсчета количества зародышевых трубок и / или аппрессорий, образовавшихся из конидий после инкубации на гидрофобных пластиковых покровных стеклах в течение различных периодов времени.

Мобилизацию гликогена визуализировали под микроскопом, как описано выше.

Влияние делеции каждого гена на патогенность грибов определяли путем распыления 5 × 10 4 спор / мл на чувствительные к CO-39 линии риса и восприимчивые линии ячменя Golden Promise, как описано ранее [41].

Для исследования генерации аппрессорного тургора был использован метод зарождающегося циторриза (клеточного коллапса) [54], [55]. Конидии в концентрации 2 × 10 4 мл -1 инкубировали на гидрофобных пластиковых покровных стеклах для индукции образования аппрессория. Затем удаляли окружающую воду и заменяли равным объемом раствора глицерина в диапазоне концентраций от 0,5 до 5,0 М. После 10 минут инкубации регистрировали количество разрушившихся аппрессорий.Проникновение аппрессорий в кутикулу изучали с помощью эпидермального пилинга лука, как описано Chida and Sisler (1987). Конидиям с концентрацией 5 × 10 4 спор / мл позволяли прорасти на эпидермисе лука, и скорость успешного апрессориум-опосредованного проникновения в эпидермис оценивали с помощью световой микроскопии. Все эксперименты проводили в трех повторностях.

Аппрессориум-опосредованное проникновение в оболочку рисового листа оценивали с использованием процедуры, основанной на процедуре Канканала и др. , 2007 [28].Конидиальную суспензию с концентрацией 1 × 10 5 спор мл -1 собирали в 0,25% желатине и инокулировали на оболочки листьев над средней жилкой. Инокулированные оболочки оставляли во влажных чашках Петри на 24, 36 и 48 ч в горизонтальном положении, чтобы суспензия оставалась на среднем участке вены. Когда они были готовы к микроскопии, оболочки были обрезаны вручную, чтобы удалить боковые стороны и нижнюю поверхность, чтобы обнажить одноклеточный эпидермальный слой средней вены (толщиной 2–3 клетки).Этот эпидермальный слой помещали на предметное стекло и наблюдали с помощью системы сканирующего конфокального света (CLSM) Zeiss LSM510 Meta.

Целенаправленная замена гена

GSN1 и NMR3

Нацеленная замена гена GSN1 и NMR3 была проведена в Guy11 и Δ agl1 Δ gph2 , соответственно, с использованием стратегии расщепленных маркеров, как объяснялось ранее, где GSN1 был заменен на резистентность к гигромицину B. Маркер hph и NMR3 был заменен селективным маркером устойчивости к биалафосу bar .Последовательности праймеров, использованных в исследовании, показаны в дополнительной таблице S1. После трансформации трансформанты подвергали скринингу в присутствии гигромицина B (200 мг / мл -1 ) на устойчивость к гигромицину и глюфосината аммония (100 мг / мл -1 ) на устойчивость к баялафосу. Замены генов подтверждали анализом ДНК-блоттинга.

Анализ экспрессии генов

Количественная ОТ-ПЦР была использована для характеристики экспрессии генов TPS1 и TPS3 у Guy-11, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2.Для анализа экспрессии генов мицелия, выращенного в полной среде, изогенный Guy-11 дикого типа, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 был инокулирован в CM 48 часов с последующей экстракцией РНК [41] , синтез кДНК и анализ QRT-PCR. Синтез кДНК выполняли с использованием набора для синтеза кДНК AffinityScript QPCR (Stratagene) в соответствии с протоколом производителя. Анализ экспрессии генов выполняли с использованием набора Brilliant Green QPCR Master Mix от Stratagene и прибора MX3005P (Stratagene) в соответствии с протоколом производителя.Экспрессию TPS1 , TPS3 и RSY1 анализировали с использованием праймеров Tps1-qRT-5 '( 5'-CTTATCGTCAACCCCTGGAAC-3' ) и Tps1-3 '( 5'-TCCCTTCCGTCTTC ), Tps3-qRT-5 '( 5'-CACATCAACGACGCCTGCGA-3 ) и Tps3-3' ( 5'-ATGTAGCTCTTGCCTCTGTGTT-3 ') и Rsy1-qRT-5' ( 5'CGAGTC ) и Rsy1-qRT-3 '( 5'-TTATTTGTCGCCAAAGGTCTCC-3' ). Экспрессия была нормализована относительно β-тубулина (MGG_00604.6) экспрессия гена с использованием праймеров QRT.PCR.BTubF ( CGCGGCCTCAAGATGTCGT ) и QRT.PCR.BTubR ( GCCTCCTCCTCGTACTCCTCTTCC ). Условиями ПЦР были 94 ° C в течение 30 секунд, 62 ° C в течение 30 секунд и 72 ° C в течение 30 секунд.

Дополнительная информация

Рисунок S3

Нацеленная делеция гена AGL1 и GPh2 в M. oryzae Guy11. А . Организация AGL1 , показывающая сайты рестрикции и ориентацию кодирующей области. В . Целевые векторы для замены гена с делецией гена AGL1 , демонстрирующие образование нулевых мутантов. С . ДНК-гель-блоттинг-анализ мутантов M. oryzae Δ agl1 . ДНК расщепляли Nhe I, фракционировали, блотировали и зондировали с помощью 2,8 т.п.н. Hin dIII- Hin dIII AGL1 удаленный фрагмент, 1,7 кб Hin dIII- Hin dIII AGL1 фрагмент промотора или кассету 1,4 кб Hph .Дорожка 1, Guy11; Дорожка 2–5, Δ agl1 мутанты; Дорожки 6 и 7, эктопические трансформанты agl1 . Д . Организация локуса ГПх2 Е . Целевые векторы для замены гена для делеции гена GPh2 , показывающие и генерирующие нулевые мутанты F . ДНК-гель-блот-анализ мутантов M. oryzae Δ gph2 . ДНК расщепляли Sph I, фракционировали, блотировали и зондировали удаленным фрагментом GPh2 в 2,2 т.п.н., a 1.Фрагмент промотора GPh2 размером 4 т.п.н. или кассета Hph размером 1,4 т.п.н. Дорожка 1, Guy11; Дорожки 2, 4 и 5, мутанты Δ gph2 ; Дорожки 3 и 6, эктопические трансформанты gph2 .

(PDF)

Рисунок S4

Направленное разрушение гена AGL1 в мутанте Δ gph2 из M. oryzae . А . Схематическое изображение локуса AGL1 , показывающее сайты рестрикции и ориентацию кодирующей области.ДНК выделяли и проверяли на предмет успешной целевой гомологичной рекомбинации в месте события B . ПЦР-анализ. Два праймера, Agl1-50.1 и Agl1-30.1, использовали для обнаружения разницы в размерах между эктопическими трансформантами и потенциальными двойными мутантами Δ agl1 Δ gph2 . L = 1 т.п.н. плюс ДНК-лестница (Invitrogen), G = геномная ДНК от Guy11, дорожки 1–10 геномной ДНК от предполагаемых трансформантов Δ agl1 Δ gph2 . Дорожки 6, 7, 10 = предполагаемые двойные мутанты Δ agl1 Δ gph2 . С . Предполагаемые мутанты Δ agl1 Δ gph2 проверяли с помощью гибридизационного анализа по Саузерну. Дорожка G = Guy11; Дорожка g = Δ gph2 ; дорожка 2 = эктопический трансформант 2; Дорожки 6, 7, 10 = предполагаемые двойные мутанты Δ agl1 Δ gph2 . Блот исследовали с удаленной областью AGL1 . Д . Была выделена общая РНК и синтезирована кДНК. 5'-кодирующая область AGL1 (789 п.н.) амплифицировали в неколичественной реакции ОТ-ПЦР.Все три анализа подтвердили успешное разрушение гена AGL1 в фоновом мутанте Δ gph2 . Трансформант 6 (AG-6) был выбран для дальнейшего фенотипического анализа и в дальнейшем обозначен как Δ agl1 Δ gph2 . L = 1 т.п.н. плюс ДНК-лестница, G = Guy11 (дикий тип), g = Δ gph2 , a = Δ agl1 , гДНК = геномная ДНК Guy11.

(PDF)

Рисунок S5

Комплементация Δ agl1 и Δ gph2 мутантов M.oryzae восстанавливает рост на крахмале. Полноразмерные гены AGL1 и GPh2 под контролем их нативных промоторов трансформировали в мутанты Δ gph2 и Δ gph2 соответственно и отобрали трансформанты. Анализы на планшете проводили на минимальной среде с крахмалом в качестве единственного источника углерода. Повторное введение каждого гена восстановило их способность расти на крахмале.

(PDF)

Рисунок S6

Аминокислотное выравнивание предсказанных M.oryzae Gsn1 с описанными гликогенсинтазами. Предсказанная аминокислотная последовательность M. oryzae GSN1 (MGG_07829.6) была сопоставлена ​​с продуктами транслирования Homo sapiensf , Gys1 & Gys2 и Saccharomyces cerevisiae , Gsy1 (YFR015C) и Gsy2 (YLR258W). Последовательности были идентифицированы из базы данных NCBI и SGD (http://www.yeastgenome.org/), выровнены с использованием ClustalW (Thompson et al. , 1994) и закрашены с помощью GeneDoc Version 2.6.002. Остатки в черном цвете идентичны для всех перечисленных белков, консервативные изменения показаны серым, а те, что на белом фоне, не показывают никакого сходства.Консервативные предполагаемые остатки серина или треонина, которые являются кандидатами на посттрансляционное фосфорилирование, показаны синим цветом.

(DOC)

Рисунок S7

Целенаправленная делеция гена GSN1 в M. oryzae Guy11. А . Схематическое изображение локуса GSN1 . В . ДНК выделяли, расщепляли Stu I и фракционировали в 0,8% агарозном геле. Гель обрабатывали методом саузерн-блоттинга и зондировали с помощью 2.Фрагмент 35 т.п.н. кодирующей области GSN1 , чтобы показать присутствие или отсутствие кодирующей области. Фрагмент 0,96 т.п.н. верхней фланкирующей области также использовали в качестве зонда для демонстрации полиморфизма длины рестрикционного фрагмента, показанного на нижней панели. Трансформанты G3, G10, G12 и G13 являются предполагаемыми мутантами Δ gsn1 . L = 1 т.п.н. плюс ДНК-лестница (Invitrogen). G2 и G4 = эктопические трансформанты.

(PDF)

Рисунок S8

Целенаправленная делеция гена NMR3 в мутанте M. Δ agl1 Δ gph2 .oryzae . А . Организация локуса NMR3 для демонстрации сайтов рестрикции Pst I и схематическое изображение, показывающее механизм делеции гена NMR3 с использованием стратегии расщепления маркеров. ДНК выделяли из трансформантов Δ agl1 Δ gph2 и предполагаемых Δ agl1 Δ gph2 Δ nmr3 и расщепляли Pst I. Расщепленную ДНК фракционировали в 0,8% агарозном геле и переносили в Hybond. -N. В . Мембрану зондировали 5'-фланкирующим фрагментом ДНК размером 1 т.п.н. для подтверждения мутантов Δ agl1 Δ gph2 Δ nmr3 на основе полиморфизма длины рестрикционного фрагмента. Трансформант 10 был выбран для дальнейшего фенотипического анализа и в дальнейшем назван Δ agl1 Δ gph2 Δ nmr3 . WT = Guy11, 1–11 = предполагаемый Δ agl1 Δ gph2 Δ nmr3 трансформантов и AG6 = Δ agl1 Δ gph2 .

(PDF)

Таблица S1

Олигонуклеотидные праймеры, использованные в этом исследовании.

(DOCX)

Гены метаболизма гликогена участвуют в регуляции патогенности, опосредованной трегалозой-6-фосфат-синтазой, грибком рисового взрыва Magnaporthe oryzae

Abstract

Нитчатый гриб Magnaporthe oryzae болезнь. Здесь мы показываем, что гены метаболизма гликогена играют важную роль в заражении растений M.oryzae . Нацеленная делеция AGL1 и GPh2 , которые кодируют амилоглюкозидазу и гликогенфосфорилазу, соответственно, предотвращала мобилизацию запасов гликогена во время развития аппрессория и вызывала значительное снижение способности M. oryzae вызывать болезнь рисового бласта. Напротив, целевая мутация GSN1 , кодирующая гликогенсинтазу, значительно снижает синтез внутриклеточного гликогена, но не влияет на патогенность грибов.Мы обнаружили, что потеря AGL1 и GPh2 привела к снижению экспрессии TPS1 и TPS3 , которые кодируют компоненты комплекса трегалоза-6-фосфатсинтаза, который действует как генетический переключатель в M. oryzae . Tps1 реагирует на уровни глюкозо-6-фосфата и баланс НАДФ / НАДФН, регулируя экспрессию генов, ассоциированную с вирулентностью, в сочетании с ингибиторами транскрипции Nmr. Мы показываем, что делеция гена ингибитора транскрипции NMR3 частично восстанавливает вирулентность мутанта Δ agl1Δgph2 , предполагая, что гены метаболизма гликогена необходимы для работы NADPH-зависимого генетического переключателя в M.oryzae .

Об авторе

Грибок Magnaporthe oryzae вызывает разрушительную болезнь риса, называемую взрывом. Ежегодно вирусная эпидемия риса уничтожает почти четверть потенциального урожая риса в мире. Грибок поражает рисовые растения, создавая особую инфекционную структуру, называемую аппрессорием, которая физически разрушает жесткую внешнюю кутикулу рисового листа. Magnaporthe может развивать аппрессории при отсутствии источника питательных веществ. Поэтому мы изучаем, как гриб использует запасы энергии в своих спорах для своего первоначального роста и развития.Гликоген является ключевым запасным соединением в грибах, и в этом исследовании мы исследовали, как происходит распад гликогена в грибах рисового бласта. Мы показали, что два основных фермента, разрушающих клеточные запасы гликогена, важны при болезни рисового бласта. Однако мы также обнаружили, что штамм гриба, у которого сильно нарушена способность синтезировать собственный гликоген, все еще может нормально инфицировать растения. Чтобы объяснить эти явно противоречивые результаты, мы исследовали регуляторную роль распада гликогена и предоставили доказательства того, что метаболизм гликогена является ключевым регулятором недавно описанного генетического переключателя, связанного с вирулентностью, в Магнапорте, который управляется ферментом, называемым трегалозо-6-фосфатсинтазой.

Введение

Райсовая болезнь является наиболее серьезным заболеванием культивируемого риса и в последние годы вызвала эпидемии в Южной Корее, Японии, Бутане и Китае [1], [2], что привело к серьезным потерям урожая. Поэтому понимание биологии рисовой пестициды важно для разработки надежных стратегий борьбы с этим заболеванием [2].

Рисовый грибок, Magnaporthe oryzae , вызывает заражение листьев риса, образуя специализированную инфекционную структуру, называемую аппрессорием [2].Это одноклеточная куполообразная структура, которая развивается из конца грибковой зародышевой трубки и отвечает за механическое повреждение кутикулы риса, позволяя грибку проникать в клетки растений. Развитие аппрессория регулируется клеточным циклом в M. oryzae с контрольными точками, регулирующими инициацию и созревание аппрессория [3], [4]. Дифференциация аппрессория сопровождается аутофагией в конидиуме, что приводит к запрограммированной гибели клеток и мобилизации содержимого трехклеточной споры в инфекционную клетку.Предотвращение аутофагии путем делеции любого из основных генов, связанных с неселективной макроаутофагией, делает гриб непатогенным, демонстрируя, что рециклинг содержимого конидия необходим для правильного функционирования аппрессория [3], [5 ].

Огромный тургор, создаваемый аппрессорием M. oryzae , является результатом накопления глицерина, который действует как совместимое растворенное вещество, вызывая приток воды в клетку для создания гидростатического давления [6].Отток глицерина предотвращается слоем меланина в клеточной стенке аппрессория, и мутанты, неспособные синтезировать меланин, не могут генерировать тургор и, следовательно, не являются патогенными. Ранее было показано, что запасы гликогена и липидные тела перемещаются из конидия в апрессорий M. oryzae до образования тургора [7] - [9]. Этот процесс контролируется Pmk1 MAP kinase pathway, который регулирует морфогенез appressorium [10] и, вероятно, связан с началом аутофагии в конидии [3].Распад липидов и гликогена в аппрессории контролируется путем ответа цАМФ, и мутанты cpkA , лишенные активности протеинкиназы А, обнаруживают значительные задержки в распаде липидов и гликогена [7]. Быстрые изменения первичного метаболизма во время созревания аппрессория, по-видимому, частично регулируются генетическим переключателем, опосредованным трегалозо-6-фосфатсинтазой (Tps), который реагирует на уровни глюкозо-6-фосфата (G6P) и баланс NADPH / NADP. в ячейках [11]. Tps-опосредованный переключатель генов взаимодействует с тремя ингибиторами транскрипции, которые регулируют экспрессию генов, связанных с вирулентностью, в ответ на преобладающие метаболические условия [11].

В этом исследовании мы исследовали роль метаболизма гликогена в функции аппрессория M. oryzae . Мы показываем, что запасы гликогена в споре быстро разрушаются во время прорастания спор в процессе, регулируемом путем ответа цАМФ. Мы демонстрируем, что гены гликогенфосфорилазы GPh2, и амилоглюкозидазы AGL1 , которые кодируют ферменты, необходимые для расщепления цитозольного гликогена, являются факторами вирулентности, участвующими в инфекции растений.Однако неожиданно мы также показали, что гликогенсинтаза, кодируемая геном GSN1 в M. oryzae , не обязательна для патогенности. Чтобы объяснить этот очевидный парадокс, мы приводим доказательства того, что потеря активности амилоглюкозидазы или гликогенфосфорилазы в M. oryzae приводит к снижению экспрессии TPS1 , тем самым влияя на регуляцию G6P / NADPH-зависимого гена [11] - [13] ]. В соответствии с этой идеей, мы показываем, что делеция NMR3 , одного из ингибиторов транскрипции, связанных с Tps1, частично восстанавливает вирулентность мутанта Δ gph2Δagl1 .Наши результаты показывают, что распад гликогена в аппрессории является важным фактором в регулировании экспрессии генов, связанных с вирулентностью.

Результаты

Мобилизация гликогена во время инфекционного развития

Magnaporthe oryzae

Чтобы исследовать роль мобилизации гликогена во время формирования аппрессория, мы сначала изучили клеточное распределение гранул гликогена в штамме M. oryzae дикого типа, Guy-11 и регуляторных мутантах, затронутых морфогенезом аппрессория.У Guy-11 непрораставшие конидии (0 ч инкубации) были богаты гликогеном, на что указывает темный осадок в каждой из трех конидиальных клеток после инкубации в растворе йода (), как описано ранее [7]. Во время прорастания и раннего образования аппрессория (2–4 ч) гликоген расщеплялся, а остаточный гликоген локализовался только в центральной клетке конидия. После 6 ч прорастания гликоген появился в зарождающемся апрессории, но быстро истощился во время созревания апрессория, пока через 24 часа не стали видны только темное кольцо меланина вокруг апрессория и небольшое количество зерен гликогена (, [7]).

Распределение клеток и количественный анализ гликогена во время морфогенеза аппрессоров у M. oryzae .

Микрофотографии мобилизации гликогена во время развития аппрессория M. oryzae . Конидии штаммов M. oryzae проращивали на гидрофобных пластиковых покровных стеклах. Образцы отбирали через 0 ч, 2 ч, 4 ч, 6 ч, 8 ч, 12 ч, 24 ч и 48 ч и окрашивали на наличие гликогена раствором йода. Желтовато-коричневые отложения гликогена сразу стали видны с помощью модулирующей оптики Хоффмана с микроскопом Nikon Optiphot-2. А . Штамм дикого типа Guy 11, проращенный в воде. В . ΔcpkA мутант DF51. С . Штамм дикого типа Guy 11 проращивали в полной среде (CM), содержащей 2% дрожжевого экстракта. Бар = 10 мкм. D – F Графики, показывающие биохимический анализ мобилизации гликогена во время формирования аппрессория M. oryzae Конидии проращивали в воде на гидрофобных пластиковых покровных стеклах и позволяли формировать аппрессории. Количество гликогена в пикограммах оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген. Д . Штамм дикого типа Guy 11. E . ΔcpkA мутант DF51. Ф . Δmac1 sum1-99 мутант DA-99. Каждая точка данных представляет собой среднее значение трех независимых повторов эксперимента. Планки погрешностей показывают стандартное отклонение.

Чтобы изучить роль пути цАМФ в мобилизации гликогена, мы исследовали мутант ΔcpkA (). CPKA кодирует каталитическую субъединицу цАМФ-зависимой протеинкиназы A [14], [15].Конидии изначально были богаты гликогеном, но деградация гликогена у мутантов ΔcpkA была отложена, гликоген все еще присутствовал в конидиях через 8 часов. Затем гликоген откладывался в деформированных аппрессориях ΔcpkA , но эти клетки не развивались полностью и гликоген не разрушался (). Мы пришли к выводу, что путь цАМФ регулирует эффективную деградацию гликогена во время прорастания и образования аппрессория. В соответствии с этой идеей, мутант супрессора обхода цАМФ Δmac1 sum1-99 [16], обнаруживает ускоренный распад гликогена в аппрессориях, как сообщалось ранее [7].

Чтобы определить, связана ли мобилизация гликогена с развитием аппрессориев, конидии Guy-11 проращивали в условиях с высоким содержанием питательных веществ (2% дрожжевой экстракт), которые подавляют образование аппрессориев [16]. Наблюдалась ограниченная деградация отложений гликогена, и через 48 ч гранулы гликогена можно было увидеть внутри разветвленных зародышевых трубок (). Таким образом, мобилизация гликогена из конидиума связана с морфогенезом аппрессория в условиях отсутствия питательных веществ.

Биохимический анализ мобилизации гликогена в развивающемся апрессории

Затем мы разработали анализ, позволяющий количественно оценить запасы гликогена, и обнаружили, что непроращенные конидии Guy11 содержат около 1200 пг гликогена ().Мы наблюдали 1500 пг гликогена проростков -1 через 2 часа прорастания, во время прорастания зародышевой трубочки, но между 2 и 12 часами после прорастания количество гликогена упало до 500 пг проростков -1 и оставалось на этом уровне во время созревания аппрессория. , что представляет собой среднее снижение на 988 пг с 95% семейным доверительным интервалом (667, 1310), p <0,001. За все 48 часов средний уровень гликогена снизился на 751 пг (95% ДИ 1073, 430 p <0.001). Сравнить эти результаты с предыдущими измерениями уровня гликогена в почкующихся дрожжах Saccharomyces cerevisiae [17], они должны быть преобразованы в фемтомоли (фмоль) на клетку. Количество клеток M. oryzae можно легко определить только через 0 ч (3-клеточный конидий) и 48 ч (одноклеточный апрессорий). Следовательно, непроращенный конидиум M. oryzae содержит в среднем 2363 фмоль клеток гликогена -1 , в то время как аппрессорий содержит 2450 фмоль клеток гликогена -1 .Значительная емкость гликогена клеток M. oryzae дикого типа подчеркивается, когда эти значения сравниваются с 19,5 фмоль гликогена, измеренным в дрожжевых клетках S. cerevisiae [17]. Мутант ΔcpkA содержал более низкие уровни гликогена, чем Guy11 (). В 0 ч мы обнаружили 800 мкг проростков гликогена -1 . Не было значительных изменений в уровнях гликогена ΔcpkA за весь период времени (общее среднее снижение на 13 пг [95% ДИ 354, 328 p = 1]).В цАМФ-независимом мутантном штамме PKA Δmac1 sum1-99 анализ гликогена выявил изначально высокие уровни гликогена в 1700 пг зародышей -1 (). Это продолжало увеличиваться до пика при 2100 пг проростков -1 через 4 часа (среднее увеличение от 0 до 4 часов для 450 пг [95% ДИ -265, 1164 p = 0,545]). Между 4 и 6 часами после прорастания, во время образования аппрессория, уровни гликогена быстро снижались в среднем на 986 пг проростков -1 (95% ДИ 1700, 272 p <0.001). Уровни снова повышались до 12 часов, достигая пика при более низком значении 1800 пг проростков -1 (среднее увеличение 646 пг [95% ДИ -152, 1445 p = 0,2156]. Затем гликоген постепенно снижался в среднем на 1340 пг за оставшиеся 36 часов (95% ДИ 2139, 541 p <0,001) до конечного значения примерно 400 пг проростки -1 через 48 ч. За весь период времени уровни гликогена в сумме Δmac11- 99 мутант уменьшился в среднем на 1230 пг (95% ДИ 1944, 516 p <0.001). Мы пришли к выводу, что путь ответа цАМФ регулирует мобилизацию гликогена во время развития аппрессория у M. oryzae .

Идентификация и характеристика

M. oryzae AGL1 и GPh2

Чтобы определить, необходима ли мобилизация гликогена для патогенности M. oryzae , мы идентифицировали основные ферменты, связанные с его расщеплением. Гликоген состоит из цепей глюкозы, связанных α-1,4-гликозидной связью, и примерно у каждого десятого остатка точка разветвления образована α-1,6-гликозидной связью.Амилоглюкозидаза (фермент разветвления гликогена) удаляет α-1,6-гликозидные связи из сильно разветвленного полимера, высвобождая глюкозу. Предполагаемый ген, кодирующий амилоглюкозидазу, AGL1 (MGG_00063.6), был идентифицирован в последовательности генома M. oryzae . [18]. AGL1 имеет открытую рамку считывания 4749 п.н., прерванную двумя интронами длиной 134 и 91 п.о., и кодирует предполагаемый белок из 1583 п.о. Сопоставление потенциального белка Agl1 M. oryzae с амилоглюкозидазами других организмов (рисунок S1) выявило 72% идентичности гипотетическому белку из Neurospora crassa и 47% идентичности ферменту разветвления гликогена Gdb1 S.cerevisiae [19]. Дальнейший анализ белковой последовательности выявил четыре консервативных участка аминокислот, присутствующих в α / β бочкообразном домене всех членов суперсемейства α-амилазы (данные не показаны). Разрушение гликогена также требует действия гликогенфосфорилазы. Этот фермент дополняет α-1,6-гликозидную активность амилоглюкозидазы, воздействуя на экзогликозидные α-1,4-гликогенные связи гликогена, последовательно отщепляя и фосфорилируя невосстанавливающие концы полимера.Был идентифицирован ген M. oryzae GPh2 (MGG_01819.6) и выявлена ​​ORF длиной 2664 п.о., кодирующая предполагаемый белок 888 аминокислотных остатков. В последовательности присутствовали два старт-сайта ATG в рамке считывания, самый 5'-из них имеет индикаторный нуклеотид старт-сайта, А, на -3 п.н. [20], который, вероятно, является сайтом инициации трансляции для GPh2 [21]. Белок показал 78% идентичности гипотетическому белку в N. crassa и 74% идентичности предполагаемой гликогенфосфорилазе из Aspergillus fumigatus (Рисунок S2).В S. cerevisiae сайт фосфорилирования присутствует в N-концевой области белка [22]. Белок M. oryzae демонстрирует высокую степень сходства с этой последовательностью, а остаток треонина, с которым связывается фосфат в дрожжевой гликогенфосфорилазе, является консервативным. Кроме того, все гликогенфосфорилазы обладают сайтом связывания для пиридоксаль-5'-фосфата, кофактора, участвующего в фосфорилировании. Альдегидная группа этого производного пиридоксина образует основание Шиффа со специфической лизиновой боковой цепью гликогенфосфорилазы [23].Аминокислотная последовательность, окружающая этот сайт, была идентифицирована в дрожжевой гликогенфосфорилазе [22] и является высококонсервативной в M. oryzae GPh2 с 17 из 18 остатков, идентичными у двух организмов (данные не показаны). Последовательность геномной ДНК длиной 3021 п.н. M. oryzae GPh2 также была идентифицирована из опубликованной последовательности генома [18]. Сравнение этой геномной последовательности с последовательностью кДНК GPh2 выявило присутствие четырех интронов.

Целенаправленная замена гена

M.oryzae AGL1 и GPh2

Чтобы изучить роль AGL1 и GPh2 в патогенности M. oryzae , мы выполнили целевую замену гена (рисунок S3A). Фрагмент Hin dIII размером 2,8 т.п.н. (рисунок S3B), содержащий большую часть 5'-области AGL1 , был удален и заменен кассетой гигромицинфосфотрансферазы [24], придающей устойчивость к гигромицину B. Полученная конструкция (рисунок S3B) ) вводили в Guy-11 и проверяли трансформанты с помощью гель-блоттинга ДНК (рис. S3C).Чтобы удалить GPh2 , часть кодирующей последовательности размером 3 т.п.н. в 2,2 т.п.н. была впоследствии заменена кассетой устойчивости 1,4 т.п.н. к гигромицин-фосфотрансферазе (рисунок S3D). Полученная кассета была введена в Guy-11 и отобраны трансформанты (Рисунок S3E).

Делецию каждого гена подтверждали измерением активности ферментов Agl1 и Gph2 (). Активность амилоглюкозидазы не была обнаружена в штамме Δ agl1 , а активность гликогенфосфорилазы не была обнаружена в мутантах Δ gph2 .Однако мы также наблюдали, что активность амилоглюкозидазы не может быть обнаружена в штаммах с делецией Δ gph2 . Амилоглюкозидаза расщепляет точки разветвления гликогена только тогда, когда они становятся доступными под действием гликогенфосфорилазы и, следовательно, не могут быть измерены в этом анализе.

Столбчатые диаграммы, показывающие активность амилоглюкозидазы и гликогенфосфорилазы у мутантов M. oryzae , метаболизирующих гликоген.

Подробнее о ферментативных анализах см. Материалы и методы. А . Активность амилоглюкозидазы не была обнаружена в мутантах Δ agl1 или, как следствие использованного анализа, в штаммах Δ gph2 . В . гликогенфосфорилазная активность отсутствовала у мутанта Δ gph2 .

Для создания двойного мутанта Δ agl1 Δ gph2 мы провели целевую делецию AGL1 в мутанте Δ gph2 , используя метод делеции гена маркера расщепления [25]. Конструкции с делецией генов трансформировали в Δ gph2 с использованием аллеля гена ацетолактатсинтазы, придающего устойчивость к сульфонилмочевине.Полученные трансформанты были отобраны и проанализированы с помощью гель-блоттинга ДНК (рис. S4). Кроме того, была проведена ОТ-ПЦР для подтверждения успешной делеции гена. В Guy11 и Δ gph2 был амплифицирован ампликон длиной 789 п.н., соответствующий транскрипту Agl1, но это не было обнаружено в мутантах Δ agl1 или двойных мутантах Δ agl1 Δ gph2 (рисунок S4D).

Δ

agl1 и Δ gph2 мутанты демонстрируют измененный метаболизм гликогена

Чтобы исследовать, затрагивается ли клеточное распределение гликогена у мутантов, несущих целевые делеции AGL1 и GPh2 , мы проанализировали мобилизацию гликогена во время образования Δagl1 , Δgph2 и Δ agl1 Δ gph2 ().Мобилизация гликогена замедлялась у мутантов Δ agl1 и Δ agl1 Δ gph2 , и гликоген не истощался из конидий до 24 часов по сравнению с 8–12 часами у Guy11. Напротив, мутанты Δ gph2 оказались менее подверженными мобилизации гликогена. Эти результаты предполагают, что амилоглюкозидаза более важна для эффективного разложения гликогена во время развития, связанного с инфекцией, чем гликогенфосфорилаза. Это может отражать способность недавно описанной глюкоамилазы выполнять α-1,4-гликозидную активность гликогенфосфорилазы и, таким образом, потенциально компенсировать потерю этой активности [25].Однако гликогенфосфорилаза важна для разрушения мицелиального гликогена, поскольку гликоген накапливается в штаммах Δ gph2 во время роста на минимальной среде (), но не в штаммах Δ agl1 .

