Запасающую функцию в зерновках выполняет ткань: Запасающую функцию в зерновках выполняет ткань:                                              

Содержание

Тема №12322 Ответы к тесту по биологии 10-11 класс 3 типа заданий

Тема №12322

1. Запасающую функцию в зерновках выполняет ткань:
а) покровная; в) основная;
б) проводящая; г) образовательная.
2. Основная функция палисадной ткани листа — осуществление:
 а) газообмена; в) фотосинтеза;
 б) транспирации; г) накопления воды.
3. На рисунке изображен проводящий пучок:
а) колатеральный;
б) радиальный;
в) концентрический;
г) биколатеральный.
4. Крахмал в растительной клетке откладывается:
а) в вакуоли; в) в лейкопластах;
б) в хромопластах; г) на внутренней стороне оболочки.
5. При формировании нового органа (побега, корня) первой появляется
 образовательная ткань:
 а) верхушечная; в) боковая;
 б) вставочная; г) раневая.
6. Цветковые растения в отличие от голосеменных:
а) имеют корень, стебель, листья;
б) имеют цветок и образуют плоды;
в) размножаются семенами;
г) размножаются только вегетативным путем.
7. Сред злаков преобладают растения:

а) травянистые; в) кустарники;
б) лианы; г) деревянистые.
8. Первым при прорастании семени редиса появляется (-ются):
 а) главный корень; в) главный и боковые корни;
б) боковые корни; г) придаточные корни.
9. Вторичное утолщение стебля типично для:
а) мхов, голосеменных, покрытосеменных;
б) однодольных покрытосеменных, голосеменных;
в) однодольных и двудольных покрытосеменных;
г) голосеменных и двудольных покрытосеменных.
10. Наиболее крупная систематическая категория, в которую объединяют растения:
а) вид; в) царство;
б) класс; г) отдел.
11. Кочан, который образуется у большинства форм и сортов культурной капусты,
представляет собой пример метаморфоза:
а) корня; в) листьев;
б) стебля; г) почки.
12. Верхний плод, образованный завязью пестика и другими частями
цветка, встречается у:
а) яблони и груши; в) шиповника и граната;
 б)шиповника и земляники; г) кактуса и крыжовника.
13. Муха цеце является переносчиком трипаноза, вызывающего у человека:
а) сонную болезнь; в) малярию;
б) восточную язву; г) кокцидиоз.
14. Регенерация у полипов происходит благодаря делению:
а) кожно-мускульных клеток;
б) нервных клеток;
в) промежуточных клеток;
г) мезоглеи.
15. У свободноживущих плоских червей (Тиrbellariа) пищеварительная система:
а) замкнутая в виде полости;
б) сквозная в виде трубчатой кишки;
в)замкнутая в виде разветвленной кишки;
 г) отсутствует.
16. Ротовой аппарат, изображенный на рисунке,
 характерен для:
а) шмеля;
б) таракана;
в) комара звонца;
г) комнатной мухи.
17. Органами передвижения у многощетинковых червей
(класс Рolichaeta) являются:
а) параподии;
б) сложные членистые конечности;
в) амбулакральные ножки;
г) мускулистые щупальца.
18. Кровеносная система у нематод:
а) замкнутая;
б) частично замкнутая;
в) незамкнутая;
г) отсутствует.
19. Органами зрения у пауков являются:
а) 1 пара фасеточных глаз;
б) 4 пары простых глаз;
в) 1 пара фасеточных и 2 пары простых глаз;
г) 1 пара фасеточных и 3 пары простых глаз.
20. Череп, изображенный на рисунке,
 принадлежит:
а) черепахе;
б) ящерице;
в) змее;
г) крокодилу.
21. Среди куриных птиц (Сalliformes) к перелетным относится:
а) белая куропатка; в) фазан;
б) перепел; г) рябчик.
22. Интегративным центром терморегуляции организма млекопитающего является:
а) таламус; в) гипофиз;
б) гипоталамус; г) эпифиз.
23. Слюнные железы, постоянно вырабатывающие секрет:
а) околоушные и подчелюстные:
б) подчелюстные и подъязычные;
в) подъязычные и мелкие;
г) мелкие и околоушные.
24. Фибриноген крови превращается в фибрин во время:
а) транспорта газов;
б) превращения глюкозы в гликоген;
в) превращения гликогена в глюкозу;
г) формирования кровяного сгустка.
25. Нобелевская премия по физиологии была присуждена в 1904 г. И.П. Павлову за
исследования в области:
а) физиологии пищеварения;
б) физиологии высшей нервной деятельности;
в) физиологии сердечно-сосудистой системы;
г) физиологии зрения.
26. Первые рефлекторные реакции у человека наблюдаются в:
а) первом триместре беременности;
б) втором триместре беременности;
в) третьем триместре беременности;
г) только после рождения.
27. Концентрация ионов Си2+
у человека ниже всего в:
а) эндоплазматической сети;
б) цитозоле;
в) митохондриях;
г) крови.
28. Ядро блуждающего нерва находится в:
а) продолговатом мозге;
б) коре мозжечка;
в) промежуточном мозге;
г) подкорке больших полушарий.
29. Часть пищеварительной системы, которая НЕ входит в состав тонкого кишечника:
а) двенадцатиперстная кишка;
б) подвздошная кишка;
в) слепая кишка;
г) тощая кишка.
30. Недостаток солей кальция в организме человека в первую очередь отразиться на:
а) проведении нервных импульсов;
б) свертывании крови;
в) росте;
г) пищеварении.
31. Лимфа по лимфатическим сосудам проводится от тканей и органов
непосредственно в:
а) венозное русло большого круга кровообращения;
б) артериальное русло большого круга кровообращения;
в) венозное русло малого круга кровообращения;
г) артериальное русло малого круга кровообращения.
32. Из перечисленных животных наименьшее количество пищи, по сравнению с
собственным весом, требуется:
а) пестрому дятлу; в) льву;
б) колибри; г) зайцу-русаку.
33. Пищевая цепь, состоящая из следующих компонентов: планктон – треска – нерпа – белый
медведь, называется:
а) планктонной; в) пастбищной;
б) океанической; г) аккумулирующей.
34. В основе самого распространённого типа связей между особями разных видов
лежат отношения, связанные с:
а)защитой потомства; в) потреблением пищи;
б) расселением; г) территорией.
35. Из названных одноклеточных организмов к надцарству эукариот не относится:
а) радиолярия; в) инфузория туфелька;
б) хлорелла; г) сенная палочка.
36. Первые наземные растения появились в:
а) протерозойской эре; в) палеозойской эре;
б) мезозойской эре; г) кайнозойской эре.
37. Для гипотетического «недостающего звена» между обезьянами и человеком,
немецкий биолог Эрнст Геккель предложил название:
а) парантроп;
б) питекантроп;
в) плезиантроп;
г) эоантроп.
38. Половой процесс у водорослей, характеризующийся слиянием двух
неспециализированных клеток, называется:
а) изогамией;
б) оогамией;
в) гетерогамией;
г) конъюгацией.
39. Выдающийся русский биолог Карл Максимович Бэр является автором:
а) закона зародышевого сходства;
б) закона независимого наследования признаков;
в) закона гомологических рядов;
г) биогенетического закона.
40. Стабилизирующим фактором эволюции является:
а) естественный отбор;
б) изоляция;
в) популяционные волны;
г) борьба за существование.
41. Редукция свободных конечностей у некоторых видов ящериц семейства
Веретениц (Аgцidае) является примером:
а) идиоадаптации;
б) дегенерации;
в) конвергенции;
г) специализации.
42. Контуры тела летяги, сумчатой летяги, шерстокрыла очень сходны.
Это является следствием:
а) дивергенции;
б) конвергенции;
в) параллелизма;
г) случайного совпадения.
43. Из Центральноамериканского центра происхождения культурных растений
(по Н.И. Вавилову) происходит:
а) мягкая пшеница;
б) сорго;
в) рис;
г) кукуруза.
44. В единую мембранную систему клетки входят:
а) митохондрии, эндоплазматическая сеть, лизосомы;
б) митохондрии, хлоропласты, хромопласты;
в) эндоплазматическая сеть, аппарат Гольджи, лизосомы;
г) цитоплазматическая мембрана, эндоплазматическая сеть, лизосомы.
45. Хроматофорами называют пластиды, содержащиеся в клетках:
а) грибов; в) водорослей;
б) мхов; г) растений.
Задание 2. Задание включает 20 вопросов, с несколькими вариантами ответа (от 0-я до 5-ти).
1. Признаки, характерные для семейства пасленовых:
а) листья простые без прилистников;
б) травянистые растения, полукустарники, а в тропиках кустарники и деревья;
в) плод ягода или коробочка;
г) соцветие кисть, двойной завиток;
д) формула цветка *Ч(5)Л5Т(5)П2).
2. Реактивный тип движения встречается среди представителей:
а) кишечнополостных;
б) двустворчатых моллюсков;
в) головоногих моллюсков;
г) иглокожих;
д) насекомых.
3. К характерным признакам кишечнополостных можно отнести:
а) радиальную симметрию;
б) трехслойное»;
в) наличие гастральной полости;
г) ганглинозный тип нервной системы;
 д) гермафродитизм.
4. Вторичное костное небо есть у:
а) гаттерии;
б) ящериц;
в) черепах;
г) змей;
д) крокодилов.
5. Два круга кровообращения имеют:
а) хрящевые рыбы;
б) лучеперые рыбы;
в) двоякодышащие рыбы;
г) земноводные;
д) пресмыкающиеся.
6. Ежегодно сбрасывают рога:
а) северный олень;
б) кабарга;
в) сайгак;
г) косуля;
д) вилорогая антилопа.
7. У зайца-беляка имеются следующие функциональные группы зубов:
а) резцы;
б) клыки;
в) предкоренные;
г) коренные;
д) глоточные.
8. Из перечисленных клеток, в процессах фагоцитоза участвуют:
а) нейтрофилы;
б) моноциты;
в) базофилы;
г) гепатоциты;
д) тромбоциты.
9. К безусловным защитным рефлексам относятся:
а) кашель;
б) глазной нистагм;
в) рвота;
г) чихание;
д) глотание.
10. К возбудимым относятся ткани:
а) хрящевая;
б) костная;
в) мышечная;
г) нервная;
д) жировая.
11. К функциям клеток нейроглии относятся:
а) образование миелина;
б) генерация нервного импульса;
в) обеспечение защиты нейронов;
г) участие в питании нейронов;
д) синтез медиаторов.
12. К факторам свертывания крови относятся:
а) фимбрин;
б) протромбин;
в) фибриноген;
г) гемоглобин;
 д) Са2+
.
13. Из ниже перечисленных витаминов к водорастворимым относят:
а) А;
 б) В2;
в) С;
г) Д;
д) Е.
14. Общими, для грибов и растений, являются следующие признаки:
а) гетеротрофность;
б) наличие хорошо выраженной клеточной стенки, включающей хитин;
в) наличие хлоропластов;
г) накапливание гликогена, как запасного вещества;
д) способность к размножению спорами.
15. Из названных водных животных по способу питания является фильтратором:
а) актиния;
б) губка-бадяга;
в) тридакна;
г) дафния;
д) морской еж.
16. На число и разнообразие видов, появляющихся на определенной территории, влияют:
а) географические барьеры;
б) расстояние на которое осуществляется расселение;
в) воздушные и водные течения;
г) размеры и характер заселяемой территории;
д) антропогенные факторы.
17. Ксилофагами являются личинки жуков из следующих семейств:
 а) усачей;
 б) златок;
 в) короедов;
 г) чернотелок;
 д) карапузиков.
18. Яркая черно-желтая полосатая окраска является предупреждающей у:
 а) тигра;
 б) колорадского жука;
 в) суматранского барбуса;
 г) шершня;
 д) мухи журчалки.
19. В Каменноугольном периоде появились насекомые из отряда:
а) перепончатокрылых;
б) чешуекрылых;
в) стрекоз;
г) двукрылых;
д) поденок.
20. В клетках эукариот ДНК находится в:
а) ядре;
б) нуклеосомах;
в) митохондриях;
г) пластидах;
д) пероксисомах.
Задание 3. Задание на определение правильности суждений. Поставьте знак «+» рядом с
номерами правильных суждений. (20 суждений)
1. Моховидные являются тупиковой ветвью эволюции.
2. Кора имеется только у древесных растений.
3. У однодольных растений между древесиной и лубом находится камбий.
4. Основная причина листопада в Московской области — понижение температуры и влажности
окружающей среды.
5. Для всех жгутиконосцев характерно наличие зеленого пигмента — хлорофилла.
6. Паренхима у плоских червей выполняет опорную функцию.
7. Нематоды лишены способности к регенерации.
8. Все двустворчатые моллюски, в отличие от брюхоногих и головоногих, лишены возможности
видеть, так как у них нет глаз.
9. У домашних животных головной мозг, как правило, больше, чем у их диких предков.
10. К группе кожных желез млекопитающих относятся потовые, сальные и молочные.
11. Особенности строения кожных покровов позволяют китообразным жить только в соленой воде.
12. Для всех осетровых рыб характерны нерестовые миграции.
13. Головной мозг человека формируется пятью долями.
14. Сыворотка — плазма крови, не содержащая фибриногена.
15. Ионы Са2+
оказывают на сердце усиливающее (симпатикотропное) действие.
16. Во время отдыха количество сахара в крови уменьшается.
17. Крахмал и целлюлоза различаются по своему химическому составу.
18. Гаплоидные клетки не могут делиться митозом.
19. Растения и животные способны обогащать воздух кислородом.
20. Млекопитающие появились после вымирания динозавров. 