Распределение клеток и количественная оценка гликогена во время морфогенеза аппрессория у мутантов Δ agl1 и Δ gph2 M. oryzae .

А . Конидии инкубировали на гидрофобных стеклянных покровных стеклах, чтобы позволить апрессориям развиться до окрашивания раствором йода.Мутанты Δ agl1 и Δ agl1 Δ gph2 были нарушены в мобилизации гликогена из конидия в аппрессорий и в последующей деградации в аппрессории, тогда как мутант Δ gph2 был сравним с Guy11. Шкала шкалы = 10 мкм. В . Количественное определение гликогена в экстрактах мицелия дикого типа и метаболических мутантах гликогена M. oryzae . Штаммы выращивали либо в жидкой CM в течение 48 часов, либо в CM с последующим выращиванием в GMM в течение 16 часов.Культуры собирали, промывали 0,2% CaCl 2 и сушили вымораживанием. Количество гликогена, присутствующего в мицелии -1 нмольмг, оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген. Значения, обозначенные разными буквами (a, b,), статистически значимы при p <0,01. С . Тесты роста, чтобы показать использование крахмала и гликогена в качестве единственных источников углерода. Минимальную среду, содержащую глюкозу, крахмал или гликоген, засевали мицелиальной пробкой М.oryzae и инкубировали в течение 12 дней. Чашки с крахмалом и гликогеном заливали йодом, чтобы визуализировать разницу в использовании субстрата. Йод окрашивает крахмал в синий цвет, а гликоген в коричневый цвет. У мутантов гликогена была нарушена их способность использовать как крахмал, так и гликоген в качестве единственного источника углерода.

Чтобы определить, способны ли мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 использовать внешний гликоген в качестве единственного источника углерода, мы провели тесты роста на различных источниках углерода.Оба мутанта Δ agl1 и Δ gph2 вместе с двойным мутантом Δ agl1 Δ gph2 были способны утилизировать глюкозу, но их рост был нарушен на гликогене и крахмале (). Повторное введение AGL1 и GPh2 в соответствующие нуль-мутанты дополняло мутантный фенотип (рисунок S5). Мы пришли к выводу, что мутанты Δ agl1 и Δ gph2 обладают нарушенной способностью использовать как крахмал, так и гликоген в качестве единственного источника углерода.

Agl1 и Gph2 локализуются в цитоплазме конидий, аппрессорий и инвазивных гиф

Для определения субклеточного расположения Agl1p и Gph2p во время образования аппрессория, AGL1: GFP и GPh2: GFP экспрессировали слияниями генов Guy11. . Слияния Agl1-GFP и Gph2-GFP локализуются по всей цитоплазме в конидиях Guy11 и внутри зародышевых трубок и возникающих аппрессорий к 2 часам и 4 часам соответственно (). Через 8 часов флуоресцентный сигнал наблюдался преимущественно в развивающемся апрессории, а через 24 часа Agl1-GFP и Gph2-GFP были обнаружены исключительно в цитоплазме апрессория.Интересно, что Agl1-Gfp и Gph2-Gfp также были высоко экспрессированы во время заражения растений через 36 часов и локализовались в цитоплазме внутриклеточных инвазивных гиф грибов (2).

Локализация Agl1-GFP и Gph2-GFP на разных стадиях морфогенеза аппрессория и в росте planta с помощью M. oryzae .

А . Конидиям давали возможность сформировать аппрессории, и локализацию Agl1-GFP и Gph2-GFP наблюдали в течение 24 часов с использованием инвертированного эпифлуоресцентного микроскопа Olympus IX-81, снабженного камерой HQ 2 .Слитые белки были локализованы в цитоплазме в конидиях, зародышевой трубке и апрессории. Шкала шкалы = 10 мкм. В . Конидии собирали из штаммов Agl1-GFP и Gph2-GFP и инкубировали на оболочке рисового листа во влажной камере. Конфокальную систему лазерного сканирующего микроскопа Zeiss LSM510 Meta использовали для наблюдения экспрессии Agl1-GFP и Gph2-GFP в эпидермальной ткани риса через 36 часов после инкубации. Agl1-GFP и Gph2-GFP экспрессировались цитоплазматически в инвазивных гифах. Шкала шкалы = 20 мкм.

М.oryzae Δ agl1 , Δ gph2 , Δ agl1 Δ gph2 мутанты обладают нарушенной способностью вызывать болезнь рисового бласта

Чтобы определить роль AGL1 и gph2 в патогенности GPh2 засевали восприимчивый сорт риса CO-39 и сорт ячменя Golden Promise однородными суспензиями спор каждого мутанта и Guy-11 (). У мутантов Δ agl1 и Δ gph2 количество повреждений уменьшилось на 50.44 ± 6% ( P <0,0001) и 44,7 ± 2,4% ( P <0,001), соответственно, тогда как у штамма Δ agl1 Δ gph2 количество поражений уменьшилось на 75,44 ± 1,4% ( P <0,0001) (). У мутантов не обнаружено дефектов прорастания конидий и образования аппрессориев в условиях отсутствия питательных веществ, и частота образования аппрессориев также не пострадала (данные не показаны). Ранее предполагалось, что распад гликогена может быть значительным в генерации тургора аппрессория [6], [7], [26].Поэтому мы измерили тургор аппрессория у мутантных штаммов Δ agl1 и Δ gph2 , используя анализ зарождающегося циторриза [6]. Несмотря на различия в мобилизации гликогена у мутантных штаммов (), мы не обнаружили существенных различий в тургоре между аппрессориями мутантных штаммов и Guy-11 (не показано). Затем мы использовали анализ эпидермиса лука [27], чтобы определить, может ли наблюдаемое снижение вирулентности быть следствием нарушения функции аппрессория. Однако не наблюдали значительных различий в эпидермальном проникновении между Guy-11 и мутантными штаммами Δagl1 , Δgph2 и Δagl1Δgph2 , которые обычно вырабатывали штыри для проникновения (не показаны).Следовательно, уменьшение образования повреждений, наблюдаемое для Δ agl1 , Δ gph2 и Δagl1Δgph2 , не является следствием пониженного тургорного давления или нарушения функции аппрессора. Чтобы исследовать колонизацию тканей каждым мутантом, был проведен анализ оболочки рисового листа [28]. Мы обнаружили, что мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 не обладают способностью к инвазивному росту внутри клеток риса. Мутанты, метаболизирующие гликоген, образовывали необычные инвазивные гифы, которые были менее выпуклыми и разветвленными, чем обычно ().Мы пришли к выводу, что мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 способны нормально проникать в клетки риса, но не могут эффективно размножаться в тканях риса, что приводит к уменьшению симптомов заболевания.

Анализы заражения и проникновения мутантов Δ agl1 , Δ gph2 и Δ agl1Δgph2 M. oryzae .

А . Пятнадцатидневные проростки риса сорта СО-39 или 8-дневные проростки ячменя Golden Promise опрыскивали конидиальной суспензией из 5 × 10 -4 спор спор -1 мл и инкубировали при 24 ° C. при сильном освещении и влажности 90% в течение 5 дней.Показанные листья представляют типичные симптомы, связанные с каждым штаммом. Эксперимент был повторен шесть раз с аналогичными результатами. Столбчатые диаграммы показывают плотности поражений, полученные на инфицированных листьях риса, выбранных случайным образом. Односторонний анализ ANOVA показал, что у мутантных штаммов была значительная недостаточность их способности вызывать болезнь рисового бласта. Значения, обозначенные разными буквами (a, b, c), статистически значимы при p <0,01. В . Для исследования инвазии в ткани хозяина конидии инкубировали на оболочке рисового листа в течение 36 часов и наблюдали с помощью лазерной конфокальной микроскопии.Штамм дикого типа Guy11 показал рост с инвазивными луковичными и разветвленными гифами. Мутанты по метаболизму гликогена продуцировали менее луковичные и разветвленные инвазивные гифы внутри рисовых клеток. Шкала шкалы = 20 мкм.

Идентификация гена, кодирующего гликоген-синтазу

M. oryzae

Учитывая важность мобилизации гликогена для вирулентности, мы решили создать штамм M. oryzae , запасы гликогена истощены. Предполагаемый ген, кодирующий гликоген-синтазу, был идентифицирован из M.База данных генома oryzae (http://www.broadinstitute.org/annotation/fungi/magnaporthe/) с использованием алгоритма BLASTX [29], основанного на его предсказанной аминокислотной гомологии с гликоген-синтазами дрожжей и млекопитающих. Одна последовательность, MGG_07289.6, выровнена с гликогенсинтазами дрожжей и млекопитающих [30], [31]. Предсказанный ген, кодирующий гликоген-синтазу, который мы назвали GSN1 , присутствует как единичный ген в геноме M. oryzae и, по прогнозам, содержит пять экзонов, прерванных четырьмя интронами [29].Предсказанный ген кодирует белок из 708 аминокислот и показал высокое сходство последовательностей с Gsy1p и Gsy2p дрожжей [30] и Gys1p и Gys2p специфичных для мышц и печени форм гликогенсинтазы человека [31]. На рисунке S6 показан результат выравнивания ClustalW [32]. S. cerevisiae Gsy1 и Gsy2 показали 63% и 64% идентичности с M. oryzae GSN1 , соответственно, тогда как Homo sapiens Gys1 и Gys2 показали идентичность 60% и 55% соответственно. Сайты фосфорилирования, предположительно участвующие в посттрансляционной регуляции Gsy2p, консервативны в M.oryzae Гсн1п. В Gsy2p три сайта фосфорилирования присутствуют в S650, S654 и T667 на C-конце [33], тогда как в Gsn1p предсказанные остатки присутствуют в положениях S632, S636 и T645 на C-конце, как показано на дополнительном рисунке S5.

Синтез гликогена не влияет на патогенность

M. oryzae

Для создания нулевого мутанта Δ gsn1 M. oryzae , целевую замену гена GSN1 проводили с использованием метода делеции гена маркера расщепления (рисунок S6A) [25].Конструкции с делецией генов трансформировали в Guy11, и предполагаемые трансформанты подвергали скринингу на основании их устойчивости к гигромицину B (фигура S7). У мутантов Δ gsn1 отложения гликогена не могли четко наблюдаться (), в отличие от Guy11 (). Для дальнейшего исследования мы измерили гликоген с помощью ферментативного анализа и наблюдали значительное снижение ( P <0,01) гликогена в клетках мутанта Δ gsn1 (). Мы пришли к выводу, что синтез гликогена серьезно нарушен как в конидиях, так и в аппрессориях в отсутствие гена гликогенсинтазы GSN1 .

Распределение гликогена в клетках во время морфогенеза аппрессория у мутанта гликоген-синтазы Δ gsn1 из M. oryzae .

А . Конидиям давали возможность образовать аппрессории, а затем проводили окрашивание раствором йода. Отложения гликогена отсутствовали в конидиях и на всем протяжении развития аппрессория. Шкала шкалы = 10 мкм. В . Анализы заражения мутантами Δ gsn1 . Споры собирали из 12-дневных культур Guy11 и мутанта Δ gsn1 и инокулировали распылением в концентрации 5 × 10 4 конидий мл -1 на 3-недельные проростки риса и 8-дневные проростки. рассада ячменя.Растения инокулировали при 24 ° C, сильном освещении и влажности 90% в течение пяти дней. Листья собирали и оценивали на наличие симптомов взрыва риса. Не наблюдалось очевидной разницы между патогенностью штамма Guy11 дикого типа и мутанта гликоген-синтазы Δ gsn1 . Эксперимент повторяли три раза с идентичными результатами, и не наблюдали статистически значимых различий в плотности или степени поражения (не показано). C. Количественное определение гликогена в конидиях дикого типа и мутантах гликогенсинтазы M.oryzae . Конидии собирали с 12-дневных чашек дикого типа и двух мутантов с делецией Δ gsn1 и разбавляли до концентрации 1 × 10 6 мл -1 . Количество гликогена в конидиях -1 мг / мл оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген (+). Также показано количество глюкозы без добавления ферментов, расщепляющих гликоген (-). Значения с разными буквами (a, b,) статистически значимы при p <0.01.

Изучить роль GSN1 в прогрессировании болезни рисовой пигментации, проростков риса CO-39 и ячменя сорта. Каждый Golden Promise был инокулирован мутантом гликогенсинтазы Δ gsn1 и штаммом дикого типа Guy11. Мутант Δ gsn1 был способен вызывать симптомы болезни рисового бласта, которые были идентичны штамму дикого типа, из которого можно сделать вывод, что этот ген является незаменимым для заражения рисовым бластом как у риса, так и у ячменя ().Мы пришли к выводу, что синтез гликогена в качестве запасного продукта в спорах у M. oryzae не является существенным для патогенности.

Δ

agl1 , Δ gph2 и Δ agl1 Δ gph2 мутанты влияют на синтез трегалозы

Мы были заинтригованы, обнаружив, что нарушение синтеза гликогена не влияет на вирулентность M. oryzae. при условии, что оба мутанта Δ agl1 и Δ gph2 показали такие выраженные дефекты в их способности вызывать болезнь рисового взрыва.Поэтому мы решили определить, были ли другие биохимические различия очевидны у любого из метаболических мутантов гликогена. Интересно, что мы наблюдали, что оба мутанта Δ agl1 и Δ gph2 показали пониженные уровни трегалозы во время вегетативного роста на CM (). Это предполагает, что в M. oryzae предшественники трегалозы, по крайней мере, во время роста мицелия, могут быть получены в результате деградации гликогена или на них влияет потеря активности этих ферментов. Поэтому мы проанализировали экспрессию TPS1 и TPS3 в мутантах Guy11, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 . TPS1 кодирует трегалозо-6-фосфат (T6P) синтазу, а TPS3 кодирует субъединицу комплекса T6P-синтаза / трегалоза фосфатаза [34]. Экспрессия TPS1 была снижена в 5 раз у мутантов Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 по сравнению с Guy11 (), тогда как экспрессия TPS3 была снижена в 6 раз при Δ . agl1 , 9 раз в Δ gph2 и в 50 раз в мутанте Δ agl1 Δ gph2 ().Мы также исследовали экспрессию гена RSY1 , участвующего в пути биосинтеза меланина [35], поскольку известно, что TPS1 регулирует экспрессию нескольких генов, связанных с вирулентностью, включая гены биосинтеза меланина, через генетический ген TPS1 / NMR . переключатель [11]. Экспрессия RSY1 также подавлялась в независимых одиночных и двойных мутантах (не показаны).

Анализ синтеза трегалозы у метаболических мутантов гликогена M.oryzae .

А . Количественное определение трегалозы в экстрактах мицелия. Штаммы выращивали либо в жидкой CM в течение 48 часов, либо в CM с последующим выращиванием в GMM в течение 16 часов. Культуры собирали, промывали 0,2% CaCl 2 и сушили вымораживанием. Экстракты мицелия получали с метилендихлоридом и метанолом и анализировали на трегалозу. Уровни трегалозы были значительно снижены у мутантов метаболизма гликогена по сравнению с Guy11. Эксперимент был повторен трижды с аналогичными результатами.Значения, обозначенные разными буквами (a, b, c, d), статистически значимы при p <0,01. В . Анализ экспрессии генов TPS1 и C . TPS3 в мицелии с помощью сравнительной количественной ОТ-ПЦР в реальном времени. Уровни транскриптов TPS1 , TPS3 были подавлены у мутантов, метаболизирующих гликоген. Эксперимент повторяли дважды, каждый с тремя техническими повторами, с аналогичными результатами. Односторонний анализ ANOVA показал, что мутантные штаммы имели значительные дефекты в экспрессии гена биосинтеза трегалозы.Обилие транскриптов показано относительно экспрессии гена M. oryzae β -тубулина (MGG_00604). Значения, обозначенные разными буквами (a, b, c, d), статистически значимы при p <0,01.

Делеция

NMR3 частично восстанавливает Δ agl1 Δ gph2 фенотип двойного мутанта

Известно, что M. oryzae Tps1 действует как G6P-чувствительный белок, напрямую связываясь с G6P и NADPH для контроля экспрессии набор ассоциированных с вирулентностью генов, экспрессируемых при заражении растений [11].Мы предположили, что если гены метаболизма гликогена ( AGL1 и GPh2 ) регулируют экспрессию TPS1 во время инфекции, то делеция одного из генов ингибитора транскрипции, который, как было показано, взаимодействует с Tps1p, может частично компенсировать фенотипические дефекты, связанные с Δ agl1 Δ gph2 двойной мутант [11]. Делеции NMR1 , NMR2 или NMR3 , например, было показано, что достаточно для восстановления патогенности мутанта Δ tps1 [11].Поэтому мы провели целенаправленную делецию гена NMR3 в двойном мутанте Δ agl1 Δ gph2 , поскольку двойные мутанты Δ tps1 Δ nmr3 показали максимальное восстановление патогенности [11]. Мы использовали стратегию расщепления маркеров для нацеливания на локус NMR3 для делеции гена, как показано на рисунке S8A. [25]. После трансформации трансформантов M. oryzae были первоначально проверены на устойчивость к биалафосу [36], и делеция была подтверждена с помощью гель-блоттинга ДНК (рис. S8B).

Для проверки вирулентности Δ agl1 Δ gph2 Δ nmr3 на восприимчивом сорте риса CO-39 был проведен анализ патогенности с использованием Guy11, Δ agl1 Δ gph2. agl1 Δ gph2 Δ nmr3 мутант. Мы обнаружили, что делеция гена NMR3 восстанавливала способность мутанта Δ agl1 Δ gph2 вызывать бластную болезнь, как показано на рис. Не наблюдалось существенной разницы в количестве повреждений между Guy11 и Δ agl1 Δ gph2 Δ nmr3 при заражении риса ( P <0.05) или инфекции ячменя (). Мы пришли к выводу, что AGL1 и GPh2 могут влиять на работу Tps1-опосредованного механизма регуляции гена, который необходим для болезни рисового бласта.

Анализ рисового бласта Δ agl1 Δ gph2 и Δ agl1 Δ gph2 Δ nmr3 мутанта M. oryzae .

А . 3-недельные проростки риса сорта СО-39 опрыскивали суспензией спор 5 × 10 4 спор -1 мл и инкубировали в течение 5 дней при 24 ° C. В . Поражения оценивали на случайно выбранных инфицированных листьях. Показанные листья представляют типичные симптомы, связанные с каждым испытанным штаммом. Эксперименты повторяли шесть раз с идентичными результатами. У Δ agl1 Δ gph2 Δ nmr3 была частично восстановлена ​​его способность вызывать бластную болезнь. Значения, обозначенные разными буквами (a, b), статистически значимы при p <0,01. C. 8-дневные проростки ячменя Golden Promise опрыскивали конидиальной суспензией из 5 × 10 -4 спор спор -1 мл и инкубировали при 24 ° C, сильном освещении и влажности 90% в течение 5 дней.Показанные листья представляют типичные симптомы, связанные с каждым штаммом. Эксперимент был повторен трижды с аналогичными результатами.

Обсуждение

В этом исследовании мы намеревались изучить роль метаболизма гликогена в возникновении болезни рисового бласта, вызываемой M. oryzae . Предыдущие сообщения установили, что мобилизация гликогена происходит во время развития аппрессория и может зависеть от cAMP-зависимой протеинкиназы A и путей передачи сигналов MAP kinase Pmk1 [7].Запасы гликогена в аппрессории также были предложены в качестве потенциального субстрата для производства глицерина в аппрессории, способствуя генерации тургора для разрыва кутикулы растения [6], [7], [26]. Запасы гликогена в аппрессориях, например, явно используются во время созревания аппрессориев до заражения растений [26]. При совместном рассмотрении результаты, представленные в этом исследовании, свидетельствуют о том, что деградация цитозольного гликогена в M. oryzae , которая требует гликогенфосфорилазы и амилоглюкозидазы, играет важную роль в вирулентности этого гриба.Этот вывод основан на мутантных фенотипах Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 двойных мутантов, у которых нарушена их способность вызывать бластную болезнь. Однако кажется вероятным, что влияние на вирулентность является плейотропным, а не специфически связанным с использованием резервов гликогена, поскольку мутанты Δ gsn1 , запасы гликогена которых значительно уменьшены из-за отсутствия активности гликогенсинтазы, не подвержены вирулентности.Этот результат предполагает, что запасы гликогена в конидиях и аппрессориях не обязательны для генерации тургора аппрессория и заражения растений. Представленные здесь данные также предполагают, что потеря GPh2 и AGL1 снижает экспрессию TPS1 , который, как известно, интегрирует контроль углеродного и азотного метаболизма в M. oryzae в ответ на уровни G6P и NADPH / NADP [11] .

В начале этого исследования мы были особенно заинтересованы в понимании того, как мобилизация гликогена происходила во время развития аппрессория M.oryzae . Поэтому изначально мы провели цитологический и биохимический анализ, чтобы изучить движение и распад запасов гликогена. Результаты этих экспериментов согласуются, показывая, что гликоген быстро разлагается во время прорастания конидий и что этот процесс замедляется у мутантов Δ cpkA , лишенных каталитической субъединицы протеинкиназы A. Наоборот, Δ mac1 sum1-99 мутант, шунтирующий супрессор нулевого мутанта аденилатциклазы, который несет мутацию в цАМФ-связывающем кармане регуляторной субъединицы протеинкиназы A [16], демонстрирует неправильную регуляцию хранения гликогена в споре.Это согласуется с более ранними предположениями, основанными исключительно на микроскопии [7], что мутанты Δ mac1 sum1-99 ускоряют распад гликогена и липидов. Взятые вместе, эти наблюдения предполагают, что путь ответа цАМФ играет важную роль в регуляции цитозольного метаболизма гликогена.

Чтобы исследовать роль распада гликогена в заражении растений M. oryzae , мы создали мутанты с делецией гена, лишенные активности ферментов амилоглюкозидазы и гликогенфосфорилазы.Фенотипический анализ показал, что двойные мутанты Δ agl1 и Δ agl1 Δ gph2 имели серьезные дефекты в расщеплении гликогена в конидиях, и через 24 часа розетки гликогена оставались видимыми в конидиях обоих мутантных штаммов. Гиперакопление гликогена ранее наблюдалось у мутантов Δ agl1 и Δ gph2 S. cerevisiae . [37], [38], демонстрируя важность этих ферментов для использования запасов гликогена.Предыдущее сообщение показало, что вакуолярная глюкоамилаза, Sga1, в M. oryzae может вносить вклад в утилизацию гликогена во время конидиогенеза [39]. Мутанты, лишенные активности Sga1, показали пониженную конидиацию, что согласуется с ролью вакуолярного аутофагического гидролиза гликогена во время развития спор. Интересно отметить, что мутанты Δ sga1 , однако, не проявили какого-либо влияния на развитие или патогенность аппрессоров [39], предполагая, что M. oryzae может разлагать гликоген посредством вакуолярного аутофагического механизма во время развития спор, но в основном цитозольный путь во время спор. прорастание и развитие аппрессориев, даже несмотря на то, что большой всплеск аутофагии связан с прорастанием конидий, запрограммированной гибелью клеток и созреванием аппрессориев [3], [5].Слияния генов Agl1-GFP и Gph2-GFP, например, подтвердили, что оба фермента локализованы в цитоплазме внутри конидий, зародышевых трубок и аппрессорий.

Фенотипы мутантов Δ agl1 и Δ gph2 согласуются с мобилизацией и использованием гликогена, оказывающими значительное влияние на способность M. oryzae вызывать болезнь, вызываемую грибковой инфекцией риса. Однако делеция GSN1 , который кодирует гликогенсинтазу, привела к значительному снижению уровней гликогена в клетках, но не оказала никакого влияния на патогенность M.oryzae .. Липиды, гликоген и трегалоза являются основными запасами питательных веществ, используемых конидиями M. oryzae для прорастания и дифференциации аппрессориев (см. обзор [2]). Основываясь на результатах, представленных здесь, кажется, что использование гликогена не может быть таким значительным фактором созревания апрессория, как гидролиз триацилглицерина [9]. Активность триацилглицерин липазы, например, индуцируется во время развития аппрессория у M. oryzae . [7].

Наиболее значимый вывод, который мы можем сделать относительно роли AGL1 и GPh2 в патогенности M.oryzae заключается в том, что отсутствие этих ферментных активностей снижает экспрессию гена TPS1 . Из M. oryzae известно, что активность Tps1 важна для болезни рисового бласта и формирует NADPH-зависимый генетический переключатель [11]. Мутанты, лишенные Tps1, способны продуцировать аппрессории, но они нефункциональны, и гриб не может колонизировать ткани риса [40]. Мутант Δ tps1 не продуцирует трегалозу или ее промежуточный трегалозо-6-фосфат (T6P), но нарушение патогенности происходит не просто из-за потери биосинтеза трегалозы.Мутации в G6P-связывающих карманах Tps1, например, сделали гриб непатогенным, в то время как мутации в каталитических сайтах, необходимых для синтеза T6P, не повлияли на его роль в заболевании, вызванном грибковой инфекцией риса, что позволяет предположить, что потеря связывания G6P связана с потерей патогенности [12]. Tps1 объединяет использование источников углерода и азота, а мутанты Δ tps1 неспособны расти на нитрате из-за воздействия на активность нитратредуктазы (NR) [34]. НАДФН является кофактором нитратредуктазы и обеспечивает восстанавливающую способность.Достаточные пулы НАДФН необходимы для функции NR и вырабатываются окислительным пентозофосфатным путем посредством активации дегидрогеназы G6P (G6PDH). Было показано, что как уровни НАДФН, так и активность G6PDH снижены у мутантов Δ tps1 , что указывает на то, что экспрессия G6PDH находится под контролем Tps1 [34]. Сверхэкспрессия G6PDH восстанавливает дефект патогенности мутантов Δ tps1 , а недавно было показано, что Tps1 непосредственно связывается с NADPH, что указывает на более широкую регуляторную роль в использовании углерода и азота [11].Также было показано, что Tps1 является позитивным регулятором трех факторов транскрипции GATA в процессе, который негативно регулируется тремя NADP-зависимыми белками-ингибиторами Nmr. Факторы транскрипции GATA положительно регулируют экспрессию связанной с вирулентностью экспрессии генов способом, модулируемым активностью белков-ингибиторов ЯМР, и, в конечном итоге, зависят от клеточных уровней NADPH / NADP и G6P [11]. Поразительно, что мы наблюдали, что мутанты Δ agl1 и Δ gph2 уменьшают накопление трегалозы.Более того, гены, кодирующие фермент биосинтеза трегалозы, TPS1 и TPS3 , подавляются у мутантов по метаболизму гликогена. Поэтому мы предположили, что Agl1 и Gph2 могут регулировать экспрессию Tps1 и Tps3. Делеции NMR3 было достаточно для восстановления вирулентности двойного мутанта Δ agl1 Δ gph2 , хотя и с небольшими повреждениями. Это предполагает, что метаболизм гликогена может вносить вклад в контроль NADPH-зависимого генетического переключателя Tps1.Это интересно, потому что было показано, что экспрессия гена AGL1 и GPh2 и оборот гликогена затрагиваются в штаммах Δ tps1 [34], что позволяет предположить, что у дикого типа может существовать механизм отрицательной обратной связи для регулирования обмена гликогена в ответ на зондирование G6P. Таким образом, при совместном рассмотрении наше исследование позволило получить фундаментальную новую информацию о роли метаболизма гликогена в грибковом грибке Magnaporthe oryzae . Представленные здесь результаты предполагают, что метаболизм гликогена играет более широкую регуляторную роль, чем первоначально предполагалось, но вряд ли существует прямая потребность в деградации гликогена для подпитки опосредованного аппрессорием проникновения в кутикулу.Вместо этого эффект Agl1p и Gph2p на Tps1-зависимый генетический переключатель предполагает важную и неожиданную регуляторную роль во время инфекции растений.

Материалы и методы

Штаммы грибов и условия культивирования

Изоляты Magnaporthe oryzae , использованные в этом исследовании, хранятся в лаборатории NJT. Описанные мутанты с целевой заменой генов изогены по отношению к рису дикого типа ( Oryza sativa ) патогенный Magnaporthe штамм Guy-11.Состав сред и процедуры для культивирования и поддержания грибов, экстракции нуклеиновых кислот и ДНК-опосредованной трансформации были описаны ранее [41].

Анализ внутриклеточного гликогена

Гликоген в развивающихся аппрессориях визуализировали с помощью йодной окраски, состоящей из 60 мг KI и 10 мг I 2 мл -1 в дистиллированной воде [42]. Свежесобранные конидии в концентрации приблизительно 1 × 10 5 мл -1 инкубировали на гидрофобных пластиковых покровных стеклах либо в стандартной питательной среде (CM) с добавлением 2% дрожжевого экстракта, либо в дистиллированной воде в течение определенного периода времени.Через несколько секунд контакта с желто-коричневым пятном отложения гликогена можно было наблюдать микроскопически. Для измерения количества гликогена, присутствующего на стадиях развития M. oryzae , был разработан протокол, основанный на экспериментах, проведенных на S. cerevisiae . [17], [43] - [46]. Спорулирующие культуры M. oryzae в возрасте 12 дней в возрасте заливали стерильной дистиллированной водой и соскребали стеклянным разбрасывателем. Полученную суспензию фильтровали через стерильный miracloth (Calbiochem) и конидии выделяли центрифугированием при 20 ° C (5000 г , 10 минут).После промывки в дистиллированной воде конидии концентрировали центрифугированием и разбавляли приблизительно до 1 × 10 6 конидий на мл -1 . Образцы разделяли и инкубировали на гидрофобных пластиковых покровных стеклах в течение периодов времени 0, 2, 4, 6, 8, 24 или 48 часов перед переносом в микроцентрифужные пробирки, нагревали до 100 ° C в течение 10 минут для остановки ферментативного действия и охлаждали на льду. . Затем конидии были разрушены с помощью 10-минутной обработки ультразвуком, выполняемой 10-секундными импульсами с использованием ультразвукового устройства Vibracell (Sonics and Materials Inc., Данбери, США). Фрагменты клеток осаждали центрифугированием и 760 мкл супернатанта удаляли в свежую пробирку. К этому добавляли 100 мкл 50 мМ CaCl 2 и 100 мкл 0,5 М NaOAc pH 5,0 вместе со следующими ферментами, которые превращают гликоген в глюкозу: 29 мкл амилоглюкозидазы (Roche, Германия), 10 мкл α-амилазы (Sigma). В контрольном эксперименте эти ферменты были заменены стерильной дистиллированной водой. Реакции инкубировали в течение ночи при 57 ° C при постоянном вращении перед центрифугированием при 5,000 g в течение 3 минут.Для каждой временной точки супернатант из двенадцати аликвот по 50 мкл анализировали с помощью набора для анализа глюкозооксидазы (Sigma Diagnostics), в котором конечная интенсивность цвета пропорциональна концентрации глюкозы. Значения оптической плотности образца измеряли при 450 нм с использованием планшет-ридера Dynex Technologies MRX II (Jencons-PLS). Контроль без добавления фермента использовали для измерения фонового уровня глюкозы. Полный эксперимент проводился в трех биологических повторностях в отдельные дни, и средние уровни гликогена рассчитывались для каждой временной точки.Уровни гликогена анализировали с помощью линейных моделей смешанных эффектов для каждого мутантного штамма индивидуально, с культивированием как случайным эффектом и временем (часами) как фиксированным эффектом. Затем все попарные сравнения были выполнены с помощью тестов Tukey HSD для поддержания общего тестового уровня 5%. Средние значения и различия в средних значениях представлены с 95% семейным доверительным интервалом и скорректированными по Тьюки p-значениями. Пакеты nlme и multcomp в R v2.15 использовались для выполнения статистического анализа.

Идентификация и целенаправленная замена гена

M.oryzae AGL1 и GPh2

Геномная ДНК из M. oryzae была использована для амплификации полимеразной цепной реакции (ПЦР) с праймерами AGL1 ( 5'-GCGTACATGGCCTGCTTTGAACGTA-3 ') и AGL2 ( 5'-TGCTCTGTGTGAGGAGT000), разработанными к консервативным областям последовательности метки экспрессированной последовательности AGL1 (EST) из базы данных Института генетики Университета Клемсона (CUGI) (http://www.genome.clemson.edu/). ПЦР проводили с применением 35 циклов амплификации.После начальной денатурации в течение 5 минут при 94 ° C использовали следующие условия амплификации: 45 секунд денатурации при 94 ° C, 1 минута отжига при 55 ° C, 1 минута элонгации при 72 ° C. Затем следовало последнее 10-минутное удлинение при 72 ° C. Затем полученный фрагмент геномной ДНК размером 513 п.н. использовали для скрининга библиотеки конидиальной кДНК Guy-11 [15]. Истинный стартовый кодон и 5'-последовательность идентифицированной кДНК AGL1 определяли с использованием стратегии 5'-быстрой амплификации концов кДНК (5'-RACE) [47].Скрининг геномной библиотеки λGEM-11 [41] с клоном кДНК AGL1 выявил геномный клон лямбда Kpn I размером 6,5 т.п.н., названный pLh2. Геномную последовательность этого клона получали с использованием стратегии Genome Priming System (GPS). Эта система на основе транспозона Tn7 использует комплекс транспозазы для случайной вставки транспраймера в мишень дцДНК [48], [49]. Производится популяция продуктов, каждый с транспраймером, вставленным в другое место, и уникальные сайты праймирования на конце каждого транспраймера позволяют секвенировать обе нити целевой ДНК в месте вставки.Для замены гена ампликон 6,0 т.п.н., состоящий из ORF AGL1 с 5'-флангом 1,0 т.п.н., был амплифицирован из геномной ДНК M. oryzae Guy-11 с праймерами AGLvectorF ( 5'-CCTGACGGATAATGGTGGGGTG-3 ') и AGLvectorR ( 5'-CTTCGTCCGCAT CCATGTAGAG-3 '), сконструированный для последовательности генома M. oryzae , штамм 70-15 (http://www.genome.wi.mit.edu/annotation/fungi/magnaporthe /). ПЦР выполняли при следующих условиях: начальная 1 минута денатурации при 95 ° C, затем 30 циклов 1 минута денатурации при 95 ° C, 1 минута отжига при 60 ° C и 6 минут элонгации при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон клонировали в вектор pGEM-T (Promega) для создания плазмиды pLh4. Затем pLh4 расщепляли Hin dIII для высвобождения фрагмента 2,8 т.п.н. ORF AGL1 и линеаризованную плазмиду лигировали с генной кассетой фосфотрансферазы Hin dIII, связанной с 1,4 т.п.н. .

Ген M. oryzae GPh2 был идентифицирован аналогично AGL1 .Праймеры GPh2 ( 5'-CTTCCTCCAGTCAGTAGAGCG-3 ') и GPh3 ( 5'-TTTGAGGAAGTCATAGCTACCG-3' ) были сконструированы из консервативных областей генов, кодирующих GPH, с использованием последовательности EST из базы данных CUGI, показывающей высокую степень сходства. к генам гликогенфосфорилазы из S. cerevisiae [50], [51] и другие организмы. Фрагмент длиной 319 п.н. M. oryzae GPh2 амплифицировали с помощью ПЦР-амплификации в следующих условиях: начальная денатурация в течение 5 минут при 94 ° C, затем 35 циклов амплификации, включающих: 45 секунд денатурации при 94 ° C, 1 минуту отжиг при 54 ° C, удлинение в течение 1 минуты 30 секунд при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон очищали в геле, клонировали в вектор pBluescript (Stratagene) и использовали для скрининга библиотеки конидиальной кДНК Guy-11 [15]. 5'-RACE [47] использовали для определения 5'-последовательности и стартового кодона GPh2 с использованием специфичного для гена праймера, сконструированного для последовательности самого длинного клона кДНК. Чтобы сконструировать вектор замены гена GPh2 , ампликон размером 5,1 т.п.н., содержащий ORF GPh2 с приблизительно 1.0 kb, амплифицировали из геномной ДНК M. oryzae с использованием праймеров GPHnestedF ( 5'-GTTGCACTGAACCTCGAGTCTAGA-3 ') и GPHnestedR ( 5'-TTCGCCAAGG ATGCTGGGCTCAAG-3' последовательности 9 штамм M. oryzae 70-15. Стандартный протокол ПЦР был адаптирован для включения системы Taq Plus® Long PCR (Stratagene), предназначенной для амплификации длинных продуктов. Образцы нагревали до 94 ° C в течение 5 минут, затем применяли следующие условия для 35 циклов: 30 секунд денатурации при 94 ° C, 30 секунд отжиг при 55 ° C, удлинение 9 минут при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон размером 5165 п.о. очищали в геле и клонировали в вектор pGEM-T (Promega) для создания плазмиды pLh5. Расщепление pLh5 с помощью Bst BI высвободило фрагмент гена размером 2,2 т.п.н., который был заменен кассетой гена Hph , связанной 1,4 т.п.н. Bst BI, связанной с 1,4 т.п.н., для создания вектора делеции гена pLh5 H . Плазмиды pLh4 H и pLh5 H трансформировали в штамм M. oryzae Guy-11.Вставка одной копии плазмидной ДНК была подтверждена для всех трансформантов с помощью гель-блоттинга ДНК.

Нацеленная замена гена AGL1 в штамме Δ gph2 маркером устойчивости к сульфонилмочевине, ILV1 , для генерации Δ agl1 Δ gph2 с использованием стратегии гена-маркера расщепления (Catlett et al. , 2003). Замена была достигнута путем замены 1 т.п.н. 5'-открытой рамки считывания AGL1 геном ILV1 размером 2,8 т.п.н.В первом раунде ПЦР 1 т.п.н. фланкирующей последовательности с каждой стороны кодирующей области гена (названной LF и RF) амплифицировали с использованием праймеров Agl1-50.1 / Agl1-m13F и Agl1-30.1 / Agl1-m13R в комбинации, с использованием геномной ДНК Guy11. Agl1-m13F и Agl1-m13R имеют дополнительные 5'-последовательности, соответствующие праймерам M13F / M13R. Эта дополнительная последовательность облегчила проведение ПЦР с перекрытием слияния во втором раунде. В параллельной реакции селектируемый маркер ILV1 амплифицировали в двух частях с использованием праймеров M13F / SUR-F и M13R / SUR-R из кассетного гена устойчивости к сульфонилмочевине [36], а затем клонировали в pBluescript (Stratagene).Эти два продукта были названы IL и LV из гена ILV1 . Первую ПЦР проводили в следующих условиях цикла в градиентном цикле Applied Biosystems GeneAmp PCR System: этап начальной денатурации при 94 ° C в течение 5 минут, за которым следовали 35 циклов параметров цикла ПЦР, 94 ° C в течение 30 секунд, 62 ° C или 30 секунд и 72 ° C в течение 1 минуты с последующим окончательным удлинением при 72 ° C в течение 10 минут. Каждая реакция ПЦР на 25 мкл содержала 1 мкл ДНК-матрицы (50 нг), 20 пмоль каждого праймера, от 2 до 4 мМ MgCl 2 ,2.5 мкл термофильного 10-кратного реакционного буфера без MgCl 2 (500 мМ KCl, 100 мМ Tris-HCl [pH 9 при 25 ° C] и 1% Triton X-100), 2 мМ всех четырех дезоксинуклеозидтрифосфатов (dNTPs, Amersham BioSciences), 0,3 мкл Taq и 0,2 мкл ДНК-полимеразы Pfu . Полученный продукт анализировали гель-электрофорезом и очищали в геле. Во втором раунде ПЦР каждый фланг сливали с одной половиной селектируемого маркера (LF / IL и RF / LV) с использованием вложенных праймеров Agl1-nesF / IL, расщепления и Agl1-NesR / LV.Условия были установлены как начальная денатурация при 94 ° C в течение 5 минут с последующими 35 циклами параметров цикла ПЦР, 94 ° C в течение 30 секунд, 62 ° C в течение 30 секунд, 72 ° C в течение 3 минут, с последующим окончательным продлением при 72 ° C в течение 10 мин. Полученный продукт анализировали гель-электрофорезом и очищали в геле, готовым к грибковой трансформации. Гомологичная рекомбинация между перекрывающимися областями селектируемого маркера и хромосомной ДНК приводит к целенаправленной делеции гена [25]. Трансформанты подвергали скринингу с помощью ДНК-блоттинга.Последовательности праймеров, использованных в исследовании, показаны в таблице S1.

Анализы активности ферментов

Потеря активности амилоглюкозидазы в штаммах Δ agl1 и потеря активности гликогенфосфорилазы в штаммах Δ gph2 была подтверждена ферментативно с использованием белков, экстрагированных из Δ agl1 и Δ gph2, сравниваемых штаммов. к Guy11. Штаммы выращивали в GMM в течение 16 часов с последующей сушкой вымораживанием и подготовкой образцов, как описано ранее [12].Вкратце, 10 мг высушенного мицелия на штамм в трех экземплярах были тонко измельчены и повторно суспендированы в 1 мл стерильной дистиллированной H 2 O. Каждый образец был мгновенно заморожен в жидком азоте для разрушения мицелиальных клеток и высвобождения всех клеток. белок и центрифугировали 3 мин. После центрифугирования образцы хранили на льду. 50 мкл этого раствора, содержащего общий клеточный белок, аспирировали в трех экземплярах из каждого образца и добавляли к 1 мл каждого ферментного анализа. Все ферментные анализы проводили при 22 ° C.Все компоненты анализа были приобретены у Sigma. Активность ферментов определяли спектрофотометрически в трех экземплярах и выражали как концентрацию продукта, образованного за одну минуту общим клеточным белком из 1 мг мицелия. Активность амилоглюкозидазы [52] определяли путем инкубации 50 мкл каждого раствора общего клеточного белка с 1% раствором крахмала, избытком очищенной гексокиназы и избытком очищенной глюкозо-6-фосфатдегидрогеназы. Agl1 в образце белка высвобождает глюкозу из крахмала, который фосфорилируется гексокиназой, и образующийся глюкозо-6-фосфат используется для генерации НАДФН из НАДФ с использованием глюкозо-6-фосфатдегидрогеназы.Скорость увеличения НАДФН по мере продвижения ферментного анализа, измеренная спектрофотометрически при A 340 и сравниваемая со скоростью продукции НАДФН в анализах, не содержащих крахмала или экстракта вареного мицелиального белка, была измерена для расчета активности Agl1 в каждом образце. Для определения активности гликогенфосфорилазы [52] 50 мкл белкового экстракта из каждого образца добавляли к 1 мл ферментного анализа в трех экземплярах. Каждый анализ содержал 4% гликогена, избыток очищенной фосфоглюкомутазы и избыток очищенной глюкозо-6-фосфатдегидрогеназы.Gph2 высвобождает глюкозо-1-фосфат из гликогена, который фосфоглюкомутазой превращается в глюкозо-6-фосфат. Глюкозо-6-фосфатдегидрогеназа преобразовывала НАДФ в НАДФН с использованием глюкозо-6-фосфата, и скорость увеличения НАДФН по мере продвижения ферментативного анализа, измеренная при A 340 и по сравнению с контрольными реакциями без гликогена или белкового экстракта, использовалась для расчета активность Gph2 в каждом образце. Протоколы были получены с веб-сайта Sigma (www.sigma.com). Концентрации трегалозы измеряли, как описано ранее [12].Вкратце, образцы обрабатывали треалазой для высвобождения глюкозы из трегалозы, а глюкозу измеряли с использованием избытка очищенной гексокиназы для образования глюкозо-6-фосфата, который использовался избытком глюкозо-6-фосфатдегидрогеназы для образования НАДФН из НАДФ. Количество НАДФН, образованного в образцах, обработанных треалазой, по сравнению с теми же образцами, не обработанными треалазой, измеряли по A 340 и рассчитывали количество трегалозы в каждом образце.

Создание конструкции слитой плазмиды Agl1: sGFP

Ген AGL1 амплифицировали из геномной ДНК изогенного штамма Guy11 дикого типа с праймерами Agl1-Pro-U / Agl1-Fus-D, 2.Аллель гена ацетолактатсинтазы размером 8 т.п.н. ( ILV1 ), придающий устойчивость к сульфонилмочевине, был амплифицирован с праймерами Sur-U / Sur-D из pCB1532 [36], а 1,4 т.п.н. sGFP: trpC амплифицирован с праймерами GFP-U / TrpC-D. из pNOX1sGFP. Последовательности праймеров показаны в дополнительной таблице S1. Фрагменты ПЦР трансформировали дрожжами pNEB1284 Spe I / Hin dIII в S. cerevisiae . Слияние генов было сконструировано путем клонирования с восстановлением разрывов в дрожжах на основе гомологичной рекомбинации в дрожжах [53].Полученную плазмиду трансформировали в изогенный штамм дикого типа Guy11.

Создание конструкции слитой плазмиды Gph2: sGFP

Ампликон 4,1 т.п.н., состоящий из промотора M. oryzae GPh2 и открытой рамки считывания, амплифицировали с помощью ПЦР из геномной ДНК Guy11 с праймерами Gph2-P-SacII и Gph2-SpeI-D и клонировали в pGEM®-T (Promega). Фрагмент вырезали с помощью сайтов рестрикции Sac II / Spe I и клонировали в pCB1532, состоящую из аллеля гена устойчивости к сульфонилмочевине (ацетолактатсинтаза или ILV1 ), для получения pGPh2.Фрагмент 1,4 т.п.н. кассеты sGFP: trpC (Chiu et al. , 1996) амплифицировали с помощью ПЦР с использованием праймеров GFP-SpeI-U и TrpC-ClaI-D (дополнительная таблица S1) и затем клонировали в pGPh2 с Spe I ограничивающие сайты для создания слияния pGPh2sGFP. Плазмиду слияния трансформировали изогенным Guy11 из M. oryzae .

Фенотипический анализ мутантов

Для определения скорости вегетативного роста диаметр колонии измеряли через 12 дней роста на полной среде [41].Частоту и характер прорастания конидий и образования аппрессориев определяли микроскопически путем подсчета количества зародышевых трубок и / или аппрессорий, образовавшихся из конидий после инкубации на гидрофобных пластиковых покровных стеклах в течение различных периодов времени.

Мобилизацию гликогена визуализировали под микроскопом, как описано выше.

Влияние делеции каждого гена на патогенность грибов определяли путем распыления 5 × 10 4 спор / мл на чувствительные к CO-39 линии риса и восприимчивые линии ячменя Golden Promise, как описано ранее [41].

Для исследования генерации аппрессорного тургора был использован метод зарождающегося циторриза (клеточного коллапса) [54], [55]. Конидии в концентрации 2 × 10 4 мл -1 инкубировали на гидрофобных пластиковых покровных стеклах для индукции образования аппрессория. Затем удаляли окружающую воду и заменяли равным объемом раствора глицерина в диапазоне концентраций от 0,5 до 5,0 М. После 10 минут инкубации регистрировали количество разрушившихся аппрессорий.Проникновение аппрессорий в кутикулу изучали с помощью эпидермального пилинга лука, как описано Chida and Sisler (1987). Конидиям с концентрацией 5 × 10 4 спор / мл позволяли прорасти на эпидермисе лука, и скорость успешного апрессориум-опосредованного проникновения в эпидермис оценивали с помощью световой микроскопии. Все эксперименты проводили в трех повторностях.

Аппрессориум-опосредованное проникновение в оболочку рисового листа оценивали с использованием процедуры, основанной на процедуре Канканала и др. , 2007 [28].Конидиальную суспензию с концентрацией 1 × 10 5 спор мл -1 собирали в 0,25% желатине и инокулировали на оболочки листьев над средней жилкой. Инокулированные оболочки оставляли во влажных чашках Петри на 24, 36 и 48 ч в горизонтальном положении, чтобы суспензия оставалась на среднем участке вены. Когда они были готовы к микроскопии, оболочки были обрезаны вручную, чтобы удалить боковые стороны и нижнюю поверхность, чтобы обнажить одноклеточный эпидермальный слой средней вены (толщиной 2–3 клетки).Этот эпидермальный слой помещали на предметное стекло и наблюдали с помощью системы сканирующего конфокального света (CLSM) Zeiss LSM510 Meta.

Целенаправленная замена гена

GSN1 и NMR3

Нацеленная замена гена GSN1 и NMR3 была проведена в Guy11 и Δ agl1 Δ gph2 , соответственно, с использованием стратегии расщепленных маркеров, как объяснялось ранее, где GSN1 был заменен на резистентность к гигромицину B. Маркер hph и NMR3 был заменен селективным маркером устойчивости к биалафосу bar .Последовательности праймеров, использованных в исследовании, показаны в дополнительной таблице S1. После трансформации трансформанты подвергали скринингу в присутствии гигромицина B (200 мг / мл -1 ) на устойчивость к гигромицину и глюфосината аммония (100 мг / мл -1 ) на устойчивость к баялафосу. Замены генов подтверждали анализом ДНК-блоттинга.

Анализ экспрессии генов

Количественная ОТ-ПЦР была использована для характеристики экспрессии генов TPS1 и TPS3 у Guy-11, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2.Для анализа экспрессии генов мицелия, выращенного в полной среде, изогенный Guy-11 дикого типа, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 был инокулирован в CM 48 часов с последующей экстракцией РНК [41] , синтез кДНК и анализ QRT-PCR. Синтез кДНК выполняли с использованием набора для синтеза кДНК AffinityScript QPCR (Stratagene) в соответствии с протоколом производителя. Анализ экспрессии генов выполняли с использованием набора Brilliant Green QPCR Master Mix от Stratagene и прибора MX3005P (Stratagene) в соответствии с протоколом производителя.Экспрессию TPS1 , TPS3 и RSY1 анализировали с использованием праймеров Tps1-qRT-5 '( 5'-CTTATCGTCAACCCCTGGAAC-3' ) и Tps1-3 '( 5'-TCCCTTCCGTCTTC ), Tps3-qRT-5 '( 5'-CACATCAACGACGCCTGCGA-3 ) и Tps3-3' ( 5'-ATGTAGCTCTTGCCTCTGTGTT-3 ') и Rsy1-qRT-5' ( 5'CGAGTC ) и Rsy1-qRT-3 '( 5'-TTATTTGTCGCCAAAGGTCTCC-3' ). Экспрессия была нормализована относительно β-тубулина (MGG_00604.6) экспрессия гена с использованием праймеров QRT.PCR.BTubF ( CGCGGCCTCAAGATGTCGT ) и QRT.PCR.BTubR ( GCCTCCTCCTCGTACTCCTCTTCC ). Условиями ПЦР были 94 ° C в течение 30 секунд, 62 ° C в течение 30 секунд и 72 ° C в течение 30 секунд.

Дополнительная информация

Рисунок S3

Нацеленная делеция гена AGL1 и GPh2 в M. oryzae Guy11. А . Организация AGL1 , показывающая сайты рестрикции и ориентацию кодирующей области. В . Целевые векторы для замены гена с делецией гена AGL1 , демонстрирующие образование нулевых мутантов. С . ДНК-гель-блоттинг-анализ мутантов M. oryzae Δ agl1 . ДНК расщепляли Nhe I, фракционировали, блотировали и зондировали с помощью 2,8 т.п.н. Hin dIII- Hin dIII AGL1 удаленный фрагмент, 1,7 кб Hin dIII- Hin dIII AGL1 фрагмент промотора или кассету 1,4 кб Hph .Дорожка 1, Guy11; Дорожка 2–5, Δ agl1 мутанты; Дорожки 6 и 7, эктопические трансформанты agl1 . Д . Организация локуса ГПх2 Е . Целевые векторы для замены гена для делеции гена GPh2 , показывающие и генерирующие нулевые мутанты F . ДНК-гель-блот-анализ мутантов M. oryzae Δ gph2 . ДНК расщепляли Sph I, фракционировали, блотировали и зондировали удаленным фрагментом GPh2 в 2,2 т.п.н., a 1.Фрагмент промотора GPh2 размером 4 т.п.н. или кассета Hph размером 1,4 т.п.н. Дорожка 1, Guy11; Дорожки 2, 4 и 5, мутанты Δ gph2 ; Дорожки 3 и 6, эктопические трансформанты gph2 .

(PDF)

Рисунок S4

Направленное разрушение гена AGL1 в мутанте Δ gph2 из M. oryzae . А . Схематическое изображение локуса AGL1 , показывающее сайты рестрикции и ориентацию кодирующей области.ДНК выделяли и проверяли на предмет успешной целевой гомологичной рекомбинации в месте события B . ПЦР-анализ. Два праймера, Agl1-50.1 и Agl1-30.1, использовали для обнаружения разницы в размерах между эктопическими трансформантами и потенциальными двойными мутантами Δ agl1 Δ gph2 . L = 1 т.п.н. плюс ДНК-лестница (Invitrogen), G = геномная ДНК от Guy11, дорожки 1–10 геномной ДНК от предполагаемых трансформантов Δ agl1 Δ gph2 . Дорожки 6, 7, 10 = предполагаемые двойные мутанты Δ agl1 Δ gph2 . С . Предполагаемые мутанты Δ agl1 Δ gph2 проверяли с помощью гибридизационного анализа по Саузерну. Дорожка G = Guy11; Дорожка g = Δ gph2 ; дорожка 2 = эктопический трансформант 2; Дорожки 6, 7, 10 = предполагаемые двойные мутанты Δ agl1 Δ gph2 . Блот исследовали с удаленной областью AGL1 . Д . Была выделена общая РНК и синтезирована кДНК. 5'-кодирующая область AGL1 (789 п.н.) амплифицировали в неколичественной реакции ОТ-ПЦР.Все три анализа подтвердили успешное разрушение гена AGL1 в фоновом мутанте Δ gph2 . Трансформант 6 (AG-6) был выбран для дальнейшего фенотипического анализа и в дальнейшем обозначен как Δ agl1 Δ gph2 . L = 1 т.п.н. плюс ДНК-лестница, G = Guy11 (дикий тип), g = Δ gph2 , a = Δ agl1 , гДНК = геномная ДНК Guy11.

(PDF)

Рисунок S5

Комплементация Δ agl1 и Δ gph2 мутантов M.oryzae восстанавливает рост на крахмале. Полноразмерные гены AGL1 и GPh2 под контролем их нативных промоторов трансформировали в мутанты Δ gph2 и Δ gph2 соответственно и отобрали трансформанты. Анализы на планшете проводили на минимальной среде с крахмалом в качестве единственного источника углерода. Повторное введение каждого гена восстановило их способность расти на крахмале.

(PDF)

Рисунок S6

Аминокислотное выравнивание предсказанных M.oryzae Gsn1 с описанными гликогенсинтазами. Предсказанная аминокислотная последовательность M. oryzae GSN1 (MGG_07829.6) была сопоставлена ​​с продуктами транслирования Homo sapiensf , Gys1 & Gys2 и Saccharomyces cerevisiae , Gsy1 (YFR015C) и Gsy2 (YLR258W). Последовательности были идентифицированы из базы данных NCBI и SGD (http://www.yeastgenome.org/), выровнены с использованием ClustalW (Thompson et al. , 1994) и закрашены с помощью GeneDoc Version 2.6.002. Остатки в черном цвете идентичны для всех перечисленных белков, консервативные изменения показаны серым, а те, что на белом фоне, не показывают никакого сходства.Консервативные предполагаемые остатки серина или треонина, которые являются кандидатами на посттрансляционное фосфорилирование, показаны синим цветом.

(DOC)

Рисунок S7

Целенаправленная делеция гена GSN1 в M. oryzae Guy11. А . Схематическое изображение локуса GSN1 . В . ДНК выделяли, расщепляли Stu I и фракционировали в 0,8% агарозном геле. Гель обрабатывали методом саузерн-блоттинга и зондировали с помощью 2.Фрагмент 35 т.п.н. кодирующей области GSN1 , чтобы показать присутствие или отсутствие кодирующей области. Фрагмент 0,96 т.п.н. верхней фланкирующей области также использовали в качестве зонда для демонстрации полиморфизма длины рестрикционного фрагмента, показанного на нижней панели. Трансформанты G3, G10, G12 и G13 являются предполагаемыми мутантами Δ gsn1 . L = 1 т.п.н. плюс ДНК-лестница (Invitrogen). G2 и G4 = эктопические трансформанты.

(PDF)

Рисунок S8

Целенаправленная делеция гена NMR3 в мутанте M. Δ agl1 Δ gph2 .oryzae . А . Организация локуса NMR3 для демонстрации сайтов рестрикции Pst I и схематическое изображение, показывающее механизм делеции гена NMR3 с использованием стратегии расщепления маркеров. ДНК выделяли из трансформантов Δ agl1 Δ gph2 и предполагаемых Δ agl1 Δ gph2 Δ nmr3 и расщепляли Pst I. Расщепленную ДНК фракционировали в 0,8% агарозном геле и переносили в Hybond. -N. В . Мембрану зондировали 5'-фланкирующим фрагментом ДНК размером 1 т.п.н. для подтверждения мутантов Δ agl1 Δ gph2 Δ nmr3 на основе полиморфизма длины рестрикционного фрагмента. Трансформант 10 был выбран для дальнейшего фенотипического анализа и в дальнейшем назван Δ agl1 Δ gph2 Δ nmr3 . WT = Guy11, 1–11 = предполагаемый Δ agl1 Δ gph2 Δ nmr3 трансформантов и AG6 = Δ agl1 Δ gph2 .

(PDF)

Таблица S1

Олигонуклеотидные праймеры, использованные в этом исследовании.

(DOCX)

Гены метаболизма гликогена участвуют в регуляции патогенности, опосредованной трегалозой-6-фосфат-синтазой, грибком рисового взрыва Magnaporthe oryzae

Abstract

Нитчатый гриб Magnaporthe oryzae болезнь. Здесь мы показываем, что гены метаболизма гликогена играют важную роль в заражении растений M.oryzae . Нацеленная делеция AGL1 и GPh2 , которые кодируют амилоглюкозидазу и гликогенфосфорилазу, соответственно, предотвращала мобилизацию запасов гликогена во время развития аппрессория и вызывала значительное снижение способности M. oryzae вызывать болезнь рисового бласта. Напротив, целевая мутация GSN1 , кодирующая гликогенсинтазу, значительно снижает синтез внутриклеточного гликогена, но не влияет на патогенность грибов.Мы обнаружили, что потеря AGL1 и GPh2 привела к снижению экспрессии TPS1 и TPS3 , которые кодируют компоненты комплекса трегалоза-6-фосфатсинтаза, который действует как генетический переключатель в M. oryzae . Tps1 реагирует на уровни глюкозо-6-фосфата и баланс НАДФ / НАДФН, регулируя экспрессию генов, ассоциированную с вирулентностью, в сочетании с ингибиторами транскрипции Nmr. Мы показываем, что делеция гена ингибитора транскрипции NMR3 частично восстанавливает вирулентность мутанта Δ agl1Δgph2 , предполагая, что гены метаболизма гликогена необходимы для работы NADPH-зависимого генетического переключателя в M.oryzae .

Об авторе

Грибок Magnaporthe oryzae вызывает разрушительную болезнь риса, называемую взрывом. Ежегодно вирусная эпидемия риса уничтожает почти четверть потенциального урожая риса в мире. Грибок поражает рисовые растения, создавая особую инфекционную структуру, называемую аппрессорием, которая физически разрушает жесткую внешнюю кутикулу рисового листа. Magnaporthe может развивать аппрессории при отсутствии источника питательных веществ. Поэтому мы изучаем, как гриб использует запасы энергии в своих спорах для своего первоначального роста и развития.Гликоген является ключевым запасным соединением в грибах, и в этом исследовании мы исследовали, как происходит распад гликогена в грибах рисового бласта. Мы показали, что два основных фермента, разрушающих клеточные запасы гликогена, важны при болезни рисового бласта. Однако мы также обнаружили, что штамм гриба, у которого сильно нарушена способность синтезировать собственный гликоген, все еще может нормально инфицировать растения. Чтобы объяснить эти явно противоречивые результаты, мы исследовали регуляторную роль распада гликогена и предоставили доказательства того, что метаболизм гликогена является ключевым регулятором недавно описанного генетического переключателя, связанного с вирулентностью, в Магнапорте, который управляется ферментом, называемым трегалозо-6-фосфатсинтазой.

Введение

Райсовая болезнь является наиболее серьезным заболеванием культивируемого риса и в последние годы вызвала эпидемии в Южной Корее, Японии, Бутане и Китае [1], [2], что привело к серьезным потерям урожая. Поэтому понимание биологии рисовой пестициды важно для разработки надежных стратегий борьбы с этим заболеванием [2].

Рисовый грибок, Magnaporthe oryzae , вызывает заражение листьев риса, образуя специализированную инфекционную структуру, называемую аппрессорием [2].Это одноклеточная куполообразная структура, которая развивается из конца грибковой зародышевой трубки и отвечает за механическое повреждение кутикулы риса, позволяя грибку проникать в клетки растений. Развитие аппрессория регулируется клеточным циклом в M. oryzae с контрольными точками, регулирующими инициацию и созревание аппрессория [3], [4]. Дифференциация аппрессория сопровождается аутофагией в конидиуме, что приводит к запрограммированной гибели клеток и мобилизации содержимого трехклеточной споры в инфекционную клетку.Предотвращение аутофагии путем делеции любого из основных генов, связанных с неселективной макроаутофагией, делает гриб непатогенным, демонстрируя, что рециклинг содержимого конидия необходим для правильного функционирования аппрессория [3], [5 ].

Огромный тургор, создаваемый аппрессорием M. oryzae , является результатом накопления глицерина, который действует как совместимое растворенное вещество, вызывая приток воды в клетку для создания гидростатического давления [6].Отток глицерина предотвращается слоем меланина в клеточной стенке аппрессория, и мутанты, неспособные синтезировать меланин, не могут генерировать тургор и, следовательно, не являются патогенными. Ранее было показано, что запасы гликогена и липидные тела перемещаются из конидия в апрессорий M. oryzae до образования тургора [7] - [9]. Этот процесс контролируется Pmk1 MAP kinase pathway, который регулирует морфогенез appressorium [10] и, вероятно, связан с началом аутофагии в конидии [3].Распад липидов и гликогена в аппрессории контролируется путем ответа цАМФ, и мутанты cpkA , лишенные активности протеинкиназы А, обнаруживают значительные задержки в распаде липидов и гликогена [7]. Быстрые изменения первичного метаболизма во время созревания аппрессория, по-видимому, частично регулируются генетическим переключателем, опосредованным трегалозо-6-фосфатсинтазой (Tps), который реагирует на уровни глюкозо-6-фосфата (G6P) и баланс NADPH / NADP. в ячейках [11]. Tps-опосредованный переключатель генов взаимодействует с тремя ингибиторами транскрипции, которые регулируют экспрессию генов, связанных с вирулентностью, в ответ на преобладающие метаболические условия [11].