Первый этап Всероссийской олимпиады школьников по биологии 2017-2018 учебной год Георгиевский городской округ г. Георгиевск 8 класс Дорогой друг

Первый этап Всероссийской олимпиады школьников по биологии

2017-2018 учебной год

Георгиевский городской округ

г. Георгиевск
8 класс
Дорогой друг!

Поздравляем Вас с участием в первом (школьном) этапе Всероссийской олимпиады школьников по биологии! Отвечая на вопросы и выполняя задания, не спешите, так как ответы требуют применения не только знаний, но и общей эрудиции, логики и творческого подхода. Успеха в работе!
Задание 1 Вам предлагаются тестовые задания, требующие выбора только одного ответа из четырех возможных. Максимальное количество баллов, которое можно набрать – 20 (по 1 баллу за каждое тестовое задание).


  1. Обязательным условием жизни всех грибов является:

а) достаточная освещенность;

б) наличие органических веществ, необходимых для их питания;

в) совместное обитание с растениями;

г) возможность формирования плодового тела, необходимого для размножения.



  1. Среди растений исключительно на суше встречаются:


а) зеленые водоросли;

б) красные водоросли;

в) голосеменные;

г) покрытосеменные



  1. Заросток папоротника имеет вид:

а) комочка;

б) сердцевидной пластинки;

в) нити;

г) улиткообразно закрученного листа.



  1. Запасающую функцию в зерновках выполняет ткань:

а) покровная;

б) проводящая;

в) основная;

г) образовательная.



  1. Орех — это плод:

а) сухой, односемянный, с кожистым околоплодником, не срастающимся с семенной кожурой;

б) сухой, односемянный, с кожистым околоплодником, срастающимся с семенной кожурой;

в) сухой, односемянный, с деревянистым околоплодником;

г) сухой, односемянный, с пленчатым околоплодником, срастающимся с семенной кожурой.



  1. Основная функция палисадной ткани листа — осуществление:

а) газообмена; б) транспирации; в) фотосинтеза; г) накопления воды.

  1. Крахмал в растительной клетке откладывается:

а) в вакуоли;

б) в хромопластах;

в) в лейкопластах;

г) на внутренней стороне оболочки.



  1. Среди злаков преобладают растения:

а)травянистые; в) кустарники;

б)лианы; г) деревянистые.



  1. Первым при прорастании семени редиса появляется (ются):

а)главный корень; в) главный и боковые корни;

б)боковые корни; г) придаточные корни.



  1. Вторичное утолщение стебля типично для:

а) мхов, голосеменных, покрытосеменных;

б) однодольных покрытосеменных, голосеменных;

в) однодольных и двудольных покрытосеменных;

г) голосеменных и двудольных покрытосеменных.



  1. Размножение инфузории туфельки может происходить в результате:

а) только простого деления;

б) только конъюгации;

в) деления и конъюгации;

г) копуляции, сопровождающейся слиянием гамет.



  1. Муха цеце является переносчиком трипаносом, вызывающих у человека:

а) сонную болезнь; в) малярию;

б) восточную язву; г) кокцидиоз.