В этом исследовании мы исследовали роль метаболизма гликогена в функции аппрессория M. oryzae . Мы показываем, что запасы гликогена в споре быстро разрушаются во время прорастания спор в процессе, регулируемом путем ответа цАМФ. Мы демонстрируем, что гены гликогенфосфорилазы GPh2, и амилоглюкозидазы AGL1 , которые кодируют ферменты, необходимые для расщепления цитозольного гликогена, являются факторами вирулентности, участвующими в инфекции растений.Однако неожиданно мы также показали, что гликогенсинтаза, кодируемая геном GSN1 в M. oryzae , не обязательна для патогенности. Чтобы объяснить этот очевидный парадокс, мы приводим доказательства того, что потеря активности амилоглюкозидазы или гликогенфосфорилазы в M. oryzae приводит к снижению экспрессии TPS1 , тем самым влияя на регуляцию G6P / NADPH-зависимого гена [11] - [13] ]. В соответствии с этой идеей, мы показываем, что делеция NMR3 , одного из ингибиторов транскрипции, связанных с Tps1, частично восстанавливает вирулентность мутанта Δ gph2Δagl1 .Наши результаты показывают, что распад гликогена в аппрессории является важным фактором в регулировании экспрессии генов, связанных с вирулентностью.

Результаты

Мобилизация гликогена во время инфекционного развития

Magnaporthe oryzae

Чтобы исследовать роль мобилизации гликогена во время формирования аппрессория, мы сначала изучили клеточное распределение гранул гликогена в штамме M. oryzae дикого типа, Guy-11 и регуляторных мутантах, затронутых морфогенезом аппрессория.У Guy-11 непрораставшие конидии (0 ч инкубации) были богаты гликогеном, на что указывает темный осадок в каждой из трех конидиальных клеток после инкубации в растворе йода (), как описано ранее [7]. Во время прорастания и раннего образования аппрессория (2–4 ч) гликоген расщеплялся, а остаточный гликоген локализовался только в центральной клетке конидия. После 6 ч прорастания гликоген появился в зарождающемся апрессории, но быстро истощился во время созревания апрессория, пока через 24 часа не стали видны только темное кольцо меланина вокруг апрессория и небольшое количество зерен гликогена (, [7]).

Распределение клеток и количественный анализ гликогена во время морфогенеза аппрессоров у M. oryzae .

Микрофотографии мобилизации гликогена во время развития аппрессория M. oryzae . Конидии штаммов M. oryzae проращивали на гидрофобных пластиковых покровных стеклах. Образцы отбирали через 0 ч, 2 ч, 4 ч, 6 ч, 8 ч, 12 ч, 24 ч и 48 ч и окрашивали на наличие гликогена раствором йода. Желтовато-коричневые отложения гликогена сразу стали видны с помощью модулирующей оптики Хоффмана с микроскопом Nikon Optiphot-2. А . Штамм дикого типа Guy 11, проращенный в воде. В . ΔcpkA мутант DF51. С . Штамм дикого типа Guy 11 проращивали в полной среде (CM), содержащей 2% дрожжевого экстракта. Бар = 10 мкм. D – F Графики, показывающие биохимический анализ мобилизации гликогена во время формирования аппрессория M. oryzae Конидии проращивали в воде на гидрофобных пластиковых покровных стеклах и позволяли формировать аппрессории. Количество гликогена в пикограммах оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген. Д . Штамм дикого типа Guy 11. E . ΔcpkA мутант DF51. Ф . Δmac1 sum1-99 мутант DA-99. Каждая точка данных представляет собой среднее значение трех независимых повторов эксперимента. Планки погрешностей показывают стандартное отклонение.

Чтобы изучить роль пути цАМФ в мобилизации гликогена, мы исследовали мутант ΔcpkA (). CPKA кодирует каталитическую субъединицу цАМФ-зависимой протеинкиназы A [14], [15].Конидии изначально были богаты гликогеном, но деградация гликогена у мутантов ΔcpkA была отложена, гликоген все еще присутствовал в конидиях через 8 часов. Затем гликоген откладывался в деформированных аппрессориях ΔcpkA , но эти клетки не развивались полностью и гликоген не разрушался (). Мы пришли к выводу, что путь цАМФ регулирует эффективную деградацию гликогена во время прорастания и образования аппрессория. В соответствии с этой идеей, мутант супрессора обхода цАМФ Δmac1 sum1-99 [16], обнаруживает ускоренный распад гликогена в аппрессориях, как сообщалось ранее [7].

Чтобы определить, связана ли мобилизация гликогена с развитием аппрессориев, конидии Guy-11 проращивали в условиях с высоким содержанием питательных веществ (2% дрожжевой экстракт), которые подавляют образование аппрессориев [16]. Наблюдалась ограниченная деградация отложений гликогена, и через 48 ч гранулы гликогена можно было увидеть внутри разветвленных зародышевых трубок (). Таким образом, мобилизация гликогена из конидиума связана с морфогенезом аппрессория в условиях отсутствия питательных веществ.

Биохимический анализ мобилизации гликогена в развивающемся апрессории

Затем мы разработали анализ, позволяющий количественно оценить запасы гликогена, и обнаружили, что непроращенные конидии Guy11 содержат около 1200 пг гликогена ().Мы наблюдали 1500 пг гликогена проростков -1 через 2 часа прорастания, во время прорастания зародышевой трубочки, но между 2 и 12 часами после прорастания количество гликогена упало до 500 пг проростков -1 и оставалось на этом уровне во время созревания аппрессория. , что представляет собой среднее снижение на 988 пг с 95% семейным доверительным интервалом (667, 1310), p <0,001. За все 48 часов средний уровень гликогена снизился на 751 пг (95% ДИ 1073, 430 p <0.001). Сравнить эти результаты с предыдущими измерениями уровня гликогена в почкующихся дрожжах Saccharomyces cerevisiae [17], они должны быть преобразованы в фемтомоли (фмоль) на клетку. Количество клеток M. oryzae можно легко определить только через 0 ч (3-клеточный конидий) и 48 ч (одноклеточный апрессорий). Следовательно, непроращенный конидиум M. oryzae содержит в среднем 2363 фмоль клеток гликогена -1 , в то время как аппрессорий содержит 2450 фмоль клеток гликогена -1 .Значительная емкость гликогена клеток M. oryzae дикого типа подчеркивается, когда эти значения сравниваются с 19,5 фмоль гликогена, измеренным в дрожжевых клетках S. cerevisiae [17]. Мутант ΔcpkA содержал более низкие уровни гликогена, чем Guy11 (). В 0 ч мы обнаружили 800 мкг проростков гликогена -1 . Не было значительных изменений в уровнях гликогена ΔcpkA за весь период времени (общее среднее снижение на 13 пг [95% ДИ 354, 328 p = 1]).В цАМФ-независимом мутантном штамме PKA Δmac1 sum1-99 анализ гликогена выявил изначально высокие уровни гликогена в 1700 пг зародышей -1 (). Это продолжало увеличиваться до пика при 2100 пг проростков -1 через 4 часа (среднее увеличение от 0 до 4 часов для 450 пг [95% ДИ -265, 1164 p = 0,545]). Между 4 и 6 часами после прорастания, во время образования аппрессория, уровни гликогена быстро снижались в среднем на 986 пг проростков -1 (95% ДИ 1700, 272 p <0.001). Уровни снова повышались до 12 часов, достигая пика при более низком значении 1800 пг проростков -1 (среднее увеличение 646 пг [95% ДИ -152, 1445 p = 0,2156]. Затем гликоген постепенно снижался в среднем на 1340 пг за оставшиеся 36 часов (95% ДИ 2139, 541 p <0,001) до конечного значения примерно 400 пг проростки -1 через 48 ч. За весь период времени уровни гликогена в сумме Δmac11- 99 мутант уменьшился в среднем на 1230 пг (95% ДИ 1944, 516 p <0.001). Мы пришли к выводу, что путь ответа цАМФ регулирует мобилизацию гликогена во время развития аппрессория у M. oryzae .

Идентификация и характеристика

M. oryzae AGL1 и GPh2

Чтобы определить, необходима ли мобилизация гликогена для патогенности M. oryzae , мы идентифицировали основные ферменты, связанные с его расщеплением. Гликоген состоит из цепей глюкозы, связанных α-1,4-гликозидной связью, и примерно у каждого десятого остатка точка разветвления образована α-1,6-гликозидной связью.Амилоглюкозидаза (фермент разветвления гликогена) удаляет α-1,6-гликозидные связи из сильно разветвленного полимера, высвобождая глюкозу. Предполагаемый ген, кодирующий амилоглюкозидазу, AGL1 (MGG_00063.6), был идентифицирован в последовательности генома M. oryzae . [18]. AGL1 имеет открытую рамку считывания 4749 п.н., прерванную двумя интронами длиной 134 и 91 п.о., и кодирует предполагаемый белок из 1583 п.о. Сопоставление потенциального белка Agl1 M. oryzae с амилоглюкозидазами других организмов (рисунок S1) выявило 72% идентичности гипотетическому белку из Neurospora crassa и 47% идентичности ферменту разветвления гликогена Gdb1 S.cerevisiae [19]. Дальнейший анализ белковой последовательности выявил четыре консервативных участка аминокислот, присутствующих в α / β бочкообразном домене всех членов суперсемейства α-амилазы (данные не показаны). Разрушение гликогена также требует действия гликогенфосфорилазы. Этот фермент дополняет α-1,6-гликозидную активность амилоглюкозидазы, воздействуя на экзогликозидные α-1,4-гликогенные связи гликогена, последовательно отщепляя и фосфорилируя невосстанавливающие концы полимера.Был идентифицирован ген M. oryzae GPh2 (MGG_01819.6) и выявлена ​​ORF длиной 2664 п.о., кодирующая предполагаемый белок 888 аминокислотных остатков. В последовательности присутствовали два старт-сайта ATG в рамке считывания, самый 5'-из них имеет индикаторный нуклеотид старт-сайта, А, на -3 п.н. [20], который, вероятно, является сайтом инициации трансляции для GPh2 [21]. Белок показал 78% идентичности гипотетическому белку в N. crassa и 74% идентичности предполагаемой гликогенфосфорилазе из Aspergillus fumigatus (Рисунок S2).В S. cerevisiae сайт фосфорилирования присутствует в N-концевой области белка [22]. Белок M. oryzae демонстрирует высокую степень сходства с этой последовательностью, а остаток треонина, с которым связывается фосфат в дрожжевой гликогенфосфорилазе, является консервативным. Кроме того, все гликогенфосфорилазы обладают сайтом связывания для пиридоксаль-5'-фосфата, кофактора, участвующего в фосфорилировании. Альдегидная группа этого производного пиридоксина образует основание Шиффа со специфической лизиновой боковой цепью гликогенфосфорилазы [23].Аминокислотная последовательность, окружающая этот сайт, была идентифицирована в дрожжевой гликогенфосфорилазе [22] и является высококонсервативной в M. oryzae GPh2 с 17 из 18 остатков, идентичными у двух организмов (данные не показаны). Последовательность геномной ДНК длиной 3021 п.н. M. oryzae GPh2 также была идентифицирована из опубликованной последовательности генома [18]. Сравнение этой геномной последовательности с последовательностью кДНК GPh2 выявило присутствие четырех интронов.

Целенаправленная замена гена

M.oryzae AGL1 и GPh2

Чтобы изучить роль AGL1 и GPh2 в патогенности M. oryzae , мы выполнили целевую замену гена (рисунок S3A). Фрагмент Hin dIII размером 2,8 т.п.н. (рисунок S3B), содержащий большую часть 5'-области AGL1 , был удален и заменен кассетой гигромицинфосфотрансферазы [24], придающей устойчивость к гигромицину B. Полученная конструкция (рисунок S3B) ) вводили в Guy-11 и проверяли трансформанты с помощью гель-блоттинга ДНК (рис. S3C).Чтобы удалить GPh2 , часть кодирующей последовательности размером 3 т.п.н. в 2,2 т.п.н. была впоследствии заменена кассетой устойчивости 1,4 т.п.н. к гигромицин-фосфотрансферазе (рисунок S3D). Полученная кассета была введена в Guy-11 и отобраны трансформанты (Рисунок S3E).

Делецию каждого гена подтверждали измерением активности ферментов Agl1 и Gph2 (). Активность амилоглюкозидазы не была обнаружена в штамме Δ agl1 , а активность гликогенфосфорилазы не была обнаружена в мутантах Δ gph2 .Однако мы также наблюдали, что активность амилоглюкозидазы не может быть обнаружена в штаммах с делецией Δ gph2 . Амилоглюкозидаза расщепляет точки разветвления гликогена только тогда, когда они становятся доступными под действием гликогенфосфорилазы и, следовательно, не могут быть измерены в этом анализе.

Столбчатые диаграммы, показывающие активность амилоглюкозидазы и гликогенфосфорилазы у мутантов M. oryzae , метаболизирующих гликоген.

Подробнее о ферментативных анализах см. Материалы и методы. А . Активность амилоглюкозидазы не была обнаружена в мутантах Δ agl1 или, как следствие использованного анализа, в штаммах Δ gph2 . В . гликогенфосфорилазная активность отсутствовала у мутанта Δ gph2 .

Для создания двойного мутанта Δ agl1 Δ gph2 мы провели целевую делецию AGL1 в мутанте Δ gph2 , используя метод делеции гена маркера расщепления [25]. Конструкции с делецией генов трансформировали в Δ gph2 с использованием аллеля гена ацетолактатсинтазы, придающего устойчивость к сульфонилмочевине.Полученные трансформанты были отобраны и проанализированы с помощью гель-блоттинга ДНК (рис. S4). Кроме того, была проведена ОТ-ПЦР для подтверждения успешной делеции гена. В Guy11 и Δ gph2 был амплифицирован ампликон длиной 789 п.н., соответствующий транскрипту Agl1, но это не было обнаружено в мутантах Δ agl1 или двойных мутантах Δ agl1 Δ gph2 (рисунок S4D).

Δ

agl1 и Δ gph2 мутанты демонстрируют измененный метаболизм гликогена

Чтобы исследовать, затрагивается ли клеточное распределение гликогена у мутантов, несущих целевые делеции AGL1 и GPh2 , мы проанализировали мобилизацию гликогена во время образования Δagl1 , Δgph2 и Δ agl1 Δ gph2 ().Мобилизация гликогена замедлялась у мутантов Δ agl1 и Δ agl1 Δ gph2 , и гликоген не истощался из конидий до 24 часов по сравнению с 8–12 часами у Guy11. Напротив, мутанты Δ gph2 оказались менее подверженными мобилизации гликогена. Эти результаты предполагают, что амилоглюкозидаза более важна для эффективного разложения гликогена во время развития, связанного с инфекцией, чем гликогенфосфорилаза. Это может отражать способность недавно описанной глюкоамилазы выполнять α-1,4-гликозидную активность гликогенфосфорилазы и, таким образом, потенциально компенсировать потерю этой активности [25].Однако гликогенфосфорилаза важна для разрушения мицелиального гликогена, поскольку гликоген накапливается в штаммах Δ gph2 во время роста на минимальной среде (), но не в штаммах Δ agl1 .

Распределение клеток и количественная оценка гликогена во время морфогенеза аппрессория у мутантов Δ agl1 и Δ gph2 M. oryzae .

А . Конидии инкубировали на гидрофобных стеклянных покровных стеклах, чтобы позволить апрессориям развиться до окрашивания раствором йода.Мутанты Δ agl1 и Δ agl1 Δ gph2 были нарушены в мобилизации гликогена из конидия в аппрессорий и в последующей деградации в аппрессории, тогда как мутант Δ gph2 был сравним с Guy11. Шкала шкалы = 10 мкм. В . Количественное определение гликогена в экстрактах мицелия дикого типа и метаболических мутантах гликогена M. oryzae . Штаммы выращивали либо в жидкой CM в течение 48 часов, либо в CM с последующим выращиванием в GMM в течение 16 часов.Культуры собирали, промывали 0,2% CaCl 2 и сушили вымораживанием. Количество гликогена, присутствующего в мицелии -1 нмольмг, оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген. Значения, обозначенные разными буквами (a, b,), статистически значимы при p <0,01. С . Тесты роста, чтобы показать использование крахмала и гликогена в качестве единственных источников углерода. Минимальную среду, содержащую глюкозу, крахмал или гликоген, засевали мицелиальной пробкой М.oryzae и инкубировали в течение 12 дней. Чашки с крахмалом и гликогеном заливали йодом, чтобы визуализировать разницу в использовании субстрата. Йод окрашивает крахмал в синий цвет, а гликоген в коричневый цвет. У мутантов гликогена была нарушена их способность использовать как крахмал, так и гликоген в качестве единственного источника углерода.

Чтобы определить, способны ли мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 использовать внешний гликоген в качестве единственного источника углерода, мы провели тесты роста на различных источниках углерода.Оба мутанта Δ agl1 и Δ gph2 вместе с двойным мутантом Δ agl1 Δ gph2 были способны утилизировать глюкозу, но их рост был нарушен на гликогене и крахмале (). Повторное введение AGL1 и GPh2 в соответствующие нуль-мутанты дополняло мутантный фенотип (рисунок S5). Мы пришли к выводу, что мутанты Δ agl1 и Δ gph2 обладают нарушенной способностью использовать как крахмал, так и гликоген в качестве единственного источника углерода.

Agl1 и Gph2 локализуются в цитоплазме конидий, аппрессорий и инвазивных гиф

Для определения субклеточного расположения Agl1p и Gph2p во время образования аппрессория, AGL1: GFP и GPh2: GFP экспрессировали слияниями генов Guy11. . Слияния Agl1-GFP и Gph2-GFP локализуются по всей цитоплазме в конидиях Guy11 и внутри зародышевых трубок и возникающих аппрессорий к 2 часам и 4 часам соответственно (). Через 8 часов флуоресцентный сигнал наблюдался преимущественно в развивающемся апрессории, а через 24 часа Agl1-GFP и Gph2-GFP были обнаружены исключительно в цитоплазме апрессория.Интересно, что Agl1-Gfp и Gph2-Gfp также были высоко экспрессированы во время заражения растений через 36 часов и локализовались в цитоплазме внутриклеточных инвазивных гиф грибов (2).

Локализация Agl1-GFP и Gph2-GFP на разных стадиях морфогенеза аппрессория и в росте planta с помощью M. oryzae .

А . Конидиям давали возможность сформировать аппрессории, и локализацию Agl1-GFP и Gph2-GFP наблюдали в течение 24 часов с использованием инвертированного эпифлуоресцентного микроскопа Olympus IX-81, снабженного камерой HQ 2 .Слитые белки были локализованы в цитоплазме в конидиях, зародышевой трубке и апрессории. Шкала шкалы = 10 мкм. В . Конидии собирали из штаммов Agl1-GFP и Gph2-GFP и инкубировали на оболочке рисового листа во влажной камере. Конфокальную систему лазерного сканирующего микроскопа Zeiss LSM510 Meta использовали для наблюдения экспрессии Agl1-GFP и Gph2-GFP в эпидермальной ткани риса через 36 часов после инкубации. Agl1-GFP и Gph2-GFP экспрессировались цитоплазматически в инвазивных гифах. Шкала шкалы = 20 мкм.

М.oryzae Δ agl1 , Δ gph2 , Δ agl1 Δ gph2 мутанты обладают нарушенной способностью вызывать болезнь рисового бласта

Чтобы определить роль AGL1 и gph2 в патогенности GPh2 засевали восприимчивый сорт риса CO-39 и сорт ячменя Golden Promise однородными суспензиями спор каждого мутанта и Guy-11 (). У мутантов Δ agl1 и Δ gph2 количество повреждений уменьшилось на 50.44 ± 6% ( P <0,0001) и 44,7 ± 2,4% ( P <0,001), соответственно, тогда как у штамма Δ agl1 Δ gph2 количество поражений уменьшилось на 75,44 ± 1,4% ( P <0,0001) (). У мутантов не обнаружено дефектов прорастания конидий и образования аппрессориев в условиях отсутствия питательных веществ, и частота образования аппрессориев также не пострадала (данные не показаны). Ранее предполагалось, что распад гликогена может быть значительным в генерации тургора аппрессория [6], [7], [26].Поэтому мы измерили тургор аппрессория у мутантных штаммов Δ agl1 и Δ gph2 , используя анализ зарождающегося циторриза [6]. Несмотря на различия в мобилизации гликогена у мутантных штаммов (), мы не обнаружили существенных различий в тургоре между аппрессориями мутантных штаммов и Guy-11 (не показано). Затем мы использовали анализ эпидермиса лука [27], чтобы определить, может ли наблюдаемое снижение вирулентности быть следствием нарушения функции аппрессория. Однако не наблюдали значительных различий в эпидермальном проникновении между Guy-11 и мутантными штаммами Δagl1 , Δgph2 и Δagl1Δgph2 , которые обычно вырабатывали штыри для проникновения (не показаны).Следовательно, уменьшение образования повреждений, наблюдаемое для Δ agl1 , Δ gph2 и Δagl1Δgph2 , не является следствием пониженного тургорного давления или нарушения функции аппрессора. Чтобы исследовать колонизацию тканей каждым мутантом, был проведен анализ оболочки рисового листа [28]. Мы обнаружили, что мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 не обладают способностью к инвазивному росту внутри клеток риса. Мутанты, метаболизирующие гликоген, образовывали необычные инвазивные гифы, которые были менее выпуклыми и разветвленными, чем обычно ().Мы пришли к выводу, что мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 способны нормально проникать в клетки риса, но не могут эффективно размножаться в тканях риса, что приводит к уменьшению симптомов заболевания.

Анализы заражения и проникновения мутантов Δ agl1 , Δ gph2 и Δ agl1Δgph2 M. oryzae .

А . Пятнадцатидневные проростки риса сорта СО-39 или 8-дневные проростки ячменя Golden Promise опрыскивали конидиальной суспензией из 5 × 10 -4 спор спор -1 мл и инкубировали при 24 ° C. при сильном освещении и влажности 90% в течение 5 дней.Показанные листья представляют типичные симптомы, связанные с каждым штаммом. Эксперимент был повторен шесть раз с аналогичными результатами. Столбчатые диаграммы показывают плотности поражений, полученные на инфицированных листьях риса, выбранных случайным образом. Односторонний анализ ANOVA показал, что у мутантных штаммов была значительная недостаточность их способности вызывать болезнь рисового бласта. Значения, обозначенные разными буквами (a, b, c), статистически значимы при p <0,01. В . Для исследования инвазии в ткани хозяина конидии инкубировали на оболочке рисового листа в течение 36 часов и наблюдали с помощью лазерной конфокальной микроскопии.Штамм дикого типа Guy11 показал рост с инвазивными луковичными и разветвленными гифами. Мутанты по метаболизму гликогена продуцировали менее луковичные и разветвленные инвазивные гифы внутри рисовых клеток. Шкала шкалы = 20 мкм.

Идентификация гена, кодирующего гликоген-синтазу

M. oryzae

Учитывая важность мобилизации гликогена для вирулентности, мы решили создать штамм M. oryzae , запасы гликогена истощены. Предполагаемый ген, кодирующий гликоген-синтазу, был идентифицирован из M.База данных генома oryzae (http://www.broadinstitute.org/annotation/fungi/magnaporthe/) с использованием алгоритма BLASTX [29], основанного на его предсказанной аминокислотной гомологии с гликоген-синтазами дрожжей и млекопитающих. Одна последовательность, MGG_07289.6, выровнена с гликогенсинтазами дрожжей и млекопитающих [30], [31]. Предсказанный ген, кодирующий гликоген-синтазу, который мы назвали GSN1 , присутствует как единичный ген в геноме M. oryzae и, по прогнозам, содержит пять экзонов, прерванных четырьмя интронами [29].Предсказанный ген кодирует белок из 708 аминокислот и показал высокое сходство последовательностей с Gsy1p и Gsy2p дрожжей [30] и Gys1p и Gys2p специфичных для мышц и печени форм гликогенсинтазы человека [31]. На рисунке S6 показан результат выравнивания ClustalW [32]. S. cerevisiae Gsy1 и Gsy2 показали 63% и 64% идентичности с M. oryzae GSN1 , соответственно, тогда как Homo sapiens Gys1 и Gys2 показали идентичность 60% и 55% соответственно. Сайты фосфорилирования, предположительно участвующие в посттрансляционной регуляции Gsy2p, консервативны в M.oryzae Гсн1п. В Gsy2p три сайта фосфорилирования присутствуют в S650, S654 и T667 на C-конце [33], тогда как в Gsn1p предсказанные остатки присутствуют в положениях S632, S636 и T645 на C-конце, как показано на дополнительном рисунке S5.

Синтез гликогена не влияет на патогенность

M. oryzae

Для создания нулевого мутанта Δ gsn1 M. oryzae , целевую замену гена GSN1 проводили с использованием метода делеции гена маркера расщепления (рисунок S6A) [25].Конструкции с делецией генов трансформировали в Guy11, и предполагаемые трансформанты подвергали скринингу на основании их устойчивости к гигромицину B (фигура S7). У мутантов Δ gsn1 отложения гликогена не могли четко наблюдаться (), в отличие от Guy11 (). Для дальнейшего исследования мы измерили гликоген с помощью ферментативного анализа и наблюдали значительное снижение ( P <0,01) гликогена в клетках мутанта Δ gsn1 (). Мы пришли к выводу, что синтез гликогена серьезно нарушен как в конидиях, так и в аппрессориях в отсутствие гена гликогенсинтазы GSN1 .

Распределение гликогена в клетках во время морфогенеза аппрессория у мутанта гликоген-синтазы Δ gsn1 из M. oryzae .

А . Конидиям давали возможность образовать аппрессории, а затем проводили окрашивание раствором йода. Отложения гликогена отсутствовали в конидиях и на всем протяжении развития аппрессория. Шкала шкалы = 10 мкм. В . Анализы заражения мутантами Δ gsn1 . Споры собирали из 12-дневных культур Guy11 и мутанта Δ gsn1 и инокулировали распылением в концентрации 5 × 10 4 конидий мл -1 на 3-недельные проростки риса и 8-дневные проростки. рассада ячменя.Растения инокулировали при 24 ° C, сильном освещении и влажности 90% в течение пяти дней. Листья собирали и оценивали на наличие симптомов взрыва риса. Не наблюдалось очевидной разницы между патогенностью штамма Guy11 дикого типа и мутанта гликоген-синтазы Δ gsn1 . Эксперимент повторяли три раза с идентичными результатами, и не наблюдали статистически значимых различий в плотности или степени поражения (не показано). C. Количественное определение гликогена в конидиях дикого типа и мутантах гликогенсинтазы M.oryzae . Конидии собирали с 12-дневных чашек дикого типа и двух мутантов с делецией Δ gsn1 и разбавляли до концентрации 1 × 10 6 мл -1 . Количество гликогена в конидиях -1 мг / мл оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген (+). Также показано количество глюкозы без добавления ферментов, расщепляющих гликоген (-). Значения с разными буквами (a, b,) статистически значимы при p <0.01.

Изучить роль GSN1 в прогрессировании болезни рисовой пигментации, проростков риса CO-39 и ячменя сорта. Каждый Golden Promise был инокулирован мутантом гликогенсинтазы Δ gsn1 и штаммом дикого типа Guy11. Мутант Δ gsn1 был способен вызывать симптомы болезни рисового бласта, которые были идентичны штамму дикого типа, из которого можно сделать вывод, что этот ген является незаменимым для заражения рисовым бластом как у риса, так и у ячменя ().Мы пришли к выводу, что синтез гликогена в качестве запасного продукта в спорах у M. oryzae не является существенным для патогенности.

Δ

agl1 , Δ gph2 и Δ agl1 Δ gph2 мутанты влияют на синтез трегалозы

Мы были заинтригованы, обнаружив, что нарушение синтеза гликогена не влияет на вирулентность M. oryzae. при условии, что оба мутанта Δ agl1 и Δ gph2 показали такие выраженные дефекты в их способности вызывать болезнь рисового взрыва.Поэтому мы решили определить, были ли другие биохимические различия очевидны у любого из метаболических мутантов гликогена. Интересно, что мы наблюдали, что оба мутанта Δ agl1 и Δ gph2 показали пониженные уровни трегалозы во время вегетативного роста на CM (). Это предполагает, что в M. oryzae предшественники трегалозы, по крайней мере, во время роста мицелия, могут быть получены в результате деградации гликогена или на них влияет потеря активности этих ферментов. Поэтому мы проанализировали экспрессию TPS1 и TPS3 в мутантах Guy11, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 . TPS1 кодирует трегалозо-6-фосфат (T6P) синтазу, а TPS3 кодирует субъединицу комплекса T6P-синтаза / трегалоза фосфатаза [34]. Экспрессия TPS1 была снижена в 5 раз у мутантов Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 по сравнению с Guy11 (), тогда как экспрессия TPS3 была снижена в 6 раз при Δ . agl1 , 9 раз в Δ gph2 и в 50 раз в мутанте Δ agl1 Δ gph2 ().Мы также исследовали экспрессию гена RSY1 , участвующего в пути биосинтеза меланина [35], поскольку известно, что TPS1 регулирует экспрессию нескольких генов, связанных с вирулентностью, включая гены биосинтеза меланина, через генетический ген TPS1 / NMR . переключатель [11]. Экспрессия RSY1 также подавлялась в независимых одиночных и двойных мутантах (не показаны).

Анализ синтеза трегалозы у метаболических мутантов гликогена M.oryzae .

А . Количественное определение трегалозы в экстрактах мицелия. Штаммы выращивали либо в жидкой CM в течение 48 часов, либо в CM с последующим выращиванием в GMM в течение 16 часов. Культуры собирали, промывали 0,2% CaCl 2 и сушили вымораживанием. Экстракты мицелия получали с метилендихлоридом и метанолом и анализировали на трегалозу. Уровни трегалозы были значительно снижены у мутантов метаболизма гликогена по сравнению с Guy11. Эксперимент был повторен трижды с аналогичными результатами.Значения, обозначенные разными буквами (a, b, c, d), статистически значимы при p <0,01. В . Анализ экспрессии генов TPS1 и C . TPS3 в мицелии с помощью сравнительной количественной ОТ-ПЦР в реальном времени. Уровни транскриптов TPS1 , TPS3 были подавлены у мутантов, метаболизирующих гликоген. Эксперимент повторяли дважды, каждый с тремя техническими повторами, с аналогичными результатами. Односторонний анализ ANOVA показал, что мутантные штаммы имели значительные дефекты в экспрессии гена биосинтеза трегалозы.Обилие транскриптов показано относительно экспрессии гена M. oryzae β -тубулина (MGG_00604). Значения, обозначенные разными буквами (a, b, c, d), статистически значимы при p <0,01.

Делеция

NMR3 частично восстанавливает Δ agl1 Δ gph2 фенотип двойного мутанта

Известно, что M. oryzae Tps1 действует как G6P-чувствительный белок, напрямую связываясь с G6P и NADPH для контроля экспрессии набор ассоциированных с вирулентностью генов, экспрессируемых при заражении растений [11].Мы предположили, что если гены метаболизма гликогена ( AGL1 и GPh2 ) регулируют экспрессию TPS1 во время инфекции, то делеция одного из генов ингибитора транскрипции, который, как было показано, взаимодействует с Tps1p, может частично компенсировать фенотипические дефекты, связанные с Δ agl1 Δ gph2 двойной мутант [11]. Делеции NMR1 , NMR2 или NMR3 , например, было показано, что достаточно для восстановления патогенности мутанта Δ tps1 [11].Поэтому мы провели целенаправленную делецию гена NMR3 в двойном мутанте Δ agl1 Δ gph2 , поскольку двойные мутанты Δ tps1 Δ nmr3 показали максимальное восстановление патогенности [11]. Мы использовали стратегию расщепления маркеров для нацеливания на локус NMR3 для делеции гена, как показано на рисунке S8A. [25]. После трансформации трансформантов M. oryzae были первоначально проверены на устойчивость к биалафосу [36], и делеция была подтверждена с помощью гель-блоттинга ДНК (рис. S8B).

Для проверки вирулентности Δ agl1 Δ gph2 Δ nmr3 на восприимчивом сорте риса CO-39 был проведен анализ патогенности с использованием Guy11, Δ agl1 Δ gph2. agl1 Δ gph2 Δ nmr3 мутант. Мы обнаружили, что делеция гена NMR3 восстанавливала способность мутанта Δ agl1 Δ gph2 вызывать бластную болезнь, как показано на рис. Не наблюдалось существенной разницы в количестве повреждений между Guy11 и Δ agl1 Δ gph2 Δ nmr3 при заражении риса ( P <0.05) или инфекции ячменя (). Мы пришли к выводу, что AGL1 и GPh2 могут влиять на работу Tps1-опосредованного механизма регуляции гена, который необходим для болезни рисового бласта.

Анализ рисового бласта Δ agl1 Δ gph2 и Δ agl1 Δ gph2 Δ nmr3 мутанта M. oryzae .

А . 3-недельные проростки риса сорта СО-39 опрыскивали суспензией спор 5 × 10 4 спор -1 мл и инкубировали в течение 5 дней при 24 ° C. В . Поражения оценивали на случайно выбранных инфицированных листьях. Показанные листья представляют типичные симптомы, связанные с каждым испытанным штаммом. Эксперименты повторяли шесть раз с идентичными результатами. У Δ agl1 Δ gph2 Δ nmr3 была частично восстановлена ​​его способность вызывать бластную болезнь. Значения, обозначенные разными буквами (a, b), статистически значимы при p <0,01. C. 8-дневные проростки ячменя Golden Promise опрыскивали конидиальной суспензией из 5 × 10 -4 спор спор -1 мл и инкубировали при 24 ° C, сильном освещении и влажности 90% в течение 5 дней.Показанные листья представляют типичные симптомы, связанные с каждым штаммом. Эксперимент был повторен трижды с аналогичными результатами.

Обсуждение

В этом исследовании мы намеревались изучить роль метаболизма гликогена в возникновении болезни рисового бласта, вызываемой M. oryzae . Предыдущие сообщения установили, что мобилизация гликогена происходит во время развития аппрессория и может зависеть от cAMP-зависимой протеинкиназы A и путей передачи сигналов MAP kinase Pmk1 [7].Запасы гликогена в аппрессории также были предложены в качестве потенциального субстрата для производства глицерина в аппрессории, способствуя генерации тургора для разрыва кутикулы растения [6], [7], [26]. Запасы гликогена в аппрессориях, например, явно используются во время созревания аппрессориев до заражения растений [26]. При совместном рассмотрении результаты, представленные в этом исследовании, свидетельствуют о том, что деградация цитозольного гликогена в M. oryzae , которая требует гликогенфосфорилазы и амилоглюкозидазы, играет важную роль в вирулентности этого гриба.Этот вывод основан на мутантных фенотипах Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 двойных мутантов, у которых нарушена их способность вызывать бластную болезнь. Однако кажется вероятным, что влияние на вирулентность является плейотропным, а не специфически связанным с использованием резервов гликогена, поскольку мутанты Δ gsn1 , запасы гликогена которых значительно уменьшены из-за отсутствия активности гликогенсинтазы, не подвержены вирулентности.Этот результат предполагает, что запасы гликогена в конидиях и аппрессориях не обязательны для генерации тургора аппрессория и заражения растений. Представленные здесь данные также предполагают, что потеря GPh2 и AGL1 снижает экспрессию TPS1 , который, как известно, интегрирует контроль углеродного и азотного метаболизма в M. oryzae в ответ на уровни G6P и NADPH / NADP [11] .

В начале этого исследования мы были особенно заинтересованы в понимании того, как мобилизация гликогена происходила во время развития аппрессория M.oryzae . Поэтому изначально мы провели цитологический и биохимический анализ, чтобы изучить движение и распад запасов гликогена. Результаты этих экспериментов согласуются, показывая, что гликоген быстро разлагается во время прорастания конидий и что этот процесс замедляется у мутантов Δ cpkA , лишенных каталитической субъединицы протеинкиназы A. Наоборот, Δ mac1 sum1-99 мутант, шунтирующий супрессор нулевого мутанта аденилатциклазы, который несет мутацию в цАМФ-связывающем кармане регуляторной субъединицы протеинкиназы A [16], демонстрирует неправильную регуляцию хранения гликогена в споре.Это согласуется с более ранними предположениями, основанными исключительно на микроскопии [7], что мутанты Δ mac1 sum1-99 ускоряют распад гликогена и липидов. Взятые вместе, эти наблюдения предполагают, что путь ответа цАМФ играет важную роль в регуляции цитозольного метаболизма гликогена.

Чтобы исследовать роль распада гликогена в заражении растений M. oryzae , мы создали мутанты с делецией гена, лишенные активности ферментов амилоглюкозидазы и гликогенфосфорилазы.Фенотипический анализ показал, что двойные мутанты Δ agl1 и Δ agl1 Δ gph2 имели серьезные дефекты в расщеплении гликогена в конидиях, и через 24 часа розетки гликогена оставались видимыми в конидиях обоих мутантных штаммов. Гиперакопление гликогена ранее наблюдалось у мутантов Δ agl1 и Δ gph2 S. cerevisiae . [37], [38], демонстрируя важность этих ферментов для использования запасов гликогена.Предыдущее сообщение показало, что вакуолярная глюкоамилаза, Sga1, в M. oryzae может вносить вклад в утилизацию гликогена во время конидиогенеза [39]. Мутанты, лишенные активности Sga1, показали пониженную конидиацию, что согласуется с ролью вакуолярного аутофагического гидролиза гликогена во время развития спор. Интересно отметить, что мутанты Δ sga1 , однако, не проявили какого-либо влияния на развитие или патогенность аппрессоров [39], предполагая, что M. oryzae может разлагать гликоген посредством вакуолярного аутофагического механизма во время развития спор, но в основном цитозольный путь во время спор. прорастание и развитие аппрессориев, даже несмотря на то, что большой всплеск аутофагии связан с прорастанием конидий, запрограммированной гибелью клеток и созреванием аппрессориев [3], [5].Слияния генов Agl1-GFP и Gph2-GFP, например, подтвердили, что оба фермента локализованы в цитоплазме внутри конидий, зародышевых трубок и аппрессорий.

Фенотипы мутантов Δ agl1 и Δ gph2 согласуются с мобилизацией и использованием гликогена, оказывающими значительное влияние на способность M. oryzae вызывать болезнь, вызываемую грибковой инфекцией риса. Однако делеция GSN1 , который кодирует гликогенсинтазу, привела к значительному снижению уровней гликогена в клетках, но не оказала никакого влияния на патогенность M.oryzae .. Липиды, гликоген и трегалоза являются основными запасами питательных веществ, используемых конидиями M. oryzae для прорастания и дифференциации аппрессориев (см. обзор [2]). Основываясь на результатах, представленных здесь, кажется, что использование гликогена не может быть таким значительным фактором созревания апрессория, как гидролиз триацилглицерина [9]. Активность триацилглицерин липазы, например, индуцируется во время развития аппрессория у M. oryzae . [7].

Наиболее значимый вывод, который мы можем сделать относительно роли AGL1 и GPh2 в патогенности M.oryzae заключается в том, что отсутствие этих ферментных активностей снижает экспрессию гена TPS1 . Из M. oryzae известно, что активность Tps1 важна для болезни рисового бласта и формирует NADPH-зависимый генетический переключатель [11]. Мутанты, лишенные Tps1, способны продуцировать аппрессории, но они нефункциональны, и гриб не может колонизировать ткани риса [40]. Мутант Δ tps1 не продуцирует трегалозу или ее промежуточный трегалозо-6-фосфат (T6P), но нарушение патогенности происходит не просто из-за потери биосинтеза трегалозы.Мутации в G6P-связывающих карманах Tps1, например, сделали гриб непатогенным, в то время как мутации в каталитических сайтах, необходимых для синтеза T6P, не повлияли на его роль в заболевании, вызванном грибковой инфекцией риса, что позволяет предположить, что потеря связывания G6P связана с потерей патогенности [12]. Tps1 объединяет использование источников углерода и азота, а мутанты Δ tps1 неспособны расти на нитрате из-за воздействия на активность нитратредуктазы (NR) [34]. НАДФН является кофактором нитратредуктазы и обеспечивает восстанавливающую способность.Достаточные пулы НАДФН необходимы для функции NR и вырабатываются окислительным пентозофосфатным путем посредством активации дегидрогеназы G6P (G6PDH). Было показано, что как уровни НАДФН, так и активность G6PDH снижены у мутантов Δ tps1 , что указывает на то, что экспрессия G6PDH находится под контролем Tps1 [34]. Сверхэкспрессия G6PDH восстанавливает дефект патогенности мутантов Δ tps1 , а недавно было показано, что Tps1 непосредственно связывается с NADPH, что указывает на более широкую регуляторную роль в использовании углерода и азота [11].Также было показано, что Tps1 является позитивным регулятором трех факторов транскрипции GATA в процессе, который негативно регулируется тремя NADP-зависимыми белками-ингибиторами Nmr. Факторы транскрипции GATA положительно регулируют экспрессию связанной с вирулентностью экспрессии генов способом, модулируемым активностью белков-ингибиторов ЯМР, и, в конечном итоге, зависят от клеточных уровней NADPH / NADP и G6P [11]. Поразительно, что мы наблюдали, что мутанты Δ agl1 и Δ gph2 уменьшают накопление трегалозы.Более того, гены, кодирующие фермент биосинтеза трегалозы, TPS1 и TPS3 , подавляются у мутантов по метаболизму гликогена. Поэтому мы предположили, что Agl1 и Gph2 могут регулировать экспрессию Tps1 и Tps3. Делеции NMR3 было достаточно для восстановления вирулентности двойного мутанта Δ agl1 Δ gph2 , хотя и с небольшими повреждениями. Это предполагает, что метаболизм гликогена может вносить вклад в контроль NADPH-зависимого генетического переключателя Tps1.Это интересно, потому что было показано, что экспрессия гена AGL1 и GPh2 и оборот гликогена затрагиваются в штаммах Δ tps1 [34], что позволяет предположить, что у дикого типа может существовать механизм отрицательной обратной связи для регулирования обмена гликогена в ответ на зондирование G6P. Таким образом, при совместном рассмотрении наше исследование позволило получить фундаментальную новую информацию о роли метаболизма гликогена в грибковом грибке Magnaporthe oryzae . Представленные здесь результаты предполагают, что метаболизм гликогена играет более широкую регуляторную роль, чем первоначально предполагалось, но вряд ли существует прямая потребность в деградации гликогена для подпитки опосредованного аппрессорием проникновения в кутикулу.Вместо этого эффект Agl1p и Gph2p на Tps1-зависимый генетический переключатель предполагает важную и неожиданную регуляторную роль во время инфекции растений.

Материалы и методы

Штаммы грибов и условия культивирования

Изоляты Magnaporthe oryzae , использованные в этом исследовании, хранятся в лаборатории NJT. Описанные мутанты с целевой заменой генов изогены по отношению к рису дикого типа ( Oryza sativa ) патогенный Magnaporthe штамм Guy-11.Состав сред и процедуры для культивирования и поддержания грибов, экстракции нуклеиновых кислот и ДНК-опосредованной трансформации были описаны ранее [41].

Анализ внутриклеточного гликогена

Гликоген в развивающихся аппрессориях визуализировали с помощью йодной окраски, состоящей из 60 мг KI и 10 мг I 2 мл -1 в дистиллированной воде [42]. Свежесобранные конидии в концентрации приблизительно 1 × 10 5 мл -1 инкубировали на гидрофобных пластиковых покровных стеклах либо в стандартной питательной среде (CM) с добавлением 2% дрожжевого экстракта, либо в дистиллированной воде в течение определенного периода времени.Через несколько секунд контакта с желто-коричневым пятном отложения гликогена можно было наблюдать микроскопически. Для измерения количества гликогена, присутствующего на стадиях развития M. oryzae , был разработан протокол, основанный на экспериментах, проведенных на S. cerevisiae . [17], [43] - [46]. Спорулирующие культуры M. oryzae в возрасте 12 дней в возрасте заливали стерильной дистиллированной водой и соскребали стеклянным разбрасывателем. Полученную суспензию фильтровали через стерильный miracloth (Calbiochem) и конидии выделяли центрифугированием при 20 ° C (5000 г , 10 минут).После промывки в дистиллированной воде конидии концентрировали центрифугированием и разбавляли приблизительно до 1 × 10 6 конидий на мл -1 . Образцы разделяли и инкубировали на гидрофобных пластиковых покровных стеклах в течение периодов времени 0, 2, 4, 6, 8, 24 или 48 часов перед переносом в микроцентрифужные пробирки, нагревали до 100 ° C в течение 10 минут для остановки ферментативного действия и охлаждали на льду. . Затем конидии были разрушены с помощью 10-минутной обработки ультразвуком, выполняемой 10-секундными импульсами с использованием ультразвукового устройства Vibracell (Sonics and Materials Inc., Данбери, США). Фрагменты клеток осаждали центрифугированием и 760 мкл супернатанта удаляли в свежую пробирку. К этому добавляли 100 мкл 50 мМ CaCl 2 и 100 мкл 0,5 М NaOAc pH 5,0 вместе со следующими ферментами, которые превращают гликоген в глюкозу: 29 мкл амилоглюкозидазы (Roche, Германия), 10 мкл α-амилазы (Sigma). В контрольном эксперименте эти ферменты были заменены стерильной дистиллированной водой. Реакции инкубировали в течение ночи при 57 ° C при постоянном вращении перед центрифугированием при 5,000 g в течение 3 минут.Для каждой временной точки супернатант из двенадцати аликвот по 50 мкл анализировали с помощью набора для анализа глюкозооксидазы (Sigma Diagnostics), в котором конечная интенсивность цвета пропорциональна концентрации глюкозы. Значения оптической плотности образца измеряли при 450 нм с использованием планшет-ридера Dynex Technologies MRX II (Jencons-PLS). Контроль без добавления фермента использовали для измерения фонового уровня глюкозы. Полный эксперимент проводился в трех биологических повторностях в отдельные дни, и средние уровни гликогена рассчитывались для каждой временной точки.Уровни гликогена анализировали с помощью линейных моделей смешанных эффектов для каждого мутантного штамма индивидуально, с культивированием как случайным эффектом и временем (часами) как фиксированным эффектом. Затем все попарные сравнения были выполнены с помощью тестов Tukey HSD для поддержания общего тестового уровня 5%. Средние значения и различия в средних значениях представлены с 95% семейным доверительным интервалом и скорректированными по Тьюки p-значениями. Пакеты nlme и multcomp в R v2.15 использовались для выполнения статистического анализа.

Идентификация и целенаправленная замена гена

M.oryzae AGL1 и GPh2

Геномная ДНК из M. oryzae была использована для амплификации полимеразной цепной реакции (ПЦР) с праймерами AGL1 ( 5'-GCGTACATGGCCTGCTTTGAACGTA-3 ') и AGL2 ( 5'-TGCTCTGTGTGAGGAGT000), разработанными к консервативным областям последовательности метки экспрессированной последовательности AGL1 (EST) из базы данных Института генетики Университета Клемсона (CUGI) (http://www.genome.clemson.edu/). ПЦР проводили с применением 35 циклов амплификации.После начальной денатурации в течение 5 минут при 94 ° C использовали следующие условия амплификации: 45 секунд денатурации при 94 ° C, 1 минута отжига при 55 ° C, 1 минута элонгации при 72 ° C. Затем следовало последнее 10-минутное удлинение при 72 ° C. Затем полученный фрагмент геномной ДНК размером 513 п.н. использовали для скрининга библиотеки конидиальной кДНК Guy-11 [15]. Истинный стартовый кодон и 5'-последовательность идентифицированной кДНК AGL1 определяли с использованием стратегии 5'-быстрой амплификации концов кДНК (5'-RACE) [47].Скрининг геномной библиотеки λGEM-11 [41] с клоном кДНК AGL1 выявил геномный клон лямбда Kpn I размером 6,5 т.п.н., названный pLh2. Геномную последовательность этого клона получали с использованием стратегии Genome Priming System (GPS). Эта система на основе транспозона Tn7 использует комплекс транспозазы для случайной вставки транспраймера в мишень дцДНК [48], [49]. Производится популяция продуктов, каждый с транспраймером, вставленным в другое место, и уникальные сайты праймирования на конце каждого транспраймера позволяют секвенировать обе нити целевой ДНК в месте вставки.Для замены гена ампликон 6,0 т.п.н., состоящий из ORF AGL1 с 5'-флангом 1,0 т.п.н., был амплифицирован из геномной ДНК M. oryzae Guy-11 с праймерами AGLvectorF ( 5'-CCTGACGGATAATGGTGGGGTG-3 ') и AGLvectorR ( 5'-CTTCGTCCGCAT CCATGTAGAG-3 '), сконструированный для последовательности генома M. oryzae , штамм 70-15 (http://www.genome.wi.mit.edu/annotation/fungi/magnaporthe /). ПЦР выполняли при следующих условиях: начальная 1 минута денатурации при 95 ° C, затем 30 циклов 1 минута денатурации при 95 ° C, 1 минута отжига при 60 ° C и 6 минут элонгации при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон клонировали в вектор pGEM-T (Promega) для создания плазмиды pLh4. Затем pLh4 расщепляли Hin dIII для высвобождения фрагмента 2,8 т.п.н. ORF AGL1 и линеаризованную плазмиду лигировали с генной кассетой фосфотрансферазы Hin dIII, связанной с 1,4 т.п.н. .

Ген M. oryzae GPh2 был идентифицирован аналогично AGL1 .Праймеры GPh2 ( 5'-CTTCCTCCAGTCAGTAGAGCG-3 ') и GPh3 ( 5'-TTTGAGGAAGTCATAGCTACCG-3' ) были сконструированы из консервативных областей генов, кодирующих GPH, с использованием последовательности EST из базы данных CUGI, показывающей высокую степень сходства. к генам гликогенфосфорилазы из S. cerevisiae [50], [51] и другие организмы. Фрагмент длиной 319 п.н. M. oryzae GPh2 амплифицировали с помощью ПЦР-амплификации в следующих условиях: начальная денатурация в течение 5 минут при 94 ° C, затем 35 циклов амплификации, включающих: 45 секунд денатурации при 94 ° C, 1 минуту отжиг при 54 ° C, удлинение в течение 1 минуты 30 секунд при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон очищали в геле, клонировали в вектор pBluescript (Stratagene) и использовали для скрининга библиотеки конидиальной кДНК Guy-11 [15]. 5'-RACE [47] использовали для определения 5'-последовательности и стартового кодона GPh2 с использованием специфичного для гена праймера, сконструированного для последовательности самого длинного клона кДНК. Чтобы сконструировать вектор замены гена GPh2 , ампликон размером 5,1 т.п.н., содержащий ORF GPh2 с приблизительно 1.0 kb, амплифицировали из геномной ДНК M. oryzae с использованием праймеров GPHnestedF ( 5'-GTTGCACTGAACCTCGAGTCTAGA-3 ') и GPHnestedR ( 5'-TTCGCCAAGG ATGCTGGGCTCAAG-3' последовательности 9 штамм M. oryzae 70-15. Стандартный протокол ПЦР был адаптирован для включения системы Taq Plus® Long PCR (Stratagene), предназначенной для амплификации длинных продуктов. Образцы нагревали до 94 ° C в течение 5 минут, затем применяли следующие условия для 35 циклов: 30 секунд денатурации при 94 ° C, 30 секунд отжиг при 55 ° C, удлинение 9 минут при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон размером 5165 п.о. очищали в геле и клонировали в вектор pGEM-T (Promega) для создания плазмиды pLh5. Расщепление pLh5 с помощью Bst BI высвободило фрагмент гена размером 2,2 т.п.н., который был заменен кассетой гена Hph , связанной 1,4 т.п.н. Bst BI, связанной с 1,4 т.п.н., для создания вектора делеции гена pLh5 H . Плазмиды pLh4 H и pLh5 H трансформировали в штамм M. oryzae Guy-11.Вставка одной копии плазмидной ДНК была подтверждена для всех трансформантов с помощью гель-блоттинга ДНК.

Нацеленная замена гена AGL1 в штамме Δ gph2 маркером устойчивости к сульфонилмочевине, ILV1 , для генерации Δ agl1 Δ gph2 с использованием стратегии гена-маркера расщепления (Catlett et al. , 2003). Замена была достигнута путем замены 1 т.п.н. 5'-открытой рамки считывания AGL1 геном ILV1 размером 2,8 т.п.н.В первом раунде ПЦР 1 т.п.н. фланкирующей последовательности с каждой стороны кодирующей области гена (названной LF и RF) амплифицировали с использованием праймеров Agl1-50.1 / Agl1-m13F и Agl1-30.1 / Agl1-m13R в комбинации, с использованием геномной ДНК Guy11. Agl1-m13F и Agl1-m13R имеют дополнительные 5'-последовательности, соответствующие праймерам M13F / M13R. Эта дополнительная последовательность облегчила проведение ПЦР с перекрытием слияния во втором раунде. В параллельной реакции селектируемый маркер ILV1 амплифицировали в двух частях с использованием праймеров M13F / SUR-F и M13R / SUR-R из кассетного гена устойчивости к сульфонилмочевине [36], а затем клонировали в pBluescript (Stratagene).Эти два продукта были названы IL и LV из гена ILV1 . Первую ПЦР проводили в следующих условиях цикла в градиентном цикле Applied Biosystems GeneAmp PCR System: этап начальной денатурации при 94 ° C в течение 5 минут, за которым следовали 35 циклов параметров цикла ПЦР, 94 ° C в течение 30 секунд, 62 ° C или 30 секунд и 72 ° C в течение 1 минуты с последующим окончательным удлинением при 72 ° C в течение 10 минут. Каждая реакция ПЦР на 25 мкл содержала 1 мкл ДНК-матрицы (50 нг), 20 пмоль каждого праймера, от 2 до 4 мМ MgCl 2 ,2.5 мкл термофильного 10-кратного реакционного буфера без MgCl 2 (500 мМ KCl, 100 мМ Tris-HCl [pH 9 при 25 ° C] и 1% Triton X-100), 2 мМ всех четырех дезоксинуклеозидтрифосфатов (dNTPs, Amersham BioSciences), 0,3 мкл Taq и 0,2 мкл ДНК-полимеразы Pfu . Полученный продукт анализировали гель-электрофорезом и очищали в геле. Во втором раунде ПЦР каждый фланг сливали с одной половиной селектируемого маркера (LF / IL и RF / LV) с использованием вложенных праймеров Agl1-nesF / IL, расщепления и Agl1-NesR / LV.Условия были установлены как начальная денатурация при 94 ° C в течение 5 минут с последующими 35 циклами параметров цикла ПЦР, 94 ° C в течение 30 секунд, 62 ° C в течение 30 секунд, 72 ° C в течение 3 минут, с последующим окончательным продлением при 72 ° C в течение 10 мин. Полученный продукт анализировали гель-электрофорезом и очищали в геле, готовым к грибковой трансформации. Гомологичная рекомбинация между перекрывающимися областями селектируемого маркера и хромосомной ДНК приводит к целенаправленной делеции гена [25]. Трансформанты подвергали скринингу с помощью ДНК-блоттинга.Последовательности праймеров, использованных в исследовании, показаны в таблице S1.

Анализы активности ферментов

Потеря активности амилоглюкозидазы в штаммах Δ agl1 и потеря активности гликогенфосфорилазы в штаммах Δ gph2 была подтверждена ферментативно с использованием белков, экстрагированных из Δ agl1 и Δ gph2, сравниваемых штаммов. к Guy11. Штаммы выращивали в GMM в течение 16 часов с последующей сушкой вымораживанием и подготовкой образцов, как описано ранее [12].Вкратце, 10 мг высушенного мицелия на штамм в трех экземплярах были тонко измельчены и повторно суспендированы в 1 мл стерильной дистиллированной H 2 O. Каждый образец был мгновенно заморожен в жидком азоте для разрушения мицелиальных клеток и высвобождения всех клеток. белок и центрифугировали 3 мин. После центрифугирования образцы хранили на льду. 50 мкл этого раствора, содержащего общий клеточный белок, аспирировали в трех экземплярах из каждого образца и добавляли к 1 мл каждого ферментного анализа. Все ферментные анализы проводили при 22 ° C.Все компоненты анализа были приобретены у Sigma. Активность ферментов определяли спектрофотометрически в трех экземплярах и выражали как концентрацию продукта, образованного за одну минуту общим клеточным белком из 1 мг мицелия. Активность амилоглюкозидазы [52] определяли путем инкубации 50 мкл каждого раствора общего клеточного белка с 1% раствором крахмала, избытком очищенной гексокиназы и избытком очищенной глюкозо-6-фосфатдегидрогеназы. Agl1 в образце белка высвобождает глюкозу из крахмала, который фосфорилируется гексокиназой, и образующийся глюкозо-6-фосфат используется для генерации НАДФН из НАДФ с использованием глюкозо-6-фосфатдегидрогеназы.Скорость увеличения НАДФН по мере продвижения ферментного анализа, измеренная спектрофотометрически при A 340 и сравниваемая со скоростью продукции НАДФН в анализах, не содержащих крахмала или экстракта вареного мицелиального белка, была измерена для расчета активности Agl1 в каждом образце. Для определения активности гликогенфосфорилазы [52] 50 мкл белкового экстракта из каждого образца добавляли к 1 мл ферментного анализа в трех экземплярах. Каждый анализ содержал 4% гликогена, избыток очищенной фосфоглюкомутазы и избыток очищенной глюкозо-6-фосфатдегидрогеназы.Gph2 высвобождает глюкозо-1-фосфат из гликогена, который фосфоглюкомутазой превращается в глюкозо-6-фосфат. Глюкозо-6-фосфатдегидрогеназа преобразовывала НАДФ в НАДФН с использованием глюкозо-6-фосфата, и скорость увеличения НАДФН по мере продвижения ферментативного анализа, измеренная при A 340 и по сравнению с контрольными реакциями без гликогена или белкового экстракта, использовалась для расчета активность Gph2 в каждом образце. Протоколы были получены с веб-сайта Sigma (www.sigma.com). Концентрации трегалозы измеряли, как описано ранее [12].Вкратце, образцы обрабатывали треалазой для высвобождения глюкозы из трегалозы, а глюкозу измеряли с использованием избытка очищенной гексокиназы для образования глюкозо-6-фосфата, который использовался избытком глюкозо-6-фосфатдегидрогеназы для образования НАДФН из НАДФ. Количество НАДФН, образованного в образцах, обработанных треалазой, по сравнению с теми же образцами, не обработанными треалазой, измеряли по A 340 и рассчитывали количество трегалозы в каждом образце.

Создание конструкции слитой плазмиды Agl1: sGFP

Ген AGL1 амплифицировали из геномной ДНК изогенного штамма Guy11 дикого типа с праймерами Agl1-Pro-U / Agl1-Fus-D, 2.Аллель гена ацетолактатсинтазы размером 8 т.п.н. ( ILV1 ), придающий устойчивость к сульфонилмочевине, был амплифицирован с праймерами Sur-U / Sur-D из pCB1532 [36], а 1,4 т.п.н. sGFP: trpC амплифицирован с праймерами GFP-U / TrpC-D. из pNOX1sGFP. Последовательности праймеров показаны в дополнительной таблице S1. Фрагменты ПЦР трансформировали дрожжами pNEB1284 Spe I / Hin dIII в S. cerevisiae . Слияние генов было сконструировано путем клонирования с восстановлением разрывов в дрожжах на основе гомологичной рекомбинации в дрожжах [53].Полученную плазмиду трансформировали в изогенный штамм дикого типа Guy11.

Создание конструкции слитой плазмиды Gph2: sGFP

Ампликон 4,1 т.п.н., состоящий из промотора M. oryzae GPh2 и открытой рамки считывания, амплифицировали с помощью ПЦР из геномной ДНК Guy11 с праймерами Gph2-P-SacII и Gph2-SpeI-D и клонировали в pGEM®-T (Promega). Фрагмент вырезали с помощью сайтов рестрикции Sac II / Spe I и клонировали в pCB1532, состоящую из аллеля гена устойчивости к сульфонилмочевине (ацетолактатсинтаза или ILV1 ), для получения pGPh2.Фрагмент 1,4 т.п.н. кассеты sGFP: trpC (Chiu et al. , 1996) амплифицировали с помощью ПЦР с использованием праймеров GFP-SpeI-U и TrpC-ClaI-D (дополнительная таблица S1) и затем клонировали в pGPh2 с Spe I ограничивающие сайты для создания слияния pGPh2sGFP. Плазмиду слияния трансформировали изогенным Guy11 из M. oryzae .

Фенотипический анализ мутантов

Для определения скорости вегетативного роста диаметр колонии измеряли через 12 дней роста на полной среде [41].Частоту и характер прорастания конидий и образования аппрессориев определяли микроскопически путем подсчета количества зародышевых трубок и / или аппрессорий, образовавшихся из конидий после инкубации на гидрофобных пластиковых покровных стеклах в течение различных периодов времени.

Мобилизацию гликогена визуализировали под микроскопом, как описано выше.

Влияние делеции каждого гена на патогенность грибов определяли путем распыления 5 × 10 4 спор / мл на чувствительные к CO-39 линии риса и восприимчивые линии ячменя Golden Promise, как описано ранее [41].

Для исследования генерации аппрессорного тургора был использован метод зарождающегося циторриза (клеточного коллапса) [54], [55]. Конидии в концентрации 2 × 10 4 мл -1 инкубировали на гидрофобных пластиковых покровных стеклах для индукции образования аппрессория. Затем удаляли окружающую воду и заменяли равным объемом раствора глицерина в диапазоне концентраций от 0,5 до 5,0 М. После 10 минут инкубации регистрировали количество разрушившихся аппрессорий.Проникновение аппрессорий в кутикулу изучали с помощью эпидермального пилинга лука, как описано Chida and Sisler (1987). Конидиям с концентрацией 5 × 10 4 спор / мл позволяли прорасти на эпидермисе лука, и скорость успешного апрессориум-опосредованного проникновения в эпидермис оценивали с помощью световой микроскопии. Все эксперименты проводили в трех повторностях.

Аппрессориум-опосредованное проникновение в оболочку рисового листа оценивали с использованием процедуры, основанной на процедуре Канканала и др. , 2007 [28].Конидиальную суспензию с концентрацией 1 × 10 5 спор мл -1 собирали в 0,25% желатине и инокулировали на оболочки листьев над средней жилкой. Инокулированные оболочки оставляли во влажных чашках Петри на 24, 36 и 48 ч в горизонтальном положении, чтобы суспензия оставалась на среднем участке вены. Когда они были готовы к микроскопии, оболочки были обрезаны вручную, чтобы удалить боковые стороны и нижнюю поверхность, чтобы обнажить одноклеточный эпидермальный слой средней вены (толщиной 2–3 клетки).Этот эпидермальный слой помещали на предметное стекло и наблюдали с помощью системы сканирующего конфокального света (CLSM) Zeiss LSM510 Meta.