  1. У свободноживущих плоских червей (Turbellaria) пищеварительная система:

а) замкнутая в виде полости;

б) сквозная в виде трубчатой кишки;

в) замкнутая в виде разветвленной кишки;

г) отсутствует.



  1. Органами передвижения у многощетинковых червей (класс Polychaeta) являются:

а) параподии;

б) сложные членистые конечности;

в) амбулакральные ножки;

г) мускулистые щупальца.



  1. У аскариды:

а) нет полости тела;

б) полость тела заполнена жидкостью;

в) полость тела заполнена паренхимой;

г) полость тела представлена клетками эндодермы.



  1. Кровеносная система у нематод:

а) замкнутая; в) незамкнутая;

б) частично замкнутая; г) отсутствует.



  1. Органами зрения у пауков являются:

а) 1 пара фасеточных глаз;

б) 4 пары простых глаз;

в) 1 пара фасеточных и 2 пары простых глаз;

г) 1 пара фасеточных и 3 пары простых глаз.



  1. Череп, изображенный на рисунке, принадлежит:

а) черепахе;

б) ящерице;

в) змее;

г) крокодилу



  1. Среди куриных птиц (Galliformes) к перелетным относится:

а)белая куропатка; в) фазан;

б)перепел; г) рябчик.



  1. Бивни слона — это:

а) видоизмененные резцы;

б) видоизмененные клыки;

в) видоизмененные коренные зубы;

г) совершенно особое образование, не имеющее отношения к зубной системе.


Задание 2 Задание включает 5 вопросов, с одним вариантом ответа, но требующих предварительного множественного выбора. (10 баллов, по 2 балла за каждое задание).

  1. Лишайники:

1) могут поселяться на голых скалах и способны поглощать влагу всей поверхностью тела;

2) могут восстанавливаться из части слоевища;

3) имеют стебель с листьями;

4) с помощью придаточных нитевидных корней удерживаются на скалах;

5) представляют собой симбиотический организм.

А) 1, 2, 3, 4, 5

Б) 1, 2, 4

В) 1, 2, 4, 5

Г) 1, 2, 5


  1. Частью зародыша семени гороха не является:

1) кожура;

2) семядоли;

3) эндосперм;

4) зародышевый корешок;

5) зародышевый стебелек с почечкой.

А) 1, 2, 4

Б) 1, 3

В) 3, 4, 5

Г) 1, 3, 5


  1. Корень не способен выполнять функцию:

1) размножения;

2) запасающую;

3) фотосинтеза;

4) проведения;

5) образования листьев.

А) 1, 3, 5

Б) 3, 5

В) 1, 4


Г) 2, 3

  1. Реактивный тип движения встречается среди представителей:

1) кишечнополостных;

2) двустворчатых моллюсков;

3) головоногих моллюсков;

4) иглокожих;

5) насекомых.

А) 1, 2, 3, 5

Б) 1, 3

В) 1, 2


Г) 1, 2, 3, 4, 5

  1. К характерным признакам кишечнополостных можно отнести:

1) радиальную симметрию;

2) трехслойность;

3) наличие гастральной полости;

4) ганглинозный тип нервной системы;

5) гермафродитизм.

А) 1, 2, 3, 5

Б) 1, 2, 3

В) 1,3


Г) 1, 3, 4, 5
Задание 3 Вам предлагаются тестовые задания в виде суждений, с каждым из которых следует либо согласиться, либо отклонить (10 баллов, по 1 баллу за каждое задание).

  1. Моховидные являются тупиковой ветвью эволюции.

  2. Основные запасы воды в клетках растений находятся в пластидах.

  3. У однодольных растений между древесиной и лубом находится камбий.

  4. Для коры корня характерно отсутствие проводящих тканей.

  5. Для всех жгутиконосцев характерно наличие зеленого пигмента — хлорофилла.

  6. Паренхима у плоских червей выполняет опорную функцию.

  7. Нематоды лишены способности к регенерации.

  8. Все двустворчатые моллюски, в отличие от брюхоногих и головоногих, лишены возможности видеть, так как у них нет глаз.

  9. Самой крупной хищной рыбой является китовая акула.

  10. К группе кожных желез млекопитающих относятся потовые, сальные и молочные.

1

2

3

4

5

6

7

8

9

10

ДА

НЕТ

Задание 4
4.1 Ниже перечислено семь одомашненных животных. Найдите каждому домашнему виду его наиболее близкого дикого родственника (только одного) из приведенного списка. (Список диких видов избыточен). (3,5 балла)


Одомашненные виды

Дикие родственники

А. Свинья

1. Кулан

8. Волк

15. Язь

Б. Лошадь

2. Горал

9. Зубр

16. Лещ

В. Корова

3. Койот

10. Дикий кабан

17. Карась

Г. Собака

4. Шакал

11. Енотовидная собака

18. Сазан

Д. Овца

5. Пекари

12. Муфлон

Е. Золотая рыбка

6. Зебра

13. Лошадь Пржевальского

Ж. Карп

7. Архар

14. Як

4.2 Какие части (органы) использует человек в пищу у следующих растений: 1. ананаса 2. картофеля 3. моркови 4. подсолнечника 5. спаржи 6. земляники 7. можжевельника 8. свеклы 9. сосны сибирской 10. шелковицы, капусты: 11. цветной 12. брюссельской 13. кольраби (6,5 баллов)




Растение

Части (органы), используемые в пищу

ананас

картофель

морковь

подсолнечник

спаржа

земляника

можжевельник

свекла

сосна сибирская

шелковица

цветная капуста

брюссельская капуста

капуста кольраби

ИТОГО в 8 классе:


часть 1

часть 2

часть 3

часть 4

Σ

20

10

10

10

50

Достарыңызбен бөлісу:

Строение семян

семя это орган размножения семенных растений возникают семя у покрытосеменных из семи зачатка который находится в завязи пестика в первую очередь семя отвечают за размножение из-за расселение растений внутри семени находится несколько основных элементов это в зародыш основной и самый главный элемент семени это какие-то запасающих ткани которые будут давать энергию и зародыши для развития и это семенная кожура зародыш зародыш от основной самый главный элемент семенем он состоит из корешка стебелька и почечки с листочками плюс в зародыше есть еще и семядоли семядоли это элемент зародыша это первые зародышевые листочки которые самыми первыми появятся из земли у двудольных семядолей 2у однодольных семядолей 1 поэтому они и получили свое название у покрытосеменных только два варианта количество семядолей 1 или 2 голосеменных семядолей может быть намного намного больше основные функции семядоли это запас питательных веществ как у бобовых примеру или сложноцветных это защита зародышевой почки это фотосинтез первичный фотосинтез потому что семядоли это первые листочки которые появляются на поверхности и всасывание питательных веществ из эндосперма у многих семян есть запаса ющая ткань которая дает первичный толчок для развития семени для развития зародыша за писающая ткани роль запасающих ткань может играть эндосперм которая развивается из центрального из центральной клетки после слияния и iso сперме роль запасая щитка не может играть перри сперму которая развивается износ мусор и роль запасающих ткани может играть основная ткань семядолей и вот эта функция семенная кожура это неотъемлемый компонент любого семени это обязательно ее составляющая возникает семенная кожура и сын документов синди кожура может быть однослойный может быть многослойной основная ее функции разумеется защитное на земле кожуре как правило можно найти рубчик ручек это след оставшиеся от крепления 7 ножки к семени сколько основных типов семян семена могут быть с эндосперм им как пшеница с перис первым как куколь с эндосперм ом и перри сперму как например перец и без того в другому как 7 и фасоли мы рассмотрим два основных типа семян это семя сенда сперва как у пшеницы и и без того и другого то есть фасоль семя пшеницы перед нами зерновка пшеницы зерновка это уже плод но семенная кожура этого плода настолько плотно срастается сокола плотником что отделить ее невозможно поэтому мы не можем отдельно рассматривать семя пшеницы от зерновки пшеницы перед нами вся зерновка пшеница строение семени пшеницы внутри этой зерновки довольно своеобразно основную массу его занимает эндосперм или питательная ткань зародыша эндосперм образовался в результате слияния второго спермия с центральная клетка он трепло един и выполняет функцию питания зародыша интересно то что зародыш которая находится вот здесь и которое развивается из оплодотворенной яйцеклетки сам соприкасается со дна с первым только одной стороной вот этой стороной вот он это 7 доля у большинства себе зародыш окружен эндосперма а здесь он только соприкасается с ней соприкасается только одним вот этим листочком семядоли он называется своеобразный здесь щиток всасывающая функция у этого щитка обеспечиваются сильно специализированными клетками и в его поверхностном слое в отличие от большинства однодольных почечка зародыша довольно сильно развитый уже имеет несколько листочков вот она почечка почечка с несколькими листочками внутри этой почки скрыт зародышу и стебелек в обратную сторону от стебелька и почечки смотрят зародышевый корешок и функцию взаимодействия зародыша с ндс первом выполняют щиток самый первый листок которое при растет на поверхность из этого семени по границе эндосперма располагается орейро новый слой это слой клеток который содержит большое количество включений полированного зерем то есть белковых включений снаружи это зерновка покрыта семенной кожурой который плотно срастается сокола под ником она мир на верхушке зерновки располагается хохолок и еще раз напоминаю что ни в коем случае не забывайте что зерновка пшеницы это уже плод они просто 7 и другим типа уже семян они плодов является семя бобовых листья на фасоли в данном случае все на фасоли относится к семенам без эндосперма и без перри сперма функцию запасающих ткани выполняет основная ткань семядолей и вот они вот они семядоли семядоли это часть зародыша это это первичные зародышевые листочки те самые которые самые первые вылезут на поверхность если вы когда-либо выращивали семена фасоли то вы должны были заметить что первые листочки лео гороха или фасоли они не похоже на все остальные листья гороха или фасоли потому что это и есть семядоли помимо семядолей внутри семени фасоли выделяются стебелек с почкой с листочками и корешок состав сюда составе семён выделяет неорганические и органические вещества неорганическим веществам относится вода и минеральные вещества семя семени розни поэтому диапазон колебаний разных веществ составе семян довольно широк воды в семенах в среднем 15-20 процентов а минеральных солей совсем мало порядка одного процента среди органических веществ состав семян конечно же входит а стал основные группы это белки жиры углеводы белков особенно много в составе семян бобовых они очень богаты белками в составе семян злаков виталий урановых зерен жиры запасается в семенах и правила форме масел их очень много в семенах подсолнечника или всегда горчицы или в семенах кукурузы доказать наличие жиров всеми не довольно просто достаточно просто его раздавить где-нибудь на кальке и останется мокрый след через какое-то время вода с этого следа испарится но мокрое пятно визуально мокро останется это и будет след жиров потому что жир и не будут испаряться так просто как вода углевода запасается внутри семян и в виде сахара в виде крахмала особенно много крахмала в семенах злаков условия прорастания семян для прорастания любого семени нужно наличие воды и кислорода вода необходима для ускорения обменных процессов в составе семян самих семян воды немного это нужно для того чтобы подольше сохранить 7-я жизнеспособными для того чтобы замедлить метаболические процессы поэтому для прорастания вода нужна помимо воды нужен обязательно кислород семена очень активно дышат поэтому если провести простой опыт и закрыть одну пробирку пустую и одну пробирку с семенами и например оставить их на ночь и на следующий день по моему поместить в каждую из пробирок о спички зажженные получения по горящие обучение то пробирки с семенами лучина потухнет сразу потому что там будет большое скопление углекислого газа и очень мало кислорода поддерживающего горения это доказывает что семена дышат еще одним необходимым условием для прорастания семян является определенная температура причем эта температура очень видоспецифичны около до стойких растений семена могут прорастать уже при температуре + 4 градуса у более теплолюбивых растений семеновой прорастать при 12-15 18 градусов оптимальная средняя температура прорастания около пятнадцати двадцати градусов для холодостойких и около 20 25 для теплолюбивых растений и конечно никакое семя не прорастет даже при соблюдении всех этих условий если внутри не будет живого зародыша [музыка] некоторым семинар для того чтобы успешно прорасти нужно соблюдении некоторых дополнительных процедур например нужно скарификация или стратификация скарификация это механическое повреждение водонепроницаемых покрова всеми не в искусственных условиях при посеве человека нередко приходится семена немножко пошкрябать повредить их покровы это имитирует поедание птицами когда они клювами во время питания на растения во время поедании плодов повреждают семена и тем самым позволяет семенам при попадании в почву уже благополучно прорастать потому что не про водонепроницаемые внешние покровы разрушаются повреждаются и воздух и вода могут проникнуть внутрь другим методом проращивания семян специфическим проращивание является стратификация стратификация той выдерживание семян при низких температурах это нужно тем семена которые обычно перед тем как вновь начать всходить зимуют в почве им нужен вот этот вот вот это понижение и зачем затем начала повышения температуры человек который не может ждать всю зиму этого сигнала какое-то непродолжительное время выдерживает семена в холодной температуре затем и у них естественным образом запускается этот механизм прорастание как будто наступила весна разным семенам требуется разная глубина заделки в почву глубина заделки зависит от размера семени мелкий сильно сделала будет неглубоко примерно на 0 5 1 сантиметр потому что в противном случае энергии для прорастания им не хватит для того чтобы добраться на поверхности почвы слишком мелкие семена слишком мало в них питательных веществ значит мало энергии для прорастания средние семена засевают на глубину 24 сантиметра а крупные можно и поглубже на глубину 46 сантиметров еще раз скажу что все зависит от того сколько питательных веществ находятся внутри сильными внутри семени фасоли питательных веществ побольше а значит от зародышу этого семени будет проще добраться до поверхности у него будет больше энергии для того чтобы это осуществить времени мака питательных веществ совсем мало значит если вы заводите его глубоко энергия для прорастания ему просто не хватит глубина посева зависит также и от плотности почвы от ее состава типа почвы на легких почвах семена можно заделывать глубже потому что сквозь про рыхлую легкую почву зародышу уже не зародышам уже про настоящему растению будет проще добраться до поверхности чем плотнее чем тяжелее почва чем больше в ней глинистых частиц тем ближе к поверхности нужно засевать семена семена некоторых растений вообще просто раскладной по поверхности почвы отношение числа проросших семян к общему количеству семян называется в схожестью предположим что у вас есть 120 семян как узнать сколько из этих ста двадцати семян вас прорастут благополучно для этого нужно взять пробную партию например 27 он и вы сеять их и предположим что из этих 20 семян у вас зайдут только 10 в этом случае всхожесть если из 20 семян зашло только 10 будет пятьдесят процентов это значит что из 100 оставшихся семян у вас зайдут только 50 а значит если вы хотите чтобы вас зашло 100 семян вам нужно высидеть 200 семян

в) ядре; г) клеточном соке. 10. Рассыпчатость спелого яблока объясняется: а) разрушением части клеток; б) появлением в процессе созревания

ЗАДАНИЯ. Дорогие ребята!

ЗАДАНИЯ Дорогие ребята! Поздравляем вас с участием в муниципальном этапе Всероссийской олимпиады школьников по биологии! Отвечая на вопросы и выполняя задания, не спешите, так как ответы не всегда очевидны

Подробнее

2018/2019 учебный год

УТВЕРЖДЕНО Приказ Министра образования Республики Беларусь 03.12.2018 836 Билеты для проведения экзамена в порядке экстерната при освоении содержания образовательной программы базового образования по учебному

Подробнее

Задания С3 по биологии

Задания С по биологии. Какие механизмы обеспечивают работу иммунной системы человека? Элементы ответа ) Узнавание организм узнает чужеродные антигены и их продукты и выделяет антитела ) Специфичность антитела

Подробнее

Задания 4. Царство Растения

Задания 4. Царство Растения 1. Какова главная функция хлорофилла в растениях? 1) выделение углекислого газа 2) поглощение энергии света 3) защита растений от грибковых и вирусных болезней 4) превращение

Подробнее

Задания B4 по биологии

Задания B4 по биологии 1. Установите соответствие между признаками организма, принадлежащего к определённому царству, и царству, представители который обладают данным признаком. А) размножаются спорами

Подробнее

428 ОГЛАВЛЕНИЕ ОГЛАВЛЕНИЕ

428 ОГЛАВЛЕНИЕ ОГЛАВЛЕНИЕ Введение… 3 Глава 1. Основные этапы индивидуального развития человека… 5 Пренатальный онтогенез… 6 Постнатальный онтогенез… 14 Глава 2. Cтроение тела человека… 22 Клетка:

Подробнее

БИОЛОГИЯ Живые организмы

2.2.2.10. БИОЛОГИЯ Живые организмы Биология как наука. Роль биологии в практической деятельности людей. Разнообразие организмов. Отличительные признаки представителей разных царств живой природы. Методы

Подробнее

1. Пояснительная записка:

1. Пояснительная записка: Рабочая программа по биологии разработана в соответствии: С Федеральным государственным образовательным стандартом основного общего образования, утвержденный приказом Министерства

Подробнее

Пояснительная записка

Пояснительная записка Данная рабочая программа учебного предмета «Биология» для обучающихся 6 класса общеобразовательного учреждения разработана на основе авторской программы Н.И. Сонина, В.Б. Захарова

Подробнее

ПЛАНИРУЕМЫЙ РЕЗУЛЬТАТ ОСВОЕНИЯ КУРСА.

ПЛАНИРУЕМЫЙ РЕЗУЛЬТАТ ОСВОЕНИЯ КУРСА. Личностными результатами изучения предмета «Биология» являются: Осознавать единство и целостность окружающего мира, возможности его объяснимости на основе достижений

Подробнее

Банк заданий по биологии 6 класс -2014год

Банк заданий по биологии 6 класс -2014год 1. Ископаемые остатки вымерших организмов изучает наука 1) систематика 2) экология 3) физиология 4) палеонтология 2. Строение и функции органоидов клетки изучает

Подробнее

Ефановой Ирины Николаевны

Муниципальное бюджетное общеобразовательное учреждение «Школа 20» города Сарова Рассмотрена на заседании методического объединения учителей предметов гуманитарного цикла ( протокол от 31.08.2018г 8) Рук.

Подробнее

ГСХА.Е. Красильникова 2017 г.

МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ федеральное государственное бюджетное образовательное учреждение высшего образования «Пермская государственная сельскохозяйственная академия имени

Подробнее

БИОЛОГИЯ (мах 30 баллов)

ГБОУ лицей 1535 2015 год ОБРАЗЕЦ КОНКУРСНОГО ВСТУПИТЕЛЬНОГО ИСПЫТАНИЯ ПО БИОЛОГИИ И ХИМИИ ДЛЯ АБИТУРИЕНТОВ, ПОСТУПАЮЩИХ в 9-й КЛАСС С РАННЕЙ ЕСТЕСТВЕННОНАУЧНОЙ СПЕЦИАЛИЗАЦИЕЙ БИОЛОГИЯ (мах 30 баллов) ЗАДАНИЯ

Подробнее

Планируемые результаты

Планируемые результаты Ученик научится: — характеризовать особенности строения и процессов жизнедеятельности биологических объектов (клеток, организмов), их практическую значимость; — применять методы

Подробнее

6 КЛАСС (68 ч) Введение

БИОЛОГИЯ. «ЖИВОЙ ОРГАНИЗМ». 6 КЛАСС (68 ч) Введение Биология наука о живых организмах. Из истории развития биологии. Современная биология. Важность биологических знаний для развития медицины, сельского

Подробнее

На выполнение работы отводится 120 минут — КиберПедия

ЗАДАНИЯ ДЛЯ ШКОЛЬНОГО ТУРА ОЛИМПИАДЫ ПО БИОЛОГИИ

ДЛЯ УЧАЩИХСЯ 9 КЛАССОВ (максимальное количество баллов – 64)

На выполнение работы отводится 120 минут

Часть I.

Из предложенных вариантов ответов выберите один правильный. Максимальное количество баллов, которое можно набрать-25(по 1 баллу за каждое тестовое задание). Индекс ответа, который вы считаете наиболее полным и правильным, укажите в матрице ответов.

 

1. Самые крупные по размерам представители водорослей встречаются среди:
а) зеленых; б) диатомовых; в) красных; г) бурых.

2. Среди растений, встречаются исключительно на суше:
а) зеленые водоросли; б) красные водоросли; в) голосеменные; г) покрытосеменные.

3. У плаунов ветвление:
а) боковое; б) дихотомическое; в) верхушечное; г) симподиальное.

4. При хранении в теплом помещении картофель быстро сморщивается, так как в нем:
а) происходит фотосинтез; б) накапливается крахмал;
в) интенсивно осуществляется процесс дыхания;
г) в нем образуется ядовитое вещество соланин и гормоны.

5. Половой процесс у водорослей, характеризующийся слиянием двух неспециализированных клеток, называется:
а) изогамией; б) оогамией; в) гетерогамией; г) коньюгацией.

6.

7. Конечная на побеге почка липы является:
а) верхушечной; б) боковой; в) может быть придаточной; г) спящей.

8. Запасающую функцию в зерновках выполняет ткань:
а) покровная; б) проводящая; в) основная; г) образовательная.

9. Вторичное утолщение стебля типично для:
а) мхов, голосеменных, покрытосеменных;
б) однодольных покрытосеменных, голосеменных;
в) однодольных и двудольных покрытосеменных;
г) голосеменных и двудольных покрытосеменных.

10. Верхний плод, образованный завязью пестика и другими частями цветка, встречается у:
а) яблони и груши; б) шиповника и земляники; в) шиповника и граната;
г) кактуса и крыжовника.

11. Муха цеце является переносчиком трипанозом, вызывающих у человека:
а) сонную болезнь; б) восточную язву; в) малярию; г) кокцидиоз.

12. Регенерация у полипов происходит благодаря делению:
а) кожно-мускульных клеток; б) нервных клеток; в) промежуточных клеток;
г) мезоглеи.

13. Кровеносная система у нематод:
а) замкнутая; б) частично замкнутая; в) незамкнутая; г) отсутствует.

14. Органами зрения у пауков являются:
а) 1 пара фасеточных глаз; б) 4 пары простых глаз;
в) 1 пара фасеточных и 2 пары простых глаз;
г) 1 пара фасеточных и 3 пары простых глаз.

15. Череп, изображенный на рисунке, принадлежит:
а) черепахе; б) ящерице; в) змее; г) крокодилу.

16. Слюнные железы, постоянно вырабатывающие секрет:
а) околоушные и подчелюстные:
б) подчелюстные и подъязычные;
в) подъязычные и мелкие;
г) мелкие и околоушные.

17. Фибриноген крови превращается в фибрин во время:
а) транспорта газов; б) превращения глюкозы в гликоген;
в) превращения гликогена в глюкозу; г) формирования кровяного сгустка.

18. Частоту и глубину дыхания в процессе гуморальной регуляции замедляет:
а) недостаток О2; б) недостаток СО2; в) избыток О2; г) избыток СО2.

19. Недостаток солей кальция в организме человека в первую очередь отразиться на:
а) проведении нервных импульсов; б) свертывании крови; в) росте; г) пищеварении.

20. Объем воздуха, который можно вдохнуть после спокойного выдоха называют:
а) резервным объемом вдоха; б) дыхательным объемом; в) резервным объемом выдоха;
г) остаточным объемом.

21. . Оксигемоглобин – это соединение гемоглобина с:

а) диоксидом углерода б) оксидом углерода

в) азотом г) кислородом

22. Выдающийся русский биолог Карл Максимович Бэр является автором:
а) закона зародышевого сходства;
б) закона независимого наследования признаков;
в) закона гомологических рядов;
г) биогенетического закона.

23. Пищевая цепь, состоящая из следующих компонентов: планктон – треска – нерпа – белый медведь, называется:
а) планктонной; б) океанической; в) пастбищной; г) аккумулирующей.

24. Редукция свободных конечностей у некоторых видов ящериц семейства Веретениц (Anguidae) является примером:
а) идиоадаптации; б) дегенерации; в) конвергенции; г) специализации.

25. В единую мембранную систему клетки входят:
а) митохондрии, эндоплазматическая сеть, лизосомы;
б) митохондрии, хлоропласты, хромопласты;
в) эндоплазматическая сеть, аппарат Гольджи, лизосомы;
г) цитоплазматическая мембрана, эндоплазматическая сеть, лизосомы.

26. Многие пресмыкающиеся для повышения температуры тела выбирают каменистые склоны южной экспозиции – это пример:
а) этологической адаптации; б) популяционной адаптации;
в) физиологической адаптации; г) морфологической адаптации.

ЧастьII

Из предложенных вариантов ответов выберите несколько правильных ответов.

Максимальное количество баллов, которое можно набрать-20 (по 2 балла за каждое тестовое задание). Индекс ответа, который вы считаете наиболее полным и правильным, укажите в матрице ответов.

1.К классу двудольных растений относятся семейства:

Злаки 5) паслёновые

Лилейные 6) бобовые

Ответ

а) 1,3,4,6

б) 1,4,5,6

в) 2,4,5,6

г)1,2,3,6

2.К классу Пресмыкающиеся относятся:

Ели 5) кипариса 6) сфагнума

Ответ

а) 1,2,3,6

б) 2,3,4,5

в) 1,3,4,5

г) 2,3,6

5.Отделы тела у животных класса Насекомые:

Ответы

а) 1,3, 5;

б) 1,3, 6;

в) 2, 4, 6;

г) 2, 3, 5.

7. Ткани, относящиеся к соединительной – это:

1) хрящевая 2) костная 3) эпидермис кожи

4) кровь 5) жировая 6) лимфа

Ответы

а) 1, 2, 4, 6;

б) 1, 2, 4, 5, 6;

в) 1, 2, 5;

г) 1,2,3,5,6 .

8.Поджелудочная железа в организме человека:

1) участвует в иммунных реакциях

2) соединена с желудком

3) соединена с тонким кишечником

4) образует гормоны

5) выделяет желчь

6) выделяет пищеварительные ферменты

Ответы

а) 3, 4, 6;

б) 2, 4, 5;

в) 1, 3, 5;

г) 3,5, 6 .

9.Укажите особенности строения птиц:

1) сердце трёхкамерное

2) сердце четырёхкамерное

3) кора головного мозга есть

4) коры головного мозга нет

5) мочевой пузырь имеется

6) мочевой пузырь отсутствует

Ответ

а) 1,3,6

б) 2,4,5

в) 1,3,5

г) 2,3,6

10. Из эктодермы у человека формируются:

1) дерма 2) эпителий кожи 3) дентин зубов

4) нервная система 5) ногти 6) околосердечная сумка

Ответы

а) 1, 2, 5;

б) 1, 2, 5, 6;

в) 2, 4, 5;

г) 1, 2,5, 6.

Часть Ш.

Задание на определение правильности суждений. Следует либо согласиться, либо отклонить суждение. В матрице ответов укажите вариант ответа, «да» или «нет». Максимальное количество баллов, которое можно набрать -15(по1баллу за каждое задание)

1. Шишка – это плод сосны.

2. Из споры папоротника развивается спорофит.

3. У сосны яйцеклетки оплодотворяются спермиями.

4. Ситовидные трубки, проводящие растворы органических веществ, образованы мертвыми клетками.

5. У всех летающих насекомых имеется две пары крыльев.

6. У человека стенки вен рук толще, чем стенки вен ног.

7. Иглокожие относятся к вторичнополостным.

8. У бактерий есть рибосомы.

9. Спиртовое брожение может проходить как в анаэробных, так и в аэробных условиях, хотя и с различной скоростью.

10. Продукты расщепления жиров всасываются непосредственно в кровь.

11. В клетках всех животных и растений вблизи ядра находится органоид, называемый клеточным центром.

12. В клетках прокариот ядерное вещество представлено в виде кольцевой хромосомы.

13. Хромопласты не могут превращаться в хлоропласты.

14. Дыхательный центр расположен в продолговатом мозге.

15. Стенки левого желудочка сердца толще, чем правого, потому что левый желудочек в единицу времени выбрасывает значительно большее количество крови, чем правый

Часть IV .

Тестовые задания, требующее установить соответствие. Максимальное количество баллов, которое можно набрать за каждое задание -3 (по 0,5 балла за каждое правильно установленное соответствие), всего 6. Заполните матрицу ответов в соответствии с требованиями задания.

1. На картинке изображены разные растения, обозначенные буквами от А до З.

2.

 

Какие из них относятся к:

1. споровым растениям  
2. голосеменным растениям  
3. покрытосеменным растениям  
4. однодольным растениям  
5. двудольным растениям  

 

2.Установите соответствие видов тканей с их особенностями

 

Виды тканей Особенности

 

1. эпителиальные А. мало межклеточного вещества  
2. соединительные Б. клетки содержат миофибриллы  
3. мышечная 4. нервная В. много межклеточного вещества Г. обладают свойством возбудимости и сократимости Д. обладают свойством возбудимости Е. образует средний слой сердца  
  Особенности А Б В Г Д Е  
  Вид ткани              
                     

 

ЗАДАНИЯ ДЛЯ ШКОЛЬНОГО ТУРА ОЛИМПИАДЫ ПО БИОЛОГИИ

ДЛЯ УЧАЩИХСЯ 9 КЛАССОВ (максимальное количество баллов – 64)

На выполнение работы отводится 120 минут

Часть I.

Из предложенных вариантов ответов выберите один правильный. Максимальное количество баллов, которое можно набрать-25(по 1 баллу за каждое тестовое задание). Индекс ответа, который вы считаете наиболее полным и правильным, укажите в матрице ответов.

 

1. Самые крупные по размерам представители водорослей встречаются среди:
а) зеленых; б) диатомовых; в) красных; г) бурых.

2. Среди растений, встречаются исключительно на суше:
а) зеленые водоросли; б) красные водоросли; в) голосеменные; г) покрытосеменные.

3. У плаунов ветвление:
а) боковое; б) дихотомическое; в) верхушечное; г) симподиальное.

4. При хранении в теплом помещении картофель быстро сморщивается, так как в нем:
а) происходит фотосинтез; б) накапливается крахмал;
в) интенсивно осуществляется процесс дыхания;
г) в нем образуется ядовитое вещество соланин и гормоны.

5. Половой процесс у водорослей, характеризующийся слиянием двух неспециализированных клеток, называется:
а) изогамией; б) оогамией; в) гетерогамией; г) коньюгацией.

6.

7. Конечная на побеге почка липы является:
а) верхушечной; б) боковой; в) может быть придаточной; г) спящей.

8. Запасающую функцию в зерновках выполняет ткань:
а) покровная; б) проводящая; в) основная; г) образовательная.

9. Вторичное утолщение стебля типично для:
а) мхов, голосеменных, покрытосеменных;
б) однодольных покрытосеменных, голосеменных;
в) однодольных и двудольных покрытосеменных;
г) голосеменных и двудольных покрытосеменных.

10. Верхний плод, образованный завязью пестика и другими частями цветка, встречается у:
а) яблони и груши; б) шиповника и земляники; в) шиповника и граната;
г) кактуса и крыжовника.

11. Муха цеце является переносчиком трипанозом, вызывающих у человека:
а) сонную болезнь; б) восточную язву; в) малярию; г) кокцидиоз.

12. Регенерация у полипов происходит благодаря делению:
а) кожно-мускульных клеток; б) нервных клеток; в) промежуточных клеток;
г) мезоглеи.

13. Кровеносная система у нематод:
а) замкнутая; б) частично замкнутая; в) незамкнутая; г) отсутствует.

14. Органами зрения у пауков являются:
а) 1 пара фасеточных глаз; б) 4 пары простых глаз;
в) 1 пара фасеточных и 2 пары простых глаз;
г) 1 пара фасеточных и 3 пары простых глаз.

15. Череп, изображенный на рисунке, принадлежит:
а) черепахе; б) ящерице; в) змее; г) крокодилу.

16. Слюнные железы, постоянно вырабатывающие секрет:
а) околоушные и подчелюстные:
б) подчелюстные и подъязычные;
в) подъязычные и мелкие;
г) мелкие и околоушные.

17. Фибриноген крови превращается в фибрин во время:
а) транспорта газов; б) превращения глюкозы в гликоген;
в) превращения гликогена в глюкозу; г) формирования кровяного сгустка.

18. Частоту и глубину дыхания в процессе гуморальной регуляции замедляет:
а) недостаток О2; б) недостаток СО2; в) избыток О2; г) избыток СО2.

19. Недостаток солей кальция в организме человека в первую очередь отразиться на:
а) проведении нервных импульсов; б) свертывании крови; в) росте; г) пищеварении.

20. Объем воздуха, который можно вдохнуть после спокойного выдоха называют:
а) резервным объемом вдоха; б) дыхательным объемом; в) резервным объемом выдоха;
г) остаточным объемом.

21. . Оксигемоглобин – это соединение гемоглобина с:

а) диоксидом углерода б) оксидом углерода

в) азотом г) кислородом

22. Выдающийся русский биолог Карл Максимович Бэр является автором:
а) закона зародышевого сходства;
б) закона независимого наследования признаков;
в) закона гомологических рядов;
г) биогенетического закона.

23. Пищевая цепь, состоящая из следующих компонентов: планктон – треска – нерпа – белый медведь, называется:
а) планктонной; б) океанической; в) пастбищной; г) аккумулирующей.

24. Редукция свободных конечностей у некоторых видов ящериц семейства Веретениц (Anguidae) является примером:
а) идиоадаптации; б) дегенерации; в) конвергенции; г) специализации.

25. В единую мембранную систему клетки входят:
а) митохондрии, эндоплазматическая сеть, лизосомы;
б) митохондрии, хлоропласты, хромопласты;
в) эндоплазматическая сеть, аппарат Гольджи, лизосомы;
г) цитоплазматическая мембрана, эндоплазматическая сеть, лизосомы.

26. Многие пресмыкающиеся для повышения температуры тела выбирают каменистые склоны южной экспозиции – это пример:
а) этологической адаптации; б) популяционной адаптации;
в) физиологической адаптации; г) морфологической адаптации.

ЧастьII

Из предложенных вариантов ответов выберите несколько правильных ответов.

Максимальное количество баллов, которое можно набрать-20 (по 2 балла за каждое тестовое задание). Индекс ответа, который вы считаете наиболее полным и правильным, укажите в матрице ответов.

1.К классу двудольных растений относятся семейства:

Что такое злаки? Новости

Что такое злаки? 13.02.2021 10:49

Что такое злаки, знает каждый. Ведь человек начал выращивать эти растения более 10 тысяч лет назад. Поэтому и сейчас такие названия злаков, как пшеница, рожь, ячмень, рис, кукуруза и многие другие, у всех на слуху. По площади посевов они уже давно получили лидирующие место. Из нашей статьи вы узнаете об особенностях строения и хозяйственном значении этих растений.

Класс Однодольные

Семейство Злаки, или Мятликовые, имеет много общих признаков с Лилейными и Луковыми. Дело в том, что все они являются представителями класса Однодольные. По каким признакам можно отличить такие растения? Их зародыш состоит из одной семядоли. Главный корень однодольных отмирает рано. Зато формируются боковые. Они образуют мочковатую корневую систему.

В корне и стебле отсутствует боковая образовательная ткань, которая называется камбий. Поэтому рост этих органов в толщину ограничен. Большинство однодольных – это травянистые растения. Их листья имеют параллельное или сетчатое жилкование.

Биологическая характеристика семейства Злаки

“Визитной карточкой” этих растений является стебель, который называется соломиной. У большинства злаковых в междоузлиях он полый. Только у сахарного тростника и кукурузы заполняется рыхлой соединительной тканью, которая выполняет запасающую функцию. Для соломины характерен вставочный рост.

Как еще можно ответить на вопрос, что такое злаки? В основном это многолетние растения, хотя встречаются среди них исключения. Так, просо и полевичка образуют семена уже на первый год после цветения. Корневая система всех злаков мочковатого типа. Она растет мощным пучком прямо от стебля.

Особое строение имеют и листья. Они простые, сидячие, удлиненные, с параллельным жилкованием. Их длинное трубчатое влагалище охватывает стебель.

Плоды и семена

Цветки злаков очень мелкие. Каждый из них имеет один пестик и три тычинки. Околоцветник простой. Он представлен двумя чешуйками и пленками. У некоторых видов такие структуры едва заметны, поэтому собраны в соцветия. У пшеницы, ржи, пырея и ячменя – это сложный колос. Цветки риса, проса, кукурузы и овса формируются в метелку.

Среди злаков встречаются само – и ветроопыляемые виды. В результате цветения образуется сухой многосемянный плод – зерновка.

Хозяйственный аспект

Большинство видов злаков относится к зерновым культурам. Это пшеница, рожь, овес, рис. Из зерновок получают муку, макаронные и хлебобулочные изделия, используют в качестве корма для животных. Из семян кукурузы получают питательное масло.

Бамбук, который растет в тропических странах, используют как строительный и отделочный материал.

Луговые злаки идут на корм домашним животным, как в свежем, так и сушеном виде. Мощная корневая система обусловливает использование этих растений для закрепления песков и предотвращения осыпания почвы.

Сорные виды злаков

А вот пырей, овсюг и щетинник заслужили совсем другую славу. Это злостные сорняки, избавиться от которых бывает очень сложно. Такие злаковые растения формируют видоизменения побега, которые называются корневища. Они состоят из сильно удлиненных междоузлий. Развиваются такие органы под землей, а снаружи видны только листья. В корневище накапливается вода с раствором минеральных веществ. Поэтому сорные растения выживают в условиях засухи и перепадов температур.

 


Ткани. Взаимосвязь их строения с выполняемой функцией

Стр.97

1. Назовите функцию образовательной ткани, используя рисунок 62 как источник необходимой информации.

Образовательная ткань принимают участие в образовании всех остальных типов тканей и обеспечивают рост растения.

2. Какая особенность данной ткани обеспечивает выполнение ею названной вами функции?

Клетки образовательных тканей (меристем) в течение длительного времени сохраняют способность к делению.

Стр.98

Используя рисунок 63, объясните, как опытным путём можно доказать функцию проводящей ткани. Ответ постройте по принятому нами плану, т. е. указав цель, ход, результаты опыта и сделав вывод из полученных результатов.

Цель: доказать функцию проводящей ткани.

Ход опыта: Поставить побег липы или какого — либо другого древесного растения на 2—4 суток в подкрашенную воду. Рассмотреть поперечный срез.

Результаты: Окрасилась древесина. В этом опыте чернила заменяли минеральные вещества, растворённые в воде. Растворы этих веществ, как и подкрашенная вода, поднимаются от корня вверх внутри стебля по сосудам древесины.

Вывод: Проводящие ткани обеспечивают в организме растения передвижение воды и растворенных в ней веществ.

Объясните, какую роль играет механическая ткань в жизни растений, учитывая, что они осуществляют процесс фотосинтеза, прикрепившись на всю жизнь к месту произрастания. При ответе используйте следующую характеристику механической ткани: образована как живыми, так и мёртвыми клетками; свою функцию выполняет за счёт утолщения оболочек клеток, образующих каркас растения.

За счёт утолщения оболочек клеток, образующих каркас растения механические ткани выполняют опорную и защитную функции, придавая прочность органам и образуя «внутренний скелет» растения.

Механические ткани образованы как живыми, так и мёртвыми клетками, что придает органам растения помимо прочности еще и гибкость (позволяет побегам не ломаться на ветру).

Стр.99

Используя рисунок 65, проведите в домашних условиях простое в исполнении, но весьма наглядное исследование.

1. Убедитесь в наличии запасного питательного вещества крахмала в клубне картофеля и зерновке пшеницы, нанеся на срез клубня и комочек теста раствор йода.

Если капнуть на срез клубня йодом, то он станет сине — фиолетового цвета, т.к. крахмал при взаимодействии с йодом даёт такую реакцию. В картофеле крахмал содержится в больших количествах (это основное запасающее вещество клубней картофеля).

2. Какую роль в жизни растения играет запасающая ткань?

Запасающая ткань выполняет функцию хранения и запаса питательных веществ.

Стр.100

1. Назовите особенности строения эпителиальной ткани, связанные с выполнением ею защитной функции.

Клетки эпителиальной ткани очень плотно прилегают друг к другу, а межклеточное вещество почти отсутствует. Такое строение обеспечивает защиту нижележащих тканей от высыхания, проникновения микробов, механических повреждений.

2. Поясните, какая ткань растительного организма также выполняет защитную функцию. Можно ли найти общие признаки в строении ткани растения и ткани животного, выполняющих сходную защитную функцию?

Защитную функцию у растений выполняет покровная ткань. Аналогично клеткам эпителиальной ткани животных клетки покровной ткани растений плотно прилегают друг другу, а межклеточное вещество почти отсутствует.

Стр.101

1. Приведите доказательства того, что кровь является одним из видов соединительной ткани.

1) Кровь не отвечает непосредственно за работу какого — либо органа.

2) Играет вспомогательную роль во всех органах.

3) Характеризуются хорошо развитым межклеточным веществом (плазма крови), в котором поодиночке или группами располагаются клетки (форменные элементы).

4) Выполняет защитную и трофическую функции.

2. Назовите функции межклеточного вещества и клеток крови.

Межклеточное вещество выполняет механическую, опорную, защитную и трофическую функции, объединяет клетки в ткань.

Все клетки крови, независимо от их специфики, участвуют в транспорте различных веществ, выполняют защитные и регуляторные функции.

РНКи в зерновом долгоносике Sitophilusspp: нокдаун системного гена в ткани бактериома | BMC Biotechnology

Разведение насекомых

Насекомых видов Sitophilus zeamais (штамм Lagoa) выращивали, как описано в [21]. Личинки обычно растут внутри зерна пшеницы до тех пор, пока через месяц после кладки яиц не появятся взрослые особи, при температуре 27,5 ° C и относительной влажности 70%. Для экспериментов с РНКи личинки третьей возрастной стадии вырезали из зерен и оставляли в живых во влажной атмосфере при 27.5 ° C на время эксперимента.

Использование стеклянных тарелок, наполненных фасованной мукой (GPF) для искусственного выращивания

Обычно личинки зернового долгоносика не питаются вне зерен по поведенческим причинам. Чтобы преодолеть этот барьер, мы создали искусственную систему, имитирующую компактность зерна злаков, которая заключается в заполнении пшеничной мукой пространства между двумя стеклянными пластинами, разделенными прокладками толщиной 1,5 мм (рис. 1). Особи долгоносика (личинки или зародыши) помещаются между двумя слоями насыпанной пшеничной муки.Сначала мы кладем первый слой муки между стеклянными пластинами, затем лаву и, наконец, извлекаем личинок вторым слоем муки. Эта система также может быть адаптирована для пробирки Эппендорфа.

Рисунок 1

Стеклянные тарелки, наполненные фасованной мукой (GPF) . Эта искусственная система призвана имитировать компактность зерна злаков. Он заключается в заполнении пространства между двумя стеклянными пластинами, разделенных прокладками толщиной 1,5 мм, пшеничной мукой. Долгоносиков по отдельности помещают между двумя слоями фасованной пшеничной муки и переносят в инкубатор (27.5 ° C и относительная влажность 70%). Этот протокол может быть адаптирован к системе флаконов Eppendorf.

Чтобы получить доступ к эмбриональной и постэмбриональной стадиям насекомых, как эмбрионы, так и личинки третьего возраста выращивали в GPF и держали при 27,5 ° C и относительной влажности 70% до появления взрослых особей. Самкам позволяли откладывать яйца на гранулы крахмала (L’amidon Remy, ADS) в течение 4 часов, и эмбрионы собирали путем растворения крахмала в воде. Эмбрионы были немедленно перенесены в систему GPF и оставлены в инкубаторе до появления взрослых особей.Личинки третьего возраста удаляли непосредственно из зерен пшеницы после вскрытия.

Синтез и инъекция дцРНК

Метод, используемый для синтеза дцРНК, аналогичен описанному в [22]. Праймеры были разработаны с помощью программного обеспечения E-RNAi, доступного по адресу http://www.dkfz.de/signaling2/e-rnai/. Для гена wpgrp1 мы использовали праймеры 5’wpgrp1-T7dsRNA и 3’wpgrp1-T7dsRNA, которые совпадают в кодирующей последовательности, а для гена gfp мы использовали праймеры 5’gfp-T7dsRNA и 3’gfp- T7dsRNA (см. Таблицу 1).Нуклеотиды, выделенные жирным шрифтом, относятся к промотору РНК-полимеразы Т7.

Таблица 1 Последовательности праймеров, используемые для синтеза дцРНК, ОТ ПЦР в режиме повторного включения и амлификации кДНК wpgrp1. Нуклеотид, выделенный жирным шрифтом, относится к промотору РНК-полимеразы Т7.

Рекомбинантные плазмиды pCR2.1-topo-wpgrp1 [21] и pw8-gfp [23] использовали в качестве матрицы для амплификации, соответственно, wpgrp1 и gfp с помощью смеси полимераз BD Advantage 2 (BD Biosciences). Продукты ПЦР очищали с помощью набора NucleoSpin Extract II (MachereyNagel) и использовали в качестве матриц для in vitro синтеза дцРНК с использованием набора MEGAscript RNAi (Ambion, Austin, TX).После синтеза дцРНК осаждали в течение ночи при -80 ° C с помощью 0,3 М ацетата натрия, 1,5 мкл гликогена и 2 объемов 100% этанола, повторно суспендированных в воде до конечной концентрации 2,89 мкг / мкл. Чистоту и целостность определяли с помощью Nanodrop и электрофореза в агарозном геле. РНК хранили при -20 ° C перед инъекцией в течение следующих 7 дней.

200 нг дцРНК (69 нл) вводили в спинную и заднюю часть личинок третьего возраста с помощью наноинъектора Nanoinject II (Drummond Scientific), и их держали в системе GPF в течение 4 дней.Затем были выделены бактериомы для выделения РНК.

Экстракция общей РНК и синтез кДНК

Бактериомы были выделены (25 для каждого образца РНК) у личинок четвертого возраста, и общая РНК была экстрагирована с помощью набора для выделения РНК на микромасштабах RNA Water ® -Micro (Ambion), как описана в процедуре производителя, которая включает заключительный этап обработки ДНКазой. После очистки концентрацию РНК в каждом образце измеряли с помощью спектрофотометра Nanodrop ® , а качество общей РНК проверяли электрофорезом.Обратную транскрипцию в кДНК первой цепи проводили с использованием системы синтеза первой цепи для набора RT-PCR (Invitrogen).

Количественная оценка транскриптов ОТ ПЦР в реальном времени

Количественные измерения были выполнены на образцах РНК, происходящих из 5 независимых повторов. Количественный анализ проводили на приборе LightCycler ® с использованием набора LightCycler Fast Start DNA Master SYBR green I (Roche Diagnostics). Данные были нормализованы с использованием отношения концентрации целевой кДНК к концентрации гена глицеральдегид-3-фосфатдегидрогеназы ( gapdh ).Экспрессия этого гена существенно не зависит от лечения, и она аналогична экспрессии гена рибосомного белка L29 (данные не показаны). Праймеры были разработаны для амплификации фрагментов длиной менее 300 п.н .; wpgrp1-For и wpgrp1-Rev генерируют фрагмент wpgrp1 длиной 248 п.н., а gapdh-For и gapdh-Rev генерируют фрагмент gapdh длиной 277 п.о. (Таблица 1).

Реакции ПЦР проводили в 96-луночных планшетах LightCycler в конечном объеме 10 мкл, содержащем 2 мкл.5 мкл образцов кДНК (разведенных в пять раз) и 7,5 мкл смеси Light Cycler ® 480 SYBR Green Master 1, с 0,5 мкл 10 мМ каждого праймера, 1,5 мкл h3O и 5 мкл Mastermix. После 5 мин при 95 ° C условия циклирования были следующими: 45 циклов при 95 ° C в течение 10 с, 56 ° C в течение 20 с и 72 ° C в течение 30 с. Для идентификации продукта в конце каждой ПЦР строили кривую плавления путем нагревания в течение 30 с при 66 ° C, а затем повышения температуры до 95 ° C со скоростью 0,11 ° C / с. Реакции осуществлялись охлаждением при 40 ° C в течение 30 с.

Эффективность ПЦР (Эффективность (E) рассчитывается по наклону стандартной кривой, полученной с различными матричными величинами. E = 10 -1 / наклон , в этом исследовании E составляла 97,7% для gapdh и 94,4% для wpgrp1 ), а для отдельных образцов точка пересечения (Cp, точка, в которой амплифицированный продукт впервые виден в данных) и концентрация (конц.) wpgrp1 (или были определены транскрипты gapdh ).Поскольку количественная оценка основана на эффективности ПЦР каждого эксперимента, соотношения затем нормализовали с помощью gapdh . Относительное соотношение для каждого образца рассчитывали по формуле: (конц. wpgrp1 (образец) / конц. gapdh (образец)). Нормализованные данные были проанализированы с использованием однофакторного дисперсионного анализа и апостериорного теста Tukey HSD [24].

Экспрессия рекомбинантного белка в

Escherichia coli для препарата антитела

Общая кДНК из личинок бактериомов Sitophilus zeamais служила в качестве матрицы в ПЦР-амплификации для выделения кДНК wpgrp1 .

В качестве праймеров использовали кДНК For-wpgrp1 и кДНК Rev-wpgrp1 (таблица 1). Полученная ДНК кодировала 263 остатка зрелого белка. Продукт ПЦР (789 п.н.) клонировали в вектор экспрессии pTrc-His-Topo (Invitrogen), и полученный вектор вводили в штамм E. coli TOP10. Нуклеотидную последовательность синтезированного гена проверяли секвенированием дидезоксинуклеотидов, и рекомбинантную плазмиду трансформировали в штамм E. coli BL21. Экспрессия рекомбинантного белка Wpgrp1, фланкированного 6 гистидинами на N-конце, была индуцирована 1 мМ изопропил-D-тиогалактопиранозидом при оптической плотности 0.6 при 30 