Целенаправленная замена гена

GSN1 и NMR3

Нацеленная замена гена GSN1 и NMR3 была проведена в Guy11 и Δ agl1 Δ gph2 , соответственно, с использованием стратегии расщепленных маркеров, как объяснялось ранее, где GSN1 был заменен на резистентность к гигромицину B. Маркер hph и NMR3 был заменен селективным маркером устойчивости к биалафосу bar .Последовательности праймеров, использованных в исследовании, показаны в дополнительной таблице S1. После трансформации трансформанты подвергали скринингу в присутствии гигромицина B (200 мг / мл -1 ) на устойчивость к гигромицину и глюфосината аммония (100 мг / мл -1 ) на устойчивость к баялафосу. Замены генов подтверждали анализом ДНК-блоттинга.

Анализ экспрессии генов

Количественная ОТ-ПЦР была использована для характеристики экспрессии генов TPS1 и TPS3 у Guy-11, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2.Для анализа экспрессии генов мицелия, выращенного в полной среде, изогенный Guy-11 дикого типа, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 был инокулирован в CM 48 часов с последующей экстракцией РНК [41] , синтез кДНК и анализ QRT-PCR. Синтез кДНК выполняли с использованием набора для синтеза кДНК AffinityScript QPCR (Stratagene) в соответствии с протоколом производителя. Анализ экспрессии генов выполняли с использованием набора Brilliant Green QPCR Master Mix от Stratagene и прибора MX3005P (Stratagene) в соответствии с протоколом производителя.Экспрессию TPS1 , TPS3 и RSY1 анализировали с использованием праймеров Tps1-qRT-5 '( 5'-CTTATCGTCAACCCCTGGAAC-3' ) и Tps1-3 '( 5'-TCCCTTCCGTCTTC ), Tps3-qRT-5 '( 5'-CACATCAACGACGCCTGCGA-3 ) и Tps3-3' ( 5'-ATGTAGCTCTTGCCTCTGTGTT-3 ') и Rsy1-qRT-5' ( 5'CGAGTC ) и Rsy1-qRT-3 '( 5'-TTATTTGTCGCCAAAGGTCTCC-3' ). Экспрессия была нормализована относительно β-тубулина (MGG_00604.6) экспрессия гена с использованием праймеров QRT.PCR.BTubF ( CGCGGCCTCAAGATGTCGT ) и QRT.PCR.BTubR ( GCCTCCTCCTCGTACTCCTCTTCC ). Условиями ПЦР были 94 ° C в течение 30 секунд, 62 ° C в течение 30 секунд и 72 ° C в течение 30 секунд.

Дополнительная информация

Рисунок S3

Нацеленная делеция гена AGL1 и GPh2 в M. oryzae Guy11. А . Организация AGL1 , показывающая сайты рестрикции и ориентацию кодирующей области. В . Целевые векторы для замены гена с делецией гена AGL1 , демонстрирующие образование нулевых мутантов. С . ДНК-гель-блоттинг-анализ мутантов M. oryzae Δ agl1 . ДНК расщепляли Nhe I, фракционировали, блотировали и зондировали с помощью 2,8 т.п.н. Hin dIII- Hin dIII AGL1 удаленный фрагмент, 1,7 кб Hin dIII- Hin dIII AGL1 фрагмент промотора или кассету 1,4 кб Hph .Дорожка 1, Guy11; Дорожка 2–5, Δ agl1 мутанты; Дорожки 6 и 7, эктопические трансформанты agl1 . Д . Организация локуса ГПх2 Е . Целевые векторы для замены гена для делеции гена GPh2 , показывающие и генерирующие нулевые мутанты F . ДНК-гель-блот-анализ мутантов M. oryzae Δ gph2 . ДНК расщепляли Sph I, фракционировали, блотировали и зондировали удаленным фрагментом GPh2 в 2,2 т.п.н., a 1.Фрагмент промотора GPh2 размером 4 т.п.н. или кассета Hph размером 1,4 т.п.н. Дорожка 1, Guy11; Дорожки 2, 4 и 5, мутанты Δ gph2 ; Дорожки 3 и 6, эктопические трансформанты gph2 .

(PDF)

Рисунок S4

Направленное разрушение гена AGL1 в мутанте Δ gph2 из M. oryzae . А . Схематическое изображение локуса AGL1 , показывающее сайты рестрикции и ориентацию кодирующей области.ДНК выделяли и проверяли на предмет успешной целевой гомологичной рекомбинации в месте события B . ПЦР-анализ. Два праймера, Agl1-50.1 и Agl1-30.1, использовали для обнаружения разницы в размерах между эктопическими трансформантами и потенциальными двойными мутантами Δ agl1 Δ gph2 . L = 1 т.п.н. плюс ДНК-лестница (Invitrogen), G = геномная ДНК от Guy11, дорожки 1–10 геномной ДНК от предполагаемых трансформантов Δ agl1 Δ gph2 . Дорожки 6, 7, 10 = предполагаемые двойные мутанты Δ agl1 Δ gph2 . С . Предполагаемые мутанты Δ agl1 Δ gph2 проверяли с помощью гибридизационного анализа по Саузерну. Дорожка G = Guy11; Дорожка g = Δ gph2 ; дорожка 2 = эктопический трансформант 2; Дорожки 6, 7, 10 = предполагаемые двойные мутанты Δ agl1 Δ gph2 . Блот исследовали с удаленной областью AGL1 . Д . Была выделена общая РНК и синтезирована кДНК. 5'-кодирующая область AGL1 (789 п.н.) амплифицировали в неколичественной реакции ОТ-ПЦР.Все три анализа подтвердили успешное разрушение гена AGL1 в фоновом мутанте Δ gph2 . Трансформант 6 (AG-6) был выбран для дальнейшего фенотипического анализа и в дальнейшем обозначен как Δ agl1 Δ gph2 . L = 1 т.п.н. плюс ДНК-лестница, G = Guy11 (дикий тип), g = Δ gph2 , a = Δ agl1 , гДНК = геномная ДНК Guy11.

(PDF)

Рисунок S5

Комплементация Δ agl1 и Δ gph2 мутантов M.oryzae восстанавливает рост на крахмале. Полноразмерные гены AGL1 и GPh2 под контролем их нативных промоторов трансформировали в мутанты Δ gph2 и Δ gph2 соответственно и отобрали трансформанты. Анализы на планшете проводили на минимальной среде с крахмалом в качестве единственного источника углерода. Повторное введение каждого гена восстановило их способность расти на крахмале.

(PDF)

Рисунок S6

Аминокислотное выравнивание предсказанных M.oryzae Gsn1 с описанными гликогенсинтазами. Предсказанная аминокислотная последовательность M. oryzae GSN1 (MGG_07829.6) была сопоставлена ​​с продуктами транслирования Homo sapiensf , Gys1 & Gys2 и Saccharomyces cerevisiae , Gsy1 (YFR015C) и Gsy2 (YLR258W). Последовательности были идентифицированы из базы данных NCBI и SGD (http://www.yeastgenome.org/), выровнены с использованием ClustalW (Thompson et al. , 1994) и закрашены с помощью GeneDoc Version 2.6.002. Остатки в черном цвете идентичны для всех перечисленных белков, консервативные изменения показаны серым, а те, что на белом фоне, не показывают никакого сходства.Консервативные предполагаемые остатки серина или треонина, которые являются кандидатами на посттрансляционное фосфорилирование, показаны синим цветом.

(DOC)

Рисунок S7

Целенаправленная делеция гена GSN1 в M. oryzae Guy11. А . Схематическое изображение локуса GSN1 . В . ДНК выделяли, расщепляли Stu I и фракционировали в 0,8% агарозном геле. Гель обрабатывали методом саузерн-блоттинга и зондировали с помощью 2.Фрагмент 35 т.п.н. кодирующей области GSN1 , чтобы показать присутствие или отсутствие кодирующей области. Фрагмент 0,96 т.п.н. верхней фланкирующей области также использовали в качестве зонда для демонстрации полиморфизма длины рестрикционного фрагмента, показанного на нижней панели. Трансформанты G3, G10, G12 и G13 являются предполагаемыми мутантами Δ gsn1 . L = 1 т.п.н. плюс ДНК-лестница (Invitrogen). G2 и G4 = эктопические трансформанты.

(PDF)

Рисунок S8

Целенаправленная делеция гена NMR3 в мутанте M. Δ agl1 Δ gph2 .oryzae . А . Организация локуса NMR3 для демонстрации сайтов рестрикции Pst I и схематическое изображение, показывающее механизм делеции гена NMR3 с использованием стратегии расщепления маркеров. ДНК выделяли из трансформантов Δ agl1 Δ gph2 и предполагаемых Δ agl1 Δ gph2 Δ nmr3 и расщепляли Pst I. Расщепленную ДНК фракционировали в 0,8% агарозном геле и переносили в Hybond. -N. В . Мембрану зондировали 5'-фланкирующим фрагментом ДНК размером 1 т.п.н. для подтверждения мутантов Δ agl1 Δ gph2 Δ nmr3 на основе полиморфизма длины рестрикционного фрагмента. Трансформант 10 был выбран для дальнейшего фенотипического анализа и в дальнейшем назван Δ agl1 Δ gph2 Δ nmr3 . WT = Guy11, 1–11 = предполагаемый Δ agl1 Δ gph2 Δ nmr3 трансформантов и AG6 = Δ agl1 Δ gph2 .

(PDF)

Таблица S1

Олигонуклеотидные праймеры, использованные в этом исследовании.

(DOCX)

Гены метаболизма гликогена участвуют в регуляции патогенности, опосредованной трегалозой-6-фосфат-синтазой, грибком рисового взрыва Magnaporthe oryzae

Abstract

Нитчатый гриб Magnaporthe oryzae болезнь. Здесь мы показываем, что гены метаболизма гликогена играют важную роль в заражении растений M.oryzae . Нацеленная делеция AGL1 и GPh2 , которые кодируют амилоглюкозидазу и гликогенфосфорилазу, соответственно, предотвращала мобилизацию запасов гликогена во время развития аппрессория и вызывала значительное снижение способности M. oryzae вызывать болезнь рисового бласта. Напротив, целевая мутация GSN1 , кодирующая гликогенсинтазу, значительно снижает синтез внутриклеточного гликогена, но не влияет на патогенность грибов.Мы обнаружили, что потеря AGL1 и GPh2 привела к снижению экспрессии TPS1 и TPS3 , которые кодируют компоненты комплекса трегалоза-6-фосфатсинтаза, который действует как генетический переключатель в M. oryzae . Tps1 реагирует на уровни глюкозо-6-фосфата и баланс НАДФ / НАДФН, регулируя экспрессию генов, ассоциированную с вирулентностью, в сочетании с ингибиторами транскрипции Nmr. Мы показываем, что делеция гена ингибитора транскрипции NMR3 частично восстанавливает вирулентность мутанта Δ agl1Δgph2 , предполагая, что гены метаболизма гликогена необходимы для работы NADPH-зависимого генетического переключателя в M.oryzae .

Об авторе

Грибок Magnaporthe oryzae вызывает разрушительную болезнь риса, называемую взрывом. Ежегодно вирусная эпидемия риса уничтожает почти четверть потенциального урожая риса в мире. Грибок поражает рисовые растения, создавая особую инфекционную структуру, называемую аппрессорием, которая физически разрушает жесткую внешнюю кутикулу рисового листа. Magnaporthe может развивать аппрессории при отсутствии источника питательных веществ. Поэтому мы изучаем, как гриб использует запасы энергии в своих спорах для своего первоначального роста и развития.Гликоген является ключевым запасным соединением в грибах, и в этом исследовании мы исследовали, как происходит распад гликогена в грибах рисового бласта. Мы показали, что два основных фермента, разрушающих клеточные запасы гликогена, важны при болезни рисового бласта. Однако мы также обнаружили, что штамм гриба, у которого сильно нарушена способность синтезировать собственный гликоген, все еще может нормально инфицировать растения. Чтобы объяснить эти явно противоречивые результаты, мы исследовали регуляторную роль распада гликогена и предоставили доказательства того, что метаболизм гликогена является ключевым регулятором недавно описанного генетического переключателя, связанного с вирулентностью, в Магнапорте, который управляется ферментом, называемым трегалозо-6-фосфатсинтазой.

Введение

Райсовая болезнь является наиболее серьезным заболеванием культивируемого риса и в последние годы вызвала эпидемии в Южной Корее, Японии, Бутане и Китае [1], [2], что привело к серьезным потерям урожая. Поэтому понимание биологии рисовой пестициды важно для разработки надежных стратегий борьбы с этим заболеванием [2].

Рисовый грибок, Magnaporthe oryzae , вызывает заражение листьев риса, образуя специализированную инфекционную структуру, называемую аппрессорием [2].Это одноклеточная куполообразная структура, которая развивается из конца грибковой зародышевой трубки и отвечает за механическое повреждение кутикулы риса, позволяя грибку проникать в клетки растений. Развитие аппрессория регулируется клеточным циклом в M. oryzae с контрольными точками, регулирующими инициацию и созревание аппрессория [3], [4]. Дифференциация аппрессория сопровождается аутофагией в конидиуме, что приводит к запрограммированной гибели клеток и мобилизации содержимого трехклеточной споры в инфекционную клетку.Предотвращение аутофагии путем делеции любого из основных генов, связанных с неселективной макроаутофагией, делает гриб непатогенным, демонстрируя, что рециклинг содержимого конидия необходим для правильного функционирования аппрессория [3], [5 ].

Огромный тургор, создаваемый аппрессорием M. oryzae , является результатом накопления глицерина, который действует как совместимое растворенное вещество, вызывая приток воды в клетку для создания гидростатического давления [6].Отток глицерина предотвращается слоем меланина в клеточной стенке аппрессория, и мутанты, неспособные синтезировать меланин, не могут генерировать тургор и, следовательно, не являются патогенными. Ранее было показано, что запасы гликогена и липидные тела перемещаются из конидия в апрессорий M. oryzae до образования тургора [7] - [9]. Этот процесс контролируется Pmk1 MAP kinase pathway, который регулирует морфогенез appressorium [10] и, вероятно, связан с началом аутофагии в конидии [3].Распад липидов и гликогена в аппрессории контролируется путем ответа цАМФ, и мутанты cpkA , лишенные активности протеинкиназы А, обнаруживают значительные задержки в распаде липидов и гликогена [7]. Быстрые изменения первичного метаболизма во время созревания аппрессория, по-видимому, частично регулируются генетическим переключателем, опосредованным трегалозо-6-фосфатсинтазой (Tps), который реагирует на уровни глюкозо-6-фосфата (G6P) и баланс NADPH / NADP. в ячейках [11]. Tps-опосредованный переключатель генов взаимодействует с тремя ингибиторами транскрипции, которые регулируют экспрессию генов, связанных с вирулентностью, в ответ на преобладающие метаболические условия [11].

В этом исследовании мы исследовали роль метаболизма гликогена в функции аппрессория M. oryzae . Мы показываем, что запасы гликогена в споре быстро разрушаются во время прорастания спор в процессе, регулируемом путем ответа цАМФ. Мы демонстрируем, что гены гликогенфосфорилазы GPh2, и амилоглюкозидазы AGL1 , которые кодируют ферменты, необходимые для расщепления цитозольного гликогена, являются факторами вирулентности, участвующими в инфекции растений.Однако неожиданно мы также показали, что гликогенсинтаза, кодируемая геном GSN1 в M. oryzae , не обязательна для патогенности. Чтобы объяснить этот очевидный парадокс, мы приводим доказательства того, что потеря активности амилоглюкозидазы или гликогенфосфорилазы в M. oryzae приводит к снижению экспрессии TPS1 , тем самым влияя на регуляцию G6P / NADPH-зависимого гена [11] - [13] ]. В соответствии с этой идеей, мы показываем, что делеция NMR3 , одного из ингибиторов транскрипции, связанных с Tps1, частично восстанавливает вирулентность мутанта Δ gph2Δagl1 .Наши результаты показывают, что распад гликогена в аппрессории является важным фактором в регулировании экспрессии генов, связанных с вирулентностью.

Результаты

Мобилизация гликогена во время инфекционного развития

Magnaporthe oryzae

Чтобы исследовать роль мобилизации гликогена во время формирования аппрессория, мы сначала изучили клеточное распределение гранул гликогена в штамме M. oryzae дикого типа, Guy-11 и регуляторных мутантах, затронутых морфогенезом аппрессория.У Guy-11 непрораставшие конидии (0 ч инкубации) были богаты гликогеном, на что указывает темный осадок в каждой из трех конидиальных клеток после инкубации в растворе йода (), как описано ранее [7]. Во время прорастания и раннего образования аппрессория (2–4 ч) гликоген расщеплялся, а остаточный гликоген локализовался только в центральной клетке конидия. После 6 ч прорастания гликоген появился в зарождающемся апрессории, но быстро истощился во время созревания апрессория, пока через 24 часа не стали видны только темное кольцо меланина вокруг апрессория и небольшое количество зерен гликогена (, [7]).

Распределение клеток и количественный анализ гликогена во время морфогенеза аппрессоров у M. oryzae .

Микрофотографии мобилизации гликогена во время развития аппрессория M. oryzae . Конидии штаммов M. oryzae проращивали на гидрофобных пластиковых покровных стеклах. Образцы отбирали через 0 ч, 2 ч, 4 ч, 6 ч, 8 ч, 12 ч, 24 ч и 48 ч и окрашивали на наличие гликогена раствором йода. Желтовато-коричневые отложения гликогена сразу стали видны с помощью модулирующей оптики Хоффмана с микроскопом Nikon Optiphot-2. А . Штамм дикого типа Guy 11, проращенный в воде. В . ΔcpkA мутант DF51. С . Штамм дикого типа Guy 11 проращивали в полной среде (CM), содержащей 2% дрожжевого экстракта. Бар = 10 мкм. D – F Графики, показывающие биохимический анализ мобилизации гликогена во время формирования аппрессория M. oryzae Конидии проращивали в воде на гидрофобных пластиковых покровных стеклах и позволяли формировать аппрессории. Количество гликогена в пикограммах оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген. Д . Штамм дикого типа Guy 11. E . ΔcpkA мутант DF51. Ф . Δmac1 sum1-99 мутант DA-99. Каждая точка данных представляет собой среднее значение трех независимых повторов эксперимента. Планки погрешностей показывают стандартное отклонение.

Чтобы изучить роль пути цАМФ в мобилизации гликогена, мы исследовали мутант ΔcpkA (). CPKA кодирует каталитическую субъединицу цАМФ-зависимой протеинкиназы A [14], [15].Конидии изначально были богаты гликогеном, но деградация гликогена у мутантов ΔcpkA была отложена, гликоген все еще присутствовал в конидиях через 8 часов. Затем гликоген откладывался в деформированных аппрессориях ΔcpkA , но эти клетки не развивались полностью и гликоген не разрушался (). Мы пришли к выводу, что путь цАМФ регулирует эффективную деградацию гликогена во время прорастания и образования аппрессория. В соответствии с этой идеей, мутант супрессора обхода цАМФ Δmac1 sum1-99 [16], обнаруживает ускоренный распад гликогена в аппрессориях, как сообщалось ранее [7].

Чтобы определить, связана ли мобилизация гликогена с развитием аппрессориев, конидии Guy-11 проращивали в условиях с высоким содержанием питательных веществ (2% дрожжевой экстракт), которые подавляют образование аппрессориев [16]. Наблюдалась ограниченная деградация отложений гликогена, и через 48 ч гранулы гликогена можно было увидеть внутри разветвленных зародышевых трубок (). Таким образом, мобилизация гликогена из конидиума связана с морфогенезом аппрессория в условиях отсутствия питательных веществ.

Биохимический анализ мобилизации гликогена в развивающемся апрессории

Затем мы разработали анализ, позволяющий количественно оценить запасы гликогена, и обнаружили, что непроращенные конидии Guy11 содержат около 1200 пг гликогена ().Мы наблюдали 1500 пг гликогена проростков -1 через 2 часа прорастания, во время прорастания зародышевой трубочки, но между 2 и 12 часами после прорастания количество гликогена упало до 500 пг проростков -1 и оставалось на этом уровне во время созревания аппрессория. , что представляет собой среднее снижение на 988 пг с 95% семейным доверительным интервалом (667, 1310), p <0,001. За все 48 часов средний уровень гликогена снизился на 751 пг (95% ДИ 1073, 430 p <0.001). Сравнить эти результаты с предыдущими измерениями уровня гликогена в почкующихся дрожжах Saccharomyces cerevisiae [17], они должны быть преобразованы в фемтомоли (фмоль) на клетку. Количество клеток M. oryzae можно легко определить только через 0 ч (3-клеточный конидий) и 48 ч (одноклеточный апрессорий). Следовательно, непроращенный конидиум M. oryzae содержит в среднем 2363 фмоль клеток гликогена -1 , в то время как аппрессорий содержит 2450 фмоль клеток гликогена -1 .Значительная емкость гликогена клеток M. oryzae дикого типа подчеркивается, когда эти значения сравниваются с 19,5 фмоль гликогена, измеренным в дрожжевых клетках S. cerevisiae [17]. Мутант ΔcpkA содержал более низкие уровни гликогена, чем Guy11 (). В 0 ч мы обнаружили 800 мкг проростков гликогена -1 . Не было значительных изменений в уровнях гликогена ΔcpkA за весь период времени (общее среднее снижение на 13 пг [95% ДИ 354, 328 p = 1]).В цАМФ-независимом мутантном штамме PKA Δmac1 sum1-99 анализ гликогена выявил изначально высокие уровни гликогена в 1700 пг зародышей -1 (). Это продолжало увеличиваться до пика при 2100 пг проростков -1 через 4 часа (среднее увеличение от 0 до 4 часов для 450 пг [95% ДИ -265, 1164 p = 0,545]). Между 4 и 6 часами после прорастания, во время образования аппрессория, уровни гликогена быстро снижались в среднем на 986 пг проростков -1 (95% ДИ 1700, 272 p <0.001). Уровни снова повышались до 12 часов, достигая пика при более низком значении 1800 пг проростков -1 (среднее увеличение 646 пг [95% ДИ -152, 1445 p = 0,2156]. Затем гликоген постепенно снижался в среднем на 1340 пг за оставшиеся 36 часов (95% ДИ 2139, 541 p <0,001) до конечного значения примерно 400 пг проростки -1 через 48 ч. За весь период времени уровни гликогена в сумме Δmac11- 99 мутант уменьшился в среднем на 1230 пг (95% ДИ 1944, 516 p <0.001). Мы пришли к выводу, что путь ответа цАМФ регулирует мобилизацию гликогена во время развития аппрессория у M. oryzae .

Идентификация и характеристика

M. oryzae AGL1 и GPh2

Чтобы определить, необходима ли мобилизация гликогена для патогенности M. oryzae , мы идентифицировали основные ферменты, связанные с его расщеплением. Гликоген состоит из цепей глюкозы, связанных α-1,4-гликозидной связью, и примерно у каждого десятого остатка точка разветвления образована α-1,6-гликозидной связью.Амилоглюкозидаза (фермент разветвления гликогена) удаляет α-1,6-гликозидные связи из сильно разветвленного полимера, высвобождая глюкозу. Предполагаемый ген, кодирующий амилоглюкозидазу, AGL1 (MGG_00063.6), был идентифицирован в последовательности генома M. oryzae . [18]. AGL1 имеет открытую рамку считывания 4749 п.н., прерванную двумя интронами длиной 134 и 91 п.о., и кодирует предполагаемый белок из 1583 п.о. Сопоставление потенциального белка Agl1 M. oryzae с амилоглюкозидазами других организмов (рисунок S1) выявило 72% идентичности гипотетическому белку из Neurospora crassa и 47% идентичности ферменту разветвления гликогена Gdb1 S.cerevisiae [19]. Дальнейший анализ белковой последовательности выявил четыре консервативных участка аминокислот, присутствующих в α / β бочкообразном домене всех членов суперсемейства α-амилазы (данные не показаны). Разрушение гликогена также требует действия гликогенфосфорилазы. Этот фермент дополняет α-1,6-гликозидную активность амилоглюкозидазы, воздействуя на экзогликозидные α-1,4-гликогенные связи гликогена, последовательно отщепляя и фосфорилируя невосстанавливающие концы полимера.Был идентифицирован ген M. oryzae GPh2 (MGG_01819.6) и выявлена ​​ORF длиной 2664 п.о., кодирующая предполагаемый белок 888 аминокислотных остатков. В последовательности присутствовали два старт-сайта ATG в рамке считывания, самый 5'-из них имеет индикаторный нуклеотид старт-сайта, А, на -3 п.н. [20], который, вероятно, является сайтом инициации трансляции для GPh2 [21]. Белок показал 78% идентичности гипотетическому белку в N. crassa и 74% идентичности предполагаемой гликогенфосфорилазе из Aspergillus fumigatus (Рисунок S2).В S. cerevisiae сайт фосфорилирования присутствует в N-концевой области белка [22]. Белок M. oryzae демонстрирует высокую степень сходства с этой последовательностью, а остаток треонина, с которым связывается фосфат в дрожжевой гликогенфосфорилазе, является консервативным. Кроме того, все гликогенфосфорилазы обладают сайтом связывания для пиридоксаль-5'-фосфата, кофактора, участвующего в фосфорилировании. Альдегидная группа этого производного пиридоксина образует основание Шиффа со специфической лизиновой боковой цепью гликогенфосфорилазы [23].Аминокислотная последовательность, окружающая этот сайт, была идентифицирована в дрожжевой гликогенфосфорилазе [22] и является высококонсервативной в M. oryzae GPh2 с 17 из 18 остатков, идентичными у двух организмов (данные не показаны). Последовательность геномной ДНК длиной 3021 п.н. M. oryzae GPh2 также была идентифицирована из опубликованной последовательности генома [18]. Сравнение этой геномной последовательности с последовательностью кДНК GPh2 выявило присутствие четырех интронов.

Целенаправленная замена гена

M.oryzae AGL1 и GPh2

Чтобы изучить роль AGL1 и GPh2 в патогенности M. oryzae , мы выполнили целевую замену гена (рисунок S3A). Фрагмент Hin dIII размером 2,8 т.п.н. (рисунок S3B), содержащий большую часть 5'-области AGL1 , был удален и заменен кассетой гигромицинфосфотрансферазы [24], придающей устойчивость к гигромицину B. Полученная конструкция (рисунок S3B) ) вводили в Guy-11 и проверяли трансформанты с помощью гель-блоттинга ДНК (рис. S3C).Чтобы удалить GPh2 , часть кодирующей последовательности размером 3 т.п.н. в 2,2 т.п.н. была впоследствии заменена кассетой устойчивости 1,4 т.п.н. к гигромицин-фосфотрансферазе (рисунок S3D). Полученная кассета была введена в Guy-11 и отобраны трансформанты (Рисунок S3E).

Делецию каждого гена подтверждали измерением активности ферментов Agl1 и Gph2 (). Активность амилоглюкозидазы не была обнаружена в штамме Δ agl1 , а активность гликогенфосфорилазы не была обнаружена в мутантах Δ gph2 .Однако мы также наблюдали, что активность амилоглюкозидазы не может быть обнаружена в штаммах с делецией Δ gph2 . Амилоглюкозидаза расщепляет точки разветвления гликогена только тогда, когда они становятся доступными под действием гликогенфосфорилазы и, следовательно, не могут быть измерены в этом анализе.

Столбчатые диаграммы, показывающие активность амилоглюкозидазы и гликогенфосфорилазы у мутантов M. oryzae , метаболизирующих гликоген.

Подробнее о ферментативных анализах см. Материалы и методы. А . Активность амилоглюкозидазы не была обнаружена в мутантах Δ agl1 или, как следствие использованного анализа, в штаммах Δ gph2 . В . гликогенфосфорилазная активность отсутствовала у мутанта Δ gph2 .

Для создания двойного мутанта Δ agl1 Δ gph2 мы провели целевую делецию AGL1 в мутанте Δ gph2 , используя метод делеции гена маркера расщепления [25]. Конструкции с делецией генов трансформировали в Δ gph2 с использованием аллеля гена ацетолактатсинтазы, придающего устойчивость к сульфонилмочевине.Полученные трансформанты были отобраны и проанализированы с помощью гель-блоттинга ДНК (рис. S4). Кроме того, была проведена ОТ-ПЦР для подтверждения успешной делеции гена. В Guy11 и Δ gph2 был амплифицирован ампликон длиной 789 п.н., соответствующий транскрипту Agl1, но это не было обнаружено в мутантах Δ agl1 или двойных мутантах Δ agl1 Δ gph2 (рисунок S4D).

Δ

agl1 и Δ gph2 мутанты демонстрируют измененный метаболизм гликогена

Чтобы исследовать, затрагивается ли клеточное распределение гликогена у мутантов, несущих целевые делеции AGL1 и GPh2 , мы проанализировали мобилизацию гликогена во время образования Δagl1 , Δgph2 и Δ agl1 Δ gph2 ().Мобилизация гликогена замедлялась у мутантов Δ agl1 и Δ agl1 Δ gph2 , и гликоген не истощался из конидий до 24 часов по сравнению с 8–12 часами у Guy11. Напротив, мутанты Δ gph2 оказались менее подверженными мобилизации гликогена. Эти результаты предполагают, что амилоглюкозидаза более важна для эффективного разложения гликогена во время развития, связанного с инфекцией, чем гликогенфосфорилаза. Это может отражать способность недавно описанной глюкоамилазы выполнять α-1,4-гликозидную активность гликогенфосфорилазы и, таким образом, потенциально компенсировать потерю этой активности [25].Однако гликогенфосфорилаза важна для разрушения мицелиального гликогена, поскольку гликоген накапливается в штаммах Δ gph2 во время роста на минимальной среде (), но не в штаммах Δ agl1 .

Распределение клеток и количественная оценка гликогена во время морфогенеза аппрессория у мутантов Δ agl1 и Δ gph2 M. oryzae .

А . Конидии инкубировали на гидрофобных стеклянных покровных стеклах, чтобы позволить апрессориям развиться до окрашивания раствором йода.Мутанты Δ agl1 и Δ agl1 Δ gph2 были нарушены в мобилизации гликогена из конидия в аппрессорий и в последующей деградации в аппрессории, тогда как мутант Δ gph2 был сравним с Guy11. Шкала шкалы = 10 мкм. В . Количественное определение гликогена в экстрактах мицелия дикого типа и метаболических мутантах гликогена M. oryzae . Штаммы выращивали либо в жидкой CM в течение 48 часов, либо в CM с последующим выращиванием в GMM в течение 16 часов.Культуры собирали, промывали 0,2% CaCl 2 и сушили вымораживанием. Количество гликогена, присутствующего в мицелии -1 нмольмг, оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген. Значения, обозначенные разными буквами (a, b,), статистически значимы при p <0,01. С . Тесты роста, чтобы показать использование крахмала и гликогена в качестве единственных источников углерода. Минимальную среду, содержащую глюкозу, крахмал или гликоген, засевали мицелиальной пробкой М.oryzae и инкубировали в течение 12 дней. Чашки с крахмалом и гликогеном заливали йодом, чтобы визуализировать разницу в использовании субстрата. Йод окрашивает крахмал в синий цвет, а гликоген в коричневый цвет. У мутантов гликогена была нарушена их способность использовать как крахмал, так и гликоген в качестве единственного источника углерода.

Чтобы определить, способны ли мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 использовать внешний гликоген в качестве единственного источника углерода, мы провели тесты роста на различных источниках углерода.Оба мутанта Δ agl1 и Δ gph2 вместе с двойным мутантом Δ agl1 Δ gph2 были способны утилизировать глюкозу, но их рост был нарушен на гликогене и крахмале (). Повторное введение AGL1 и GPh2 в соответствующие нуль-мутанты дополняло мутантный фенотип (рисунок S5). Мы пришли к выводу, что мутанты Δ agl1 и Δ gph2 обладают нарушенной способностью использовать как крахмал, так и гликоген в качестве единственного источника углерода.

Agl1 и Gph2 локализуются в цитоплазме конидий, аппрессорий и инвазивных гиф

Для определения субклеточного расположения Agl1p и Gph2p во время образования аппрессория, AGL1: GFP и GPh2: GFP экспрессировали слияниями генов Guy11. . Слияния Agl1-GFP и Gph2-GFP локализуются по всей цитоплазме в конидиях Guy11 и внутри зародышевых трубок и возникающих аппрессорий к 2 часам и 4 часам соответственно (). Через 8 часов флуоресцентный сигнал наблюдался преимущественно в развивающемся апрессории, а через 24 часа Agl1-GFP и Gph2-GFP были обнаружены исключительно в цитоплазме апрессория.Интересно, что Agl1-Gfp и Gph2-Gfp также были высоко экспрессированы во время заражения растений через 36 часов и локализовались в цитоплазме внутриклеточных инвазивных гиф грибов (2).

Локализация Agl1-GFP и Gph2-GFP на разных стадиях морфогенеза аппрессория и в росте planta с помощью M. oryzae .

А . Конидиям давали возможность сформировать аппрессории, и локализацию Agl1-GFP и Gph2-GFP наблюдали в течение 24 часов с использованием инвертированного эпифлуоресцентного микроскопа Olympus IX-81, снабженного камерой HQ 2 .Слитые белки были локализованы в цитоплазме в конидиях, зародышевой трубке и апрессории. Шкала шкалы = 10 мкм. В . Конидии собирали из штаммов Agl1-GFP и Gph2-GFP и инкубировали на оболочке рисового листа во влажной камере. Конфокальную систему лазерного сканирующего микроскопа Zeiss LSM510 Meta использовали для наблюдения экспрессии Agl1-GFP и Gph2-GFP в эпидермальной ткани риса через 36 часов после инкубации. Agl1-GFP и Gph2-GFP экспрессировались цитоплазматически в инвазивных гифах. Шкала шкалы = 20 мкм.

М.oryzae Δ agl1 , Δ gph2 , Δ agl1 Δ gph2 мутанты обладают нарушенной способностью вызывать болезнь рисового бласта

Чтобы определить роль AGL1 и gph2 в патогенности GPh2 засевали восприимчивый сорт риса CO-39 и сорт ячменя Golden Promise однородными суспензиями спор каждого мутанта и Guy-11 (). У мутантов Δ agl1 и Δ gph2 количество повреждений уменьшилось на 50.44 ± 6% ( P <0,0001) и 44,7 ± 2,4% ( P <0,001), соответственно, тогда как у штамма Δ agl1 Δ gph2 количество поражений уменьшилось на 75,44 ± 1,4% ( P <0,0001) (). У мутантов не обнаружено дефектов прорастания конидий и образования аппрессориев в условиях отсутствия питательных веществ, и частота образования аппрессориев также не пострадала (данные не показаны). Ранее предполагалось, что распад гликогена может быть значительным в генерации тургора аппрессория [6], [7], [26].Поэтому мы измерили тургор аппрессория у мутантных штаммов Δ agl1 и Δ gph2 , используя анализ зарождающегося циторриза [6]. Несмотря на различия в мобилизации гликогена у мутантных штаммов (), мы не обнаружили существенных различий в тургоре между аппрессориями мутантных штаммов и Guy-11 (не показано). Затем мы использовали анализ эпидермиса лука [27], чтобы определить, может ли наблюдаемое снижение вирулентности быть следствием нарушения функции аппрессория. Однако не наблюдали значительных различий в эпидермальном проникновении между Guy-11 и мутантными штаммами Δagl1 , Δgph2 и Δagl1Δgph2 , которые обычно вырабатывали штыри для проникновения (не показаны).Следовательно, уменьшение образования повреждений, наблюдаемое для Δ agl1 , Δ gph2 и Δagl1Δgph2 , не является следствием пониженного тургорного давления или нарушения функции аппрессора. Чтобы исследовать колонизацию тканей каждым мутантом, был проведен анализ оболочки рисового листа [28]. Мы обнаружили, что мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 не обладают способностью к инвазивному росту внутри клеток риса. Мутанты, метаболизирующие гликоген, образовывали необычные инвазивные гифы, которые были менее выпуклыми и разветвленными, чем обычно ().Мы пришли к выводу, что мутанты Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 способны нормально проникать в клетки риса, но не могут эффективно размножаться в тканях риса, что приводит к уменьшению симптомов заболевания.

Анализы заражения и проникновения мутантов Δ agl1 , Δ gph2 и Δ agl1Δgph2 M. oryzae .

А . Пятнадцатидневные проростки риса сорта СО-39 или 8-дневные проростки ячменя Golden Promise опрыскивали конидиальной суспензией из 5 × 10 -4 спор спор -1 мл и инкубировали при 24 ° C. при сильном освещении и влажности 90% в течение 5 дней.Показанные листья представляют типичные симптомы, связанные с каждым штаммом. Эксперимент был повторен шесть раз с аналогичными результатами. Столбчатые диаграммы показывают плотности поражений, полученные на инфицированных листьях риса, выбранных случайным образом. Односторонний анализ ANOVA показал, что у мутантных штаммов была значительная недостаточность их способности вызывать болезнь рисового бласта. Значения, обозначенные разными буквами (a, b, c), статистически значимы при p <0,01. В . Для исследования инвазии в ткани хозяина конидии инкубировали на оболочке рисового листа в течение 36 часов и наблюдали с помощью лазерной конфокальной микроскопии.Штамм дикого типа Guy11 показал рост с инвазивными луковичными и разветвленными гифами. Мутанты по метаболизму гликогена продуцировали менее луковичные и разветвленные инвазивные гифы внутри рисовых клеток. Шкала шкалы = 20 мкм.

Идентификация гена, кодирующего гликоген-синтазу

M. oryzae

Учитывая важность мобилизации гликогена для вирулентности, мы решили создать штамм M. oryzae , запасы гликогена истощены. Предполагаемый ген, кодирующий гликоген-синтазу, был идентифицирован из M.База данных генома oryzae (http://www.broadinstitute.org/annotation/fungi/magnaporthe/) с использованием алгоритма BLASTX [29], основанного на его предсказанной аминокислотной гомологии с гликоген-синтазами дрожжей и млекопитающих. Одна последовательность, MGG_07289.6, выровнена с гликогенсинтазами дрожжей и млекопитающих [30], [31]. Предсказанный ген, кодирующий гликоген-синтазу, который мы назвали GSN1 , присутствует как единичный ген в геноме M. oryzae и, по прогнозам, содержит пять экзонов, прерванных четырьмя интронами [29].Предсказанный ген кодирует белок из 708 аминокислот и показал высокое сходство последовательностей с Gsy1p и Gsy2p дрожжей [30] и Gys1p и Gys2p специфичных для мышц и печени форм гликогенсинтазы человека [31]. На рисунке S6 показан результат выравнивания ClustalW [32]. S. cerevisiae Gsy1 и Gsy2 показали 63% и 64% идентичности с M. oryzae GSN1 , соответственно, тогда как Homo sapiens Gys1 и Gys2 показали идентичность 60% и 55% соответственно. Сайты фосфорилирования, предположительно участвующие в посттрансляционной регуляции Gsy2p, консервативны в M.oryzae Гсн1п. В Gsy2p три сайта фосфорилирования присутствуют в S650, S654 и T667 на C-конце [33], тогда как в Gsn1p предсказанные остатки присутствуют в положениях S632, S636 и T645 на C-конце, как показано на дополнительном рисунке S5.

Синтез гликогена не влияет на патогенность

M. oryzae

Для создания нулевого мутанта Δ gsn1 M. oryzae , целевую замену гена GSN1 проводили с использованием метода делеции гена маркера расщепления (рисунок S6A) [25].Конструкции с делецией генов трансформировали в Guy11, и предполагаемые трансформанты подвергали скринингу на основании их устойчивости к гигромицину B (фигура S7). У мутантов Δ gsn1 отложения гликогена не могли четко наблюдаться (), в отличие от Guy11 (). Для дальнейшего исследования мы измерили гликоген с помощью ферментативного анализа и наблюдали значительное снижение ( P <0,01) гликогена в клетках мутанта Δ gsn1 (). Мы пришли к выводу, что синтез гликогена серьезно нарушен как в конидиях, так и в аппрессориях в отсутствие гена гликогенсинтазы GSN1 .

Распределение гликогена в клетках во время морфогенеза аппрессория у мутанта гликоген-синтазы Δ gsn1 из M. oryzae .

А . Конидиям давали возможность образовать аппрессории, а затем проводили окрашивание раствором йода. Отложения гликогена отсутствовали в конидиях и на всем протяжении развития аппрессория. Шкала шкалы = 10 мкм. В . Анализы заражения мутантами Δ gsn1 . Споры собирали из 12-дневных культур Guy11 и мутанта Δ gsn1 и инокулировали распылением в концентрации 5 × 10 4 конидий мл -1 на 3-недельные проростки риса и 8-дневные проростки. рассада ячменя.Растения инокулировали при 24 ° C, сильном освещении и влажности 90% в течение пяти дней. Листья собирали и оценивали на наличие симптомов взрыва риса. Не наблюдалось очевидной разницы между патогенностью штамма Guy11 дикого типа и мутанта гликоген-синтазы Δ gsn1 . Эксперимент повторяли три раза с идентичными результатами, и не наблюдали статистически значимых различий в плотности или степени поражения (не показано). C. Количественное определение гликогена в конидиях дикого типа и мутантах гликогенсинтазы M.oryzae . Конидии собирали с 12-дневных чашек дикого типа и двух мутантов с делецией Δ gsn1 и разбавляли до концентрации 1 × 10 6 мл -1 . Количество гликогена в конидиях -1 мг / мл оценивали путем измерения глюкозы, высвобожденной после инкубации клеточных экстрактов с ферментами, разрушающими гликоген (+). Также показано количество глюкозы без добавления ферментов, расщепляющих гликоген (-). Значения с разными буквами (a, b,) статистически значимы при p <0.01.

Изучить роль GSN1 в прогрессировании болезни рисовой пигментации, проростков риса CO-39 и ячменя сорта. Каждый Golden Promise был инокулирован мутантом гликогенсинтазы Δ gsn1 и штаммом дикого типа Guy11. Мутант Δ gsn1 был способен вызывать симптомы болезни рисового бласта, которые были идентичны штамму дикого типа, из которого можно сделать вывод, что этот ген является незаменимым для заражения рисовым бластом как у риса, так и у ячменя ().Мы пришли к выводу, что синтез гликогена в качестве запасного продукта в спорах у M. oryzae не является существенным для патогенности.

Δ

agl1 , Δ gph2 и Δ agl1 Δ gph2 мутанты влияют на синтез трегалозы

Мы были заинтригованы, обнаружив, что нарушение синтеза гликогена не влияет на вирулентность M. oryzae. при условии, что оба мутанта Δ agl1 и Δ gph2 показали такие выраженные дефекты в их способности вызывать болезнь рисового взрыва.Поэтому мы решили определить, были ли другие биохимические различия очевидны у любого из метаболических мутантов гликогена. Интересно, что мы наблюдали, что оба мутанта Δ agl1 и Δ gph2 показали пониженные уровни трегалозы во время вегетативного роста на CM (). Это предполагает, что в M. oryzae предшественники трегалозы, по крайней мере, во время роста мицелия, могут быть получены в результате деградации гликогена или на них влияет потеря активности этих ферментов. Поэтому мы проанализировали экспрессию TPS1 и TPS3 в мутантах Guy11, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 . TPS1 кодирует трегалозо-6-фосфат (T6P) синтазу, а TPS3 кодирует субъединицу комплекса T6P-синтаза / трегалоза фосфатаза [34]. Экспрессия TPS1 была снижена в 5 раз у мутантов Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 по сравнению с Guy11 (), тогда как экспрессия TPS3 была снижена в 6 раз при Δ . agl1 , 9 раз в Δ gph2 и в 50 раз в мутанте Δ agl1 Δ gph2 ().Мы также исследовали экспрессию гена RSY1 , участвующего в пути биосинтеза меланина [35], поскольку известно, что TPS1 регулирует экспрессию нескольких генов, связанных с вирулентностью, включая гены биосинтеза меланина, через генетический ген TPS1 / NMR . переключатель [11]. Экспрессия RSY1 также подавлялась в независимых одиночных и двойных мутантах (не показаны).

Анализ синтеза трегалозы у метаболических мутантов гликогена M.oryzae .

А . Количественное определение трегалозы в экстрактах мицелия. Штаммы выращивали либо в жидкой CM в течение 48 часов, либо в CM с последующим выращиванием в GMM в течение 16 часов. Культуры собирали, промывали 0,2% CaCl 2 и сушили вымораживанием. Экстракты мицелия получали с метилендихлоридом и метанолом и анализировали на трегалозу. Уровни трегалозы были значительно снижены у мутантов метаболизма гликогена по сравнению с Guy11. Эксперимент был повторен трижды с аналогичными результатами.Значения, обозначенные разными буквами (a, b, c, d), статистически значимы при p <0,01. В . Анализ экспрессии генов TPS1 и C . TPS3 в мицелии с помощью сравнительной количественной ОТ-ПЦР в реальном времени. Уровни транскриптов TPS1 , TPS3 были подавлены у мутантов, метаболизирующих гликоген. Эксперимент повторяли дважды, каждый с тремя техническими повторами, с аналогичными результатами. Односторонний анализ ANOVA показал, что мутантные штаммы имели значительные дефекты в экспрессии гена биосинтеза трегалозы.Обилие транскриптов показано относительно экспрессии гена M. oryzae β -тубулина (MGG_00604). Значения, обозначенные разными буквами (a, b, c, d), статистически значимы при p <0,01.

Делеция

NMR3 частично восстанавливает Δ agl1 Δ gph2 фенотип двойного мутанта

Известно, что M. oryzae Tps1 действует как G6P-чувствительный белок, напрямую связываясь с G6P и NADPH для контроля экспрессии набор ассоциированных с вирулентностью генов, экспрессируемых при заражении растений [11].Мы предположили, что если гены метаболизма гликогена ( AGL1 и GPh2 ) регулируют экспрессию TPS1 во время инфекции, то делеция одного из генов ингибитора транскрипции, который, как было показано, взаимодействует с Tps1p, может частично компенсировать фенотипические дефекты, связанные с Δ agl1 Δ gph2 двойной мутант [11]. Делеции NMR1 , NMR2 или NMR3 , например, было показано, что достаточно для восстановления патогенности мутанта Δ tps1 [11].Поэтому мы провели целенаправленную делецию гена NMR3 в двойном мутанте Δ agl1 Δ gph2 , поскольку двойные мутанты Δ tps1 Δ nmr3 показали максимальное восстановление патогенности [11]. Мы использовали стратегию расщепления маркеров для нацеливания на локус NMR3 для делеции гена, как показано на рисунке S8A. [25]. После трансформации трансформантов M. oryzae были первоначально проверены на устойчивость к биалафосу [36], и делеция была подтверждена с помощью гель-блоттинга ДНК (рис. S8B).

Для проверки вирулентности Δ agl1 Δ gph2 Δ nmr3 на восприимчивом сорте риса CO-39 был проведен анализ патогенности с использованием Guy11, Δ agl1 Δ gph2. agl1 Δ gph2 Δ nmr3 мутант. Мы обнаружили, что делеция гена NMR3 восстанавливала способность мутанта Δ agl1 Δ gph2 вызывать бластную болезнь, как показано на рис. Не наблюдалось существенной разницы в количестве повреждений между Guy11 и Δ agl1 Δ gph2 Δ nmr3 при заражении риса ( P <0.05) или инфекции ячменя (). Мы пришли к выводу, что AGL1 и GPh2 могут влиять на работу Tps1-опосредованного механизма регуляции гена, который необходим для болезни рисового бласта.

Анализ рисового бласта Δ agl1 Δ gph2 и Δ agl1 Δ gph2 Δ nmr3 мутанта M. oryzae .

А . 3-недельные проростки риса сорта СО-39 опрыскивали суспензией спор 5 × 10 4 спор -1 мл и инкубировали в течение 5 дней при 24 ° C. В . Поражения оценивали на случайно выбранных инфицированных листьях. Показанные листья представляют типичные симптомы, связанные с каждым испытанным штаммом. Эксперименты повторяли шесть раз с идентичными результатами. У Δ agl1 Δ gph2 Δ nmr3 была частично восстановлена ​​его способность вызывать бластную болезнь. Значения, обозначенные разными буквами (a, b), статистически значимы при p <0,01. C. 8-дневные проростки ячменя Golden Promise опрыскивали конидиальной суспензией из 5 × 10 -4 спор спор -1 мл и инкубировали при 24 ° C, сильном освещении и влажности 90% в течение 5 дней.Показанные листья представляют типичные симптомы, связанные с каждым штаммом. Эксперимент был повторен трижды с аналогичными результатами.

Обсуждение

В этом исследовании мы намеревались изучить роль метаболизма гликогена в возникновении болезни рисового бласта, вызываемой M. oryzae . Предыдущие сообщения установили, что мобилизация гликогена происходит во время развития аппрессория и может зависеть от cAMP-зависимой протеинкиназы A и путей передачи сигналов MAP kinase Pmk1 [7].Запасы гликогена в аппрессории также были предложены в качестве потенциального субстрата для производства глицерина в аппрессории, способствуя генерации тургора для разрыва кутикулы растения [6], [7], [26]. Запасы гликогена в аппрессориях, например, явно используются во время созревания аппрессориев до заражения растений [26]. При совместном рассмотрении результаты, представленные в этом исследовании, свидетельствуют о том, что деградация цитозольного гликогена в M. oryzae , которая требует гликогенфосфорилазы и амилоглюкозидазы, играет важную роль в вирулентности этого гриба.Этот вывод основан на мутантных фенотипах Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 двойных мутантов, у которых нарушена их способность вызывать бластную болезнь. Однако кажется вероятным, что влияние на вирулентность является плейотропным, а не специфически связанным с использованием резервов гликогена, поскольку мутанты Δ gsn1 , запасы гликогена которых значительно уменьшены из-за отсутствия активности гликогенсинтазы, не подвержены вирулентности.Этот результат предполагает, что запасы гликогена в конидиях и аппрессориях не обязательны для генерации тургора аппрессория и заражения растений. Представленные здесь данные также предполагают, что потеря GPh2 и AGL1 снижает экспрессию TPS1 , который, как известно, интегрирует контроль углеродного и азотного метаболизма в M. oryzae в ответ на уровни G6P и NADPH / NADP [11] .

В начале этого исследования мы были особенно заинтересованы в понимании того, как мобилизация гликогена происходила во время развития аппрессория M.oryzae . Поэтому изначально мы провели цитологический и биохимический анализ, чтобы изучить движение и распад запасов гликогена. Результаты этих экспериментов согласуются, показывая, что гликоген быстро разлагается во время прорастания конидий и что этот процесс замедляется у мутантов Δ cpkA , лишенных каталитической субъединицы протеинкиназы A. Наоборот, Δ mac1 sum1-99 мутант, шунтирующий супрессор нулевого мутанта аденилатциклазы, который несет мутацию в цАМФ-связывающем кармане регуляторной субъединицы протеинкиназы A [16], демонстрирует неправильную регуляцию хранения гликогена в споре.Это согласуется с более ранними предположениями, основанными исключительно на микроскопии [7], что мутанты Δ mac1 sum1-99 ускоряют распад гликогена и липидов. Взятые вместе, эти наблюдения предполагают, что путь ответа цАМФ играет важную роль в регуляции цитозольного метаболизма гликогена.

Чтобы исследовать роль распада гликогена в заражении растений M. oryzae , мы создали мутанты с делецией гена, лишенные активности ферментов амилоглюкозидазы и гликогенфосфорилазы.Фенотипический анализ показал, что двойные мутанты Δ agl1 и Δ agl1 Δ gph2 имели серьезные дефекты в расщеплении гликогена в конидиях, и через 24 часа розетки гликогена оставались видимыми в конидиях обоих мутантных штаммов. Гиперакопление гликогена ранее наблюдалось у мутантов Δ agl1 и Δ gph2 S. cerevisiae . [37], [38], демонстрируя важность этих ферментов для использования запасов гликогена.Предыдущее сообщение показало, что вакуолярная глюкоамилаза, Sga1, в M. oryzae может вносить вклад в утилизацию гликогена во время конидиогенеза [39]. Мутанты, лишенные активности Sga1, показали пониженную конидиацию, что согласуется с ролью вакуолярного аутофагического гидролиза гликогена во время развития спор. Интересно отметить, что мутанты Δ sga1 , однако, не проявили какого-либо влияния на развитие или патогенность аппрессоров [39], предполагая, что M. oryzae может разлагать гликоген посредством вакуолярного аутофагического механизма во время развития спор, но в основном цитозольный путь во время спор. прорастание и развитие аппрессориев, даже несмотря на то, что большой всплеск аутофагии связан с прорастанием конидий, запрограммированной гибелью клеток и созреванием аппрессориев [3], [5].Слияния генов Agl1-GFP и Gph2-GFP, например, подтвердили, что оба фермента локализованы в цитоплазме внутри конидий, зародышевых трубок и аппрессорий.

Фенотипы мутантов Δ agl1 и Δ gph2 согласуются с мобилизацией и использованием гликогена, оказывающими значительное влияние на способность M. oryzae вызывать болезнь, вызываемую грибковой инфекцией риса. Однако делеция GSN1 , который кодирует гликогенсинтазу, привела к значительному снижению уровней гликогена в клетках, но не оказала никакого влияния на патогенность M.oryzae .. Липиды, гликоген и трегалоза являются основными запасами питательных веществ, используемых конидиями M. oryzae для прорастания и дифференциации аппрессориев (см. обзор [2]). Основываясь на результатах, представленных здесь, кажется, что использование гликогена не может быть таким значительным фактором созревания апрессория, как гидролиз триацилглицерина [9]. Активность триацилглицерин липазы, например, индуцируется во время развития аппрессория у M. oryzae . [7].

Наиболее значимый вывод, который мы можем сделать относительно роли AGL1 и GPh2 в патогенности M.oryzae заключается в том, что отсутствие этих ферментных активностей снижает экспрессию гена TPS1 . Из M. oryzae известно, что активность Tps1 важна для болезни рисового бласта и формирует NADPH-зависимый генетический переключатель [11]. Мутанты, лишенные Tps1, способны продуцировать аппрессории, но они нефункциональны, и гриб не может колонизировать ткани риса [40]. Мутант Δ tps1 не продуцирует трегалозу или ее промежуточный трегалозо-6-фосфат (T6P), но нарушение патогенности происходит не просто из-за потери биосинтеза трегалозы.Мутации в G6P-связывающих карманах Tps1, например, сделали гриб непатогенным, в то время как мутации в каталитических сайтах, необходимых для синтеза T6P, не повлияли на его роль в заболевании, вызванном грибковой инфекцией риса, что позволяет предположить, что потеря связывания G6P связана с потерей патогенности [12]. Tps1 объединяет использование источников углерода и азота, а мутанты Δ tps1 неспособны расти на нитрате из-за воздействия на активность нитратредуктазы (NR) [34]. НАДФН является кофактором нитратредуктазы и обеспечивает восстанавливающую способность.Достаточные пулы НАДФН необходимы для функции NR и вырабатываются окислительным пентозофосфатным путем посредством активации дегидрогеназы G6P (G6PDH). Было показано, что как уровни НАДФН, так и активность G6PDH снижены у мутантов Δ tps1 , что указывает на то, что экспрессия G6PDH находится под контролем Tps1 [34]. Сверхэкспрессия G6PDH восстанавливает дефект патогенности мутантов Δ tps1 , а недавно было показано, что Tps1 непосредственно связывается с NADPH, что указывает на более широкую регуляторную роль в использовании углерода и азота [11].Также было показано, что Tps1 является позитивным регулятором трех факторов транскрипции GATA в процессе, который негативно регулируется тремя NADP-зависимыми белками-ингибиторами Nmr. Факторы транскрипции GATA положительно регулируют экспрессию связанной с вирулентностью экспрессии генов способом, модулируемым активностью белков-ингибиторов ЯМР, и, в конечном итоге, зависят от клеточных уровней NADPH / NADP и G6P [11]. Поразительно, что мы наблюдали, что мутанты Δ agl1 и Δ gph2 уменьшают накопление трегалозы.Более того, гены, кодирующие фермент биосинтеза трегалозы, TPS1 и TPS3 , подавляются у мутантов по метаболизму гликогена. Поэтому мы предположили, что Agl1 и Gph2 могут регулировать экспрессию Tps1 и Tps3. Делеции NMR3 было достаточно для восстановления вирулентности двойного мутанта Δ agl1 Δ gph2 , хотя и с небольшими повреждениями. Это предполагает, что метаболизм гликогена может вносить вклад в контроль NADPH-зависимого генетического переключателя Tps1.Это интересно, потому что было показано, что экспрессия гена AGL1 и GPh2 и оборот гликогена затрагиваются в штаммах Δ tps1 [34], что позволяет предположить, что у дикого типа может существовать механизм отрицательной обратной связи для регулирования обмена гликогена в ответ на зондирование G6P. Таким образом, при совместном рассмотрении наше исследование позволило получить фундаментальную новую информацию о роли метаболизма гликогена в грибковом грибке Magnaporthe oryzae . Представленные здесь результаты предполагают, что метаболизм гликогена играет более широкую регуляторную роль, чем первоначально предполагалось, но вряд ли существует прямая потребность в деградации гликогена для подпитки опосредованного аппрессорием проникновения в кутикулу.Вместо этого эффект Agl1p и Gph2p на Tps1-зависимый генетический переключатель предполагает важную и неожиданную регуляторную роль во время инфекции растений.

Материалы и методы

Штаммы грибов и условия культивирования

Изоляты Magnaporthe oryzae , использованные в этом исследовании, хранятся в лаборатории NJT. Описанные мутанты с целевой заменой генов изогены по отношению к рису дикого типа ( Oryza sativa ) патогенный Magnaporthe штамм Guy-11.Состав сред и процедуры для культивирования и поддержания грибов, экстракции нуклеиновых кислот и ДНК-опосредованной трансформации были описаны ранее [41].

Анализ внутриклеточного гликогена

Гликоген в развивающихся аппрессориях визуализировали с помощью йодной окраски, состоящей из 60 мг KI и 10 мг I 2 мл -1 в дистиллированной воде [42]. Свежесобранные конидии в концентрации приблизительно 1 × 10 5 мл -1 инкубировали на гидрофобных пластиковых покровных стеклах либо в стандартной питательной среде (CM) с добавлением 2% дрожжевого экстракта, либо в дистиллированной воде в течение определенного периода времени.Через несколько секунд контакта с желто-коричневым пятном отложения гликогена можно было наблюдать микроскопически. Для измерения количества гликогена, присутствующего на стадиях развития M. oryzae , был разработан протокол, основанный на экспериментах, проведенных на S. cerevisiae . [17], [43] - [46]. Спорулирующие культуры M. oryzae в возрасте 12 дней в возрасте заливали стерильной дистиллированной водой и соскребали стеклянным разбрасывателем. Полученную суспензию фильтровали через стерильный miracloth (Calbiochem) и конидии выделяли центрифугированием при 20 ° C (5000 г , 10 минут).После промывки в дистиллированной воде конидии концентрировали центрифугированием и разбавляли приблизительно до 1 × 10 6 конидий на мл -1 . Образцы разделяли и инкубировали на гидрофобных пластиковых покровных стеклах в течение периодов времени 0, 2, 4, 6, 8, 24 или 48 часов перед переносом в микроцентрифужные пробирки, нагревали до 100 ° C в течение 10 минут для остановки ферментативного действия и охлаждали на льду. . Затем конидии были разрушены с помощью 10-минутной обработки ультразвуком, выполняемой 10-секундными импульсами с использованием ультразвукового устройства Vibracell (Sonics and Materials Inc., Данбери, США). Фрагменты клеток осаждали центрифугированием и 760 мкл супернатанта удаляли в свежую пробирку. К этому добавляли 100 мкл 50 мМ CaCl 2 и 100 мкл 0,5 М NaOAc pH 5,0 вместе со следующими ферментами, которые превращают гликоген в глюкозу: 29 мкл амилоглюкозидазы (Roche, Германия), 10 мкл α-амилазы (Sigma). В контрольном эксперименте эти ферменты были заменены стерильной дистиллированной водой. Реакции инкубировали в течение ночи при 57 ° C при постоянном вращении перед центрифугированием при 5,000 g в течение 3 минут.Для каждой временной точки супернатант из двенадцати аликвот по 50 мкл анализировали с помощью набора для анализа глюкозооксидазы (Sigma Diagnostics), в котором конечная интенсивность цвета пропорциональна концентрации глюкозы. Значения оптической плотности образца измеряли при 450 нм с использованием планшет-ридера Dynex Technologies MRX II (Jencons-PLS). Контроль без добавления фермента использовали для измерения фонового уровня глюкозы. Полный эксперимент проводился в трех биологических повторностях в отдельные дни, и средние уровни гликогена рассчитывались для каждой временной точки.Уровни гликогена анализировали с помощью линейных моделей смешанных эффектов для каждого мутантного штамма индивидуально, с культивированием как случайным эффектом и временем (часами) как фиксированным эффектом. Затем все попарные сравнения были выполнены с помощью тестов Tukey HSD для поддержания общего тестового уровня 5%. Средние значения и различия в средних значениях представлены с 95% семейным доверительным интервалом и скорректированными по Тьюки p-значениями. Пакеты nlme и multcomp в R v2.15 использовались для выполнения статистического анализа.

Идентификация и целенаправленная замена гена

M.oryzae AGL1 и GPh2

Геномная ДНК из M. oryzae была использована для амплификации полимеразной цепной реакции (ПЦР) с праймерами AGL1 ( 5'-GCGTACATGGCCTGCTTTGAACGTA-3 ') и AGL2 ( 5'-TGCTCTGTGTGAGGAGT000), разработанными к консервативным областям последовательности метки экспрессированной последовательности AGL1 (EST) из базы данных Института генетики Университета Клемсона (CUGI) (http://www.genome.clemson.edu/). ПЦР проводили с применением 35 циклов амплификации.После начальной денатурации в течение 5 минут при 94 ° C использовали следующие условия амплификации: 45 секунд денатурации при 94 ° C, 1 минута отжига при 55 ° C, 1 минута элонгации при 72 ° C. Затем следовало последнее 10-минутное удлинение при 72 ° C. Затем полученный фрагмент геномной ДНК размером 513 п.н. использовали для скрининга библиотеки конидиальной кДНК Guy-11 [15]. Истинный стартовый кодон и 5'-последовательность идентифицированной кДНК AGL1 определяли с использованием стратегии 5'-быстрой амплификации концов кДНК (5'-RACE) [47].Скрининг геномной библиотеки λGEM-11 [41] с клоном кДНК AGL1 выявил геномный клон лямбда Kpn I размером 6,5 т.п.н., названный pLh2. Геномную последовательность этого клона получали с использованием стратегии Genome Priming System (GPS). Эта система на основе транспозона Tn7 использует комплекс транспозазы для случайной вставки транспраймера в мишень дцДНК [48], [49]. Производится популяция продуктов, каждый с транспраймером, вставленным в другое место, и уникальные сайты праймирования на конце каждого транспраймера позволяют секвенировать обе нити целевой ДНК в месте вставки.Для замены гена ампликон 6,0 т.п.н., состоящий из ORF AGL1 с 5'-флангом 1,0 т.п.н., был амплифицирован из геномной ДНК M. oryzae Guy-11 с праймерами AGLvectorF ( 5'-CCTGACGGATAATGGTGGGGTG-3 ') и AGLvectorR ( 5'-CTTCGTCCGCAT CCATGTAGAG-3 '), сконструированный для последовательности генома M. oryzae , штамм 70-15 (http://www.genome.wi.mit.edu/annotation/fungi/magnaporthe /). ПЦР выполняли при следующих условиях: начальная 1 минута денатурации при 95 ° C, затем 30 циклов 1 минута денатурации при 95 ° C, 1 минута отжига при 60 ° C и 6 минут элонгации при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон клонировали в вектор pGEM-T (Promega) для создания плазмиды pLh4. Затем pLh4 расщепляли Hin dIII для высвобождения фрагмента 2,8 т.п.н. ORF AGL1 и линеаризованную плазмиду лигировали с генной кассетой фосфотрансферазы Hin dIII, связанной с 1,4 т.п.н. .

Ген M. oryzae GPh2 был идентифицирован аналогично AGL1 .Праймеры GPh2 ( 5'-CTTCCTCCAGTCAGTAGAGCG-3 ') и GPh3 ( 5'-TTTGAGGAAGTCATAGCTACCG-3' ) были сконструированы из консервативных областей генов, кодирующих GPH, с использованием последовательности EST из базы данных CUGI, показывающей высокую степень сходства. к генам гликогенфосфорилазы из S. cerevisiae [50], [51] и другие организмы. Фрагмент длиной 319 п.н. M. oryzae GPh2 амплифицировали с помощью ПЦР-амплификации в следующих условиях: начальная денатурация в течение 5 минут при 94 ° C, затем 35 циклов амплификации, включающих: 45 секунд денатурации при 94 ° C, 1 минуту отжиг при 54 ° C, удлинение в течение 1 минуты 30 секунд при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон очищали в геле, клонировали в вектор pBluescript (Stratagene) и использовали для скрининга библиотеки конидиальной кДНК Guy-11 [15]. 5'-RACE [47] использовали для определения 5'-последовательности и стартового кодона GPh2 с использованием специфичного для гена праймера, сконструированного для последовательности самого длинного клона кДНК. Чтобы сконструировать вектор замены гена GPh2 , ампликон размером 5,1 т.п.н., содержащий ORF GPh2 с приблизительно 1.0 kb, амплифицировали из геномной ДНК M. oryzae с использованием праймеров GPHnestedF ( 5'-GTTGCACTGAACCTCGAGTCTAGA-3 ') и GPHnestedR ( 5'-TTCGCCAAGG ATGCTGGGCTCAAG-3' последовательности 9 штамм M. oryzae 70-15. Стандартный протокол ПЦР был адаптирован для включения системы Taq Plus® Long PCR (Stratagene), предназначенной для амплификации длинных продуктов. Образцы нагревали до 94 ° C в течение 5 минут, затем применяли следующие условия для 35 циклов: 30 секунд денатурации при 94 ° C, 30 секунд отжиг при 55 ° C, удлинение 9 минут при 72 ° C.Затем следовало последнее 10-минутное удлинение при 72 ° C. Полученный ампликон размером 5165 п.о. очищали в геле и клонировали в вектор pGEM-T (Promega) для создания плазмиды pLh5. Расщепление pLh5 с помощью Bst BI высвободило фрагмент гена размером 2,2 т.п.н., который был заменен кассетой гена Hph , связанной 1,4 т.п.н. Bst BI, связанной с 1,4 т.п.н., для создания вектора делеции гена pLh5 H . Плазмиды pLh4 H и pLh5 H трансформировали в штамм M. oryzae Guy-11.Вставка одной копии плазмидной ДНК была подтверждена для всех трансформантов с помощью гель-блоттинга ДНК.

Нацеленная замена гена AGL1 в штамме Δ gph2 маркером устойчивости к сульфонилмочевине, ILV1 , для генерации Δ agl1 Δ gph2 с использованием стратегии гена-маркера расщепления (Catlett et al. , 2003). Замена была достигнута путем замены 1 т.п.н. 5'-открытой рамки считывания AGL1 геном ILV1 размером 2,8 т.п.н.В первом раунде ПЦР 1 т.п.н. фланкирующей последовательности с каждой стороны кодирующей области гена (названной LF и RF) амплифицировали с использованием праймеров Agl1-50.1 / Agl1-m13F и Agl1-30.1 / Agl1-m13R в комбинации, с использованием геномной ДНК Guy11. Agl1-m13F и Agl1-m13R имеют дополнительные 5'-последовательности, соответствующие праймерам M13F / M13R. Эта дополнительная последовательность облегчила проведение ПЦР с перекрытием слияния во втором раунде. В параллельной реакции селектируемый маркер ILV1 амплифицировали в двух частях с использованием праймеров M13F / SUR-F и M13R / SUR-R из кассетного гена устойчивости к сульфонилмочевине [36], а затем клонировали в pBluescript (Stratagene).Эти два продукта были названы IL и LV из гена ILV1 . Первую ПЦР проводили в следующих условиях цикла в градиентном цикле Applied Biosystems GeneAmp PCR System: этап начальной денатурации при 94 ° C в течение 5 минут, за которым следовали 35 циклов параметров цикла ПЦР, 94 ° C в течение 30 секунд, 62 ° C или 30 секунд и 72 ° C в течение 1 минуты с последующим окончательным удлинением при 72 ° C в течение 10 минут. Каждая реакция ПЦР на 25 мкл содержала 1 мкл ДНК-матрицы (50 нг), 20 пмоль каждого праймера, от 2 до 4 мМ MgCl 2 ,2.5 мкл термофильного 10-кратного реакционного буфера без MgCl 2 (500 мМ KCl, 100 мМ Tris-HCl [pH 9 при 25 ° C] и 1% Triton X-100), 2 мМ всех четырех дезоксинуклеозидтрифосфатов (dNTPs, Amersham BioSciences), 0,3 мкл Taq и 0,2 мкл ДНК-полимеразы Pfu . Полученный продукт анализировали гель-электрофорезом и очищали в геле. Во втором раунде ПЦР каждый фланг сливали с одной половиной селектируемого маркера (LF / IL и RF / LV) с использованием вложенных праймеров Agl1-nesF / IL, расщепления и Agl1-NesR / LV.Условия были установлены как начальная денатурация при 94 ° C в течение 5 минут с последующими 35 циклами параметров цикла ПЦР, 94 ° C в течение 30 секунд, 62 ° C в течение 30 секунд, 72 ° C в течение 3 минут, с последующим окончательным продлением при 72 ° C в течение 10 мин. Полученный продукт анализировали гель-электрофорезом и очищали в геле, готовым к грибковой трансформации. Гомологичная рекомбинация между перекрывающимися областями селектируемого маркера и хромосомной ДНК приводит к целенаправленной делеции гена [25]. Трансформанты подвергали скринингу с помощью ДНК-блоттинга.Последовательности праймеров, использованных в исследовании, показаны в таблице S1.

Анализы активности ферментов

Потеря активности амилоглюкозидазы в штаммах Δ agl1 и потеря активности гликогенфосфорилазы в штаммах Δ gph2 была подтверждена ферментативно с использованием белков, экстрагированных из Δ agl1 и Δ gph2, сравниваемых штаммов. к Guy11. Штаммы выращивали в GMM в течение 16 часов с последующей сушкой вымораживанием и подготовкой образцов, как описано ранее [12].Вкратце, 10 мг высушенного мицелия на штамм в трех экземплярах были тонко измельчены и повторно суспендированы в 1 мл стерильной дистиллированной H 2 O. Каждый образец был мгновенно заморожен в жидком азоте для разрушения мицелиальных клеток и высвобождения всех клеток. белок и центрифугировали 3 мин. После центрифугирования образцы хранили на льду. 50 мкл этого раствора, содержащего общий клеточный белок, аспирировали в трех экземплярах из каждого образца и добавляли к 1 мл каждого ферментного анализа. Все ферментные анализы проводили при 22 ° C.Все компоненты анализа были приобретены у Sigma. Активность ферментов определяли спектрофотометрически в трех экземплярах и выражали как концентрацию продукта, образованного за одну минуту общим клеточным белком из 1 мг мицелия. Активность амилоглюкозидазы [52] определяли путем инкубации 50 мкл каждого раствора общего клеточного белка с 1% раствором крахмала, избытком очищенной гексокиназы и избытком очищенной глюкозо-6-фосфатдегидрогеназы. Agl1 в образце белка высвобождает глюкозу из крахмала, который фосфорилируется гексокиназой, и образующийся глюкозо-6-фосфат используется для генерации НАДФН из НАДФ с использованием глюкозо-6-фосфатдегидрогеназы.Скорость увеличения НАДФН по мере продвижения ферментного анализа, измеренная спектрофотометрически при A 340 и сравниваемая со скоростью продукции НАДФН в анализах, не содержащих крахмала или экстракта вареного мицелиального белка, была измерена для расчета активности Agl1 в каждом образце. Для определения активности гликогенфосфорилазы [52] 50 мкл белкового экстракта из каждого образца добавляли к 1 мл ферментного анализа в трех экземплярах. Каждый анализ содержал 4% гликогена, избыток очищенной фосфоглюкомутазы и избыток очищенной глюкозо-6-фосфатдегидрогеназы.Gph2 высвобождает глюкозо-1-фосфат из гликогена, который фосфоглюкомутазой превращается в глюкозо-6-фосфат. Глюкозо-6-фосфатдегидрогеназа преобразовывала НАДФ в НАДФН с использованием глюкозо-6-фосфата, и скорость увеличения НАДФН по мере продвижения ферментативного анализа, измеренная при A 340 и по сравнению с контрольными реакциями без гликогена или белкового экстракта, использовалась для расчета активность Gph2 в каждом образце. Протоколы были получены с веб-сайта Sigma (www.sigma.com). Концентрации трегалозы измеряли, как описано ранее [12].Вкратце, образцы обрабатывали треалазой для высвобождения глюкозы из трегалозы, а глюкозу измеряли с использованием избытка очищенной гексокиназы для образования глюкозо-6-фосфата, который использовался избытком глюкозо-6-фосфатдегидрогеназы для образования НАДФН из НАДФ. Количество НАДФН, образованного в образцах, обработанных треалазой, по сравнению с теми же образцами, не обработанными треалазой, измеряли по A 340 и рассчитывали количество трегалозы в каждом образце.

Создание конструкции слитой плазмиды Agl1: sGFP

Ген AGL1 амплифицировали из геномной ДНК изогенного штамма Guy11 дикого типа с праймерами Agl1-Pro-U / Agl1-Fus-D, 2.Аллель гена ацетолактатсинтазы размером 8 т.п.н. ( ILV1 ), придающий устойчивость к сульфонилмочевине, был амплифицирован с праймерами Sur-U / Sur-D из pCB1532 [36], а 1,4 т.п.н. sGFP: trpC амплифицирован с праймерами GFP-U / TrpC-D. из pNOX1sGFP. Последовательности праймеров показаны в дополнительной таблице S1. Фрагменты ПЦР трансформировали дрожжами pNEB1284 Spe I / Hin dIII в S. cerevisiae . Слияние генов было сконструировано путем клонирования с восстановлением разрывов в дрожжах на основе гомологичной рекомбинации в дрожжах [53].Полученную плазмиду трансформировали в изогенный штамм дикого типа Guy11.

Создание конструкции слитой плазмиды Gph2: sGFP

Ампликон 4,1 т.п.н., состоящий из промотора M. oryzae GPh2 и открытой рамки считывания, амплифицировали с помощью ПЦР из геномной ДНК Guy11 с праймерами Gph2-P-SacII и Gph2-SpeI-D и клонировали в pGEM®-T (Promega). Фрагмент вырезали с помощью сайтов рестрикции Sac II / Spe I и клонировали в pCB1532, состоящую из аллеля гена устойчивости к сульфонилмочевине (ацетолактатсинтаза или ILV1 ), для получения pGPh2.Фрагмент 1,4 т.п.н. кассеты sGFP: trpC (Chiu et al. , 1996) амплифицировали с помощью ПЦР с использованием праймеров GFP-SpeI-U и TrpC-ClaI-D (дополнительная таблица S1) и затем клонировали в pGPh2 с Spe I ограничивающие сайты для создания слияния pGPh2sGFP. Плазмиду слияния трансформировали изогенным Guy11 из M. oryzae .

Фенотипический анализ мутантов

Для определения скорости вегетативного роста диаметр колонии измеряли через 12 дней роста на полной среде [41].Частоту и характер прорастания конидий и образования аппрессориев определяли микроскопически путем подсчета количества зародышевых трубок и / или аппрессорий, образовавшихся из конидий после инкубации на гидрофобных пластиковых покровных стеклах в течение различных периодов времени.

Мобилизацию гликогена визуализировали под микроскопом, как описано выше.

Влияние делеции каждого гена на патогенность грибов определяли путем распыления 5 × 10 4 спор / мл на чувствительные к CO-39 линии риса и восприимчивые линии ячменя Golden Promise, как описано ранее [41].

Для исследования генерации аппрессорного тургора был использован метод зарождающегося циторриза (клеточного коллапса) [54], [55]. Конидии в концентрации 2 × 10 4 мл -1 инкубировали на гидрофобных пластиковых покровных стеклах для индукции образования аппрессория. Затем удаляли окружающую воду и заменяли равным объемом раствора глицерина в диапазоне концентраций от 0,5 до 5,0 М. После 10 минут инкубации регистрировали количество разрушившихся аппрессорий.Проникновение аппрессорий в кутикулу изучали с помощью эпидермального пилинга лука, как описано Chida and Sisler (1987). Конидиям с концентрацией 5 × 10 4 спор / мл позволяли прорасти на эпидермисе лука, и скорость успешного апрессориум-опосредованного проникновения в эпидермис оценивали с помощью световой микроскопии. Все эксперименты проводили в трех повторностях.

Аппрессориум-опосредованное проникновение в оболочку рисового листа оценивали с использованием процедуры, основанной на процедуре Канканала и др. , 2007 [28].Конидиальную суспензию с концентрацией 1 × 10 5 спор мл -1 собирали в 0,25% желатине и инокулировали на оболочки листьев над средней жилкой. Инокулированные оболочки оставляли во влажных чашках Петри на 24, 36 и 48 ч в горизонтальном положении, чтобы суспензия оставалась на среднем участке вены. Когда они были готовы к микроскопии, оболочки были обрезаны вручную, чтобы удалить боковые стороны и нижнюю поверхность, чтобы обнажить одноклеточный эпидермальный слой средней вены (толщиной 2–3 клетки).Этот эпидермальный слой помещали на предметное стекло и наблюдали с помощью системы сканирующего конфокального света (CLSM) Zeiss LSM510 Meta.

Целенаправленная замена гена

GSN1 и NMR3

Нацеленная замена гена GSN1 и NMR3 была проведена в Guy11 и Δ agl1 Δ gph2 , соответственно, с использованием стратегии расщепленных маркеров, как объяснялось ранее, где GSN1 был заменен на резистентность к гигромицину B. Маркер hph и NMR3 был заменен селективным маркером устойчивости к биалафосу bar .Последовательности праймеров, использованных в исследовании, показаны в дополнительной таблице S1. После трансформации трансформанты подвергали скринингу в присутствии гигромицина B (200 мг / мл -1 ) на устойчивость к гигромицину и глюфосината аммония (100 мг / мл -1 ) на устойчивость к баялафосу. Замены генов подтверждали анализом ДНК-блоттинга.

Анализ экспрессии генов

Количественная ОТ-ПЦР была использована для характеристики экспрессии генов TPS1 и TPS3 у Guy-11, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2.Для анализа экспрессии генов мицелия, выращенного в полной среде, изогенный Guy-11 дикого типа, Δ agl1 , Δ gph2 и Δ agl1 Δ gph2 был инокулирован в CM 48 часов с последующей экстракцией РНК [41] , синтез кДНК и анализ QRT-PCR. Синтез кДНК выполняли с использованием набора для синтеза кДНК AffinityScript QPCR (Stratagene) в соответствии с протоколом производителя. Анализ экспрессии генов выполняли с использованием набора Brilliant Green QPCR Master Mix от Stratagene и прибора MX3005P (Stratagene) в соответствии с протоколом производителя.Экспрессию TPS1 , TPS3 и RSY1 анализировали с использованием праймеров Tps1-qRT-5 '( 5'-CTTATCGTCAACCCCTGGAAC-3' ) и Tps1-3 '( 5'-TCCCTTCCGTCTTC ), Tps3-qRT-5 '( 5'-CACATCAACGACGCCTGCGA-3 ) и Tps3-3' ( 5'-ATGTAGCTCTTGCCTCTGTGTT-3 ') и Rsy1-qRT-5' ( 5'CGAGTC ) и Rsy1-qRT-3 '( 5'-TTATTTGTCGCCAAAGGTCTCC-3' ). Экспрессия была нормализована относительно β-тубулина (MGG_00604.6) экспрессия гена с использованием праймеров QRT.PCR.BTubF ( CGCGGCCTCAAGATGTCGT ) и QRT.PCR.BTubR ( GCCTCCTCCTCGTACTCCTCTTCC ). Условиями ПЦР были 94 ° C в течение 30 секунд, 62 ° C в течение 30 секунд и 72 ° C в течение 30 секунд.

Дополнительная информация

Рисунок S3

Нацеленная делеция гена AGL1 и GPh2 в M. oryzae Guy11. А . Организация AGL1 , показывающая сайты рестрикции и ориентацию кодирующей области. В . Целевые векторы для замены гена с делецией гена AGL1 , демонстрирующие образование нулевых мутантов. С . ДНК-гель-блоттинг-анализ мутантов M. oryzae Δ agl1 . ДНК расщепляли Nhe I, фракционировали, блотировали и зондировали с помощью 2,8 т.п.н. Hin dIII- Hin dIII AGL1 удаленный фрагмент, 1,7 кб Hin dIII- Hin dIII AGL1 фрагмент промотора или кассету 1,4 кб Hph .Дорожка 1, Guy11; Дорожка 2–5, Δ agl1 мутанты; Дорожки 6 и 7, эктопические трансформанты agl1 . Д . Организация локуса ГПх2 Е . Целевые векторы для замены гена для делеции гена GPh2 , показывающие и генерирующие нулевые мутанты F . ДНК-гель-блот-анализ мутантов M. oryzae Δ gph2 . ДНК расщепляли Sph I, фракционировали, блотировали и зондировали удаленным фрагментом GPh2 в 2,2 т.п.н., a 1.Фрагмент промотора GPh2 размером 4 т.п.н. или кассета Hph размером 1,4 т.п.н. Дорожка 1, Guy11; Дорожки 2, 4 и 5, мутанты Δ gph2 ; Дорожки 3 и 6, эктопические трансформанты gph2 .

(PDF)

Рисунок S4

Направленное разрушение гена AGL1 в мутанте Δ gph2 из M. oryzae . А . Схематическое изображение локуса AGL1 , показывающее сайты рестрикции и ориентацию кодирующей области.ДНК выделяли и проверяли на предмет успешной целевой гомологичной рекомбинации в месте события B . ПЦР-анализ. Два праймера, Agl1-50.1 и Agl1-30.1, использовали для обнаружения разницы в размерах между эктопическими трансформантами и потенциальными двойными мутантами Δ agl1 Δ gph2 . L = 1 т.п.н. плюс ДНК-лестница (Invitrogen), G = геномная ДНК от Guy11, дорожки 1–10 геномной ДНК от предполагаемых трансформантов Δ agl1 Δ gph2 . Дорожки 6, 7, 10 = предполагаемые двойные мутанты Δ agl1 Δ gph2 . С . Предполагаемые мутанты Δ agl1 Δ gph2 проверяли с помощью гибридизационного анализа по Саузерну. Дорожка G = Guy11; Дорожка g = Δ gph2 ; дорожка 2 = эктопический трансформант 2; Дорожки 6, 7, 10 = предполагаемые двойные мутанты Δ agl1 Δ gph2 . Блот исследовали с удаленной областью AGL1 . Д . Была выделена общая РНК и синтезирована кДНК. 5'-кодирующая область AGL1 (789 п.н.) амплифицировали в неколичественной реакции ОТ-ПЦР.Все три анализа подтвердили успешное разрушение гена AGL1 в фоновом мутанте Δ gph2 . Трансформант 6 (AG-6) был выбран для дальнейшего фенотипического анализа и в дальнейшем обозначен как Δ agl1 Δ gph2 . L = 1 т.п.н. плюс ДНК-лестница, G = Guy11 (дикий тип), g = Δ gph2 , a = Δ agl1 , гДНК = геномная ДНК Guy11.

(PDF)

Рисунок S5

Комплементация Δ agl1 и Δ gph2 мутантов M.oryzae восстанавливает рост на крахмале. Полноразмерные гены AGL1 и GPh2 под контролем их нативных промоторов трансформировали в мутанты Δ gph2 и Δ gph2 соответственно и отобрали трансформанты. Анализы на планшете проводили на минимальной среде с крахмалом в качестве единственного источника углерода. Повторное введение каждого гена восстановило их способность расти на крахмале.

(PDF)

Рисунок S6

Аминокислотное выравнивание предсказанных M.oryzae Gsn1 с описанными гликогенсинтазами. Предсказанная аминокислотная последовательность M. oryzae GSN1 (MGG_07829.6) была сопоставлена ​​с продуктами транслирования Homo sapiensf , Gys1 & Gys2 и Saccharomyces cerevisiae , Gsy1 (YFR015C) и Gsy2 (YLR258W). Последовательности были идентифицированы из базы данных NCBI и SGD (http://www.yeastgenome.org/), выровнены с использованием ClustalW (Thompson et al. , 1994) и закрашены с помощью GeneDoc Version 2.6.002. Остатки в черном цвете идентичны для всех перечисленных белков, консервативные изменения показаны серым, а те, что на белом фоне, не показывают никакого сходства.Консервативные предполагаемые остатки серина или треонина, которые являются кандидатами на посттрансляционное фосфорилирование, показаны синим цветом.

(DOC)

Рисунок S7

Целенаправленная делеция гена GSN1 в M. oryzae Guy11. А . Схематическое изображение локуса GSN1 . В . ДНК выделяли, расщепляли Stu I и фракционировали в 0,8% агарозном геле. Гель обрабатывали методом саузерн-блоттинга и зондировали с помощью 2.Фрагмент 35 т.п.н. кодирующей области GSN1 , чтобы показать присутствие или отсутствие кодирующей области. Фрагмент 0,96 т.п.н. верхней фланкирующей области также использовали в качестве зонда для демонстрации полиморфизма длины рестрикционного фрагмента, показанного на нижней панели. Трансформанты G3, G10, G12 и G13 являются предполагаемыми мутантами Δ gsn1 . L = 1 т.п.н. плюс ДНК-лестница (Invitrogen). G2 и G4 = эктопические трансформанты.

(PDF)

Рисунок S8

Целенаправленная делеция гена NMR3 в мутанте M. Δ agl1 Δ gph2 .oryzae . А . Организация локуса NMR3 для демонстрации сайтов рестрикции Pst I и схематическое изображение, показывающее механизм делеции гена NMR3 с использованием стратегии расщепления маркеров. ДНК выделяли из трансформантов Δ agl1 Δ gph2 и предполагаемых Δ agl1 Δ gph2 Δ nmr3 и расщепляли Pst I. Расщепленную ДНК фракционировали в 0,8% агарозном геле и переносили в Hybond. -N. В . Мембрану зондировали 5'-фланкирующим фрагментом ДНК размером 1 т.п.н. для подтверждения мутантов Δ agl1 Δ gph2 Δ nmr3 на основе полиморфизма длины рестрикционного фрагмента. Трансформант 10 был выбран для дальнейшего фенотипического анализа и в дальнейшем назван Δ agl1 Δ gph2 Δ nmr3 . WT = Guy11, 1–11 = предполагаемый Δ agl1 Δ gph2 Δ nmr3 трансформантов и AG6 = Δ agl1 Δ gph2 .

(PDF)

Таблица S1

Олигонуклеотидные праймеры, использованные в этом исследовании.

(DOCX)

Резервный пищевой материал грибов представляет собой крахмал b Биология белка класса 11 CBSE

Совет: Резервный пищевой материал - это резерв жиров, углеводов или, в редких случаях, белков в клетках и тканях, которые функционируют как важные запасы энергии которые могут высвобождаться и использоваться для производства АТФ, когда это необходимо организму. Резервный пищевой материал у грибов такой же, как и у людей.

Полный ответ:
Запасные пищевые материалы могут быть жирами или сложными углеводами, такими как крахмал. У грибов резервным пищевым материалом является многоразветвленный полисахарид, называемый гликогеном.

Дополнительная информация:
-Гликоген - это нерастворимый полисахарид с эмпирической формулой $ ({C} _ {6} {H} _ {10} {O} _ {5}) _ {n} $.
-Гликоген представляет собой разветвленный полимер, образованный линейными цепями молекул глюкозы. У них средняя длина цепи около 8–12 единиц глюкозы.
-Каждая единица глюкозы связана с другой единицей линейно гликозидными связями $ \ alpha ({1 \ rightarrow} {4)} $ от одной молекулы к другой. Разветвления связаны с линейными гликозидными связями $ \ alpha ({1 \ rightarrow} {6)} $ между первой глюкозой разветвления и молекулой глюкозы в основной цепи.
-Гликоген дает красноватую окраску при добавлении раствора йода.
- Обильно присутствует в мышцах и печени животных в качестве резервного пищевого материала. Его также называют животным крахмалом из-за его функции, аналогичной крахмалу в растениях.
-Гликоген также содержится в некоторых сине-зеленых водорослях, слизистой плесени, бактериях, а также в грибах и действует как резервный корм.
- В конечном итоге под действием ферментов он расщепляется на глюкозу, а затем ассимилируется.
-Таким образом, гликоген действует как резервный запас пищи, который можно расщепить на глюкозу и использовать для производства энергии, и это основная форма хранения у животных и грибов.

Итак, ответ: «Гликоген».

Примечание: У людей этот гликоген накапливается в печени и расщепляется до глюкозы всякий раз, когда требуется энергия, с помощью процесса, известного как гликогенолиз.
Другой полимер глюкозы, называемый крахмалом, является основным резервным пищевым материалом растений.
Он имеет ту же эмпирическую формулу $ ({C} _ {6} {H} _ {10} {O} _ {5}) _ {n} $, что и гликоген, но это линейный полисахарид. Он состоит из двух разных цепей, амилозы и амилопектина.

грибов | PMG Biology

В спецификации есть раздел «Разнообразие живых организмов». В этом разделе кандидатов просят узнать об особенностях Пяти царств живых существ, и приводятся некоторые примеры.Эта модель группировки организмов утверждает, что все живые существа можно отнести к одной из этих пяти групп:

  • Бактерии (Monera)
  • Животные
  • Растения
  • Грибы
  • Протоктисты (Протиста)

Вызывает разочарование то, что вирусы добавлены в этот раздел программы в качестве шестой группы. Вирусы не классифицируются как царство живых существ, поскольку они не состоят из клеток и не имеют метаболизма.

Бактерии

Бактерии - это небольшие одноклеточные организмы, которые состоят из клеток принципиально другого типа по сравнению со всеми другими Царствами.Бактериальные клетки описываются как прокариотические : они меньше, чем другие клетки, не имеют ядра, и мембраносвязанных органелл (таких как митохондрии или хлоропласты). Клетки бактерий имеют клеточную стенку, содержащую клеточную мембрану, но их клеточная стенка не содержит целлюлозы. Вместо этого стенка бактериальной клетки состоит в основном из молекулы под названием протеогликан. молекула встречается только в бактериальных клетках.

Бактериальные клетки содержат ДНК (все живые существа используют эту молекулу в качестве своего генетического материала), но основная идея состоит в том, что бактериальная ДНК не содержится внутри ядра.Бактериальная ДНК имеет форму единого кольцевого кольца , которое просто плавает в цитоплазме клетки. Это кольцевое кольцо ДНК иногда называют бактериальной хромосомой (но мне не нравится этот термин, поскольку молекула ДНК в бактериях не обернута вокруг белкового каркаса, как в клетках эукариот). Некоторые бактерии содержат небольшие дополнительные кольца ДНК, которые называются плазмидами . Эти плазмиды могут переноситься из одной бактериальной клетки в другую, а также могут использоваться в качестве вектора в генной инженерии.

Примерами бактерий, упомянутых в описании, являются Lactobacillus bulgaris , палочковидная бактерия, используемая при производстве йогурта, и Pneumococcus , сферическая бактерия, которая является патогеном, вызывающим инфекционную пневмонию.

Помните, что некоторые бактерии автотрофны и могут осуществлять фотосинтез, но большинство из них питаются, поглощая материал через свои клеточные стенки.

Животные

Животные по определению являются многоклеточными организмами.Клетки животных не имеют клеточной стенки и не содержат хлоропластов, поэтому не могут фотосинтезировать. Животные часто могут перемещаться с места на место и имеют нервную систему. Клетки животных могут накапливать углеводы в клетках печени и мышц в форме запасного полисахарида, называемого гликогеном.

Примерами животных, упомянутых в описании, являются люди, комнатные мухи и комары.

Растения

В царстве растений также есть многоклеточные организмы.В отличие от животных, клетки растений фотосинтезируют и содержат хлоропласты. Растительные клетки имеют клеточную стенку из полисахарида , целлюлозы . Углеводы хранятся в клетках растений в виде крахмала и транспортируются во флоэме в виде сахара, называемого сахарозой.

Примерами растений, упомянутых в описании, являются кукуруза, горох и клевер. Кукуруза - это цветущее растение, опыляемое ветром, а горох и клевер интересны тем, что являются зернобобовыми и растениями.Если вы помните свою работу над азотным циклом с лета E, вы будете знать, что бобовые растения содержат корневые клубеньки, содержащие азотфиксирующие бактерии.

Грибы

Грибы - это группа организмов, в которую входят плесень, грибы, поганки и дрожжи. Они состоят из клеток с клеточной стенкой из , хитина и ядром. Грибы не фотосинтезируют и не содержат хлоропластов. Они питаются, выделяя пищеварительные ферменты на пищевой материал, в котором они живут, а затем поглощают продукты пищеварения: процесс, называемый сапротрофным питанием .Грибы хранят углеводы в виде гликогена.

Многоклеточные грибы, такие как Mucor , часто образуют мицелий, сеть нитевидных структур, называемых гифами. Каждая гифа представляет собой структуру, содержащую множество ядер. Некоторые грибы, такие как дрожжи, используемые в пивоваренной и хлебопекарной промышленности, являются одноклеточными.

Протоктисты

Это наименее интересное из 5 царств (что о чем-то говорит… .

Author: alexxlab

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *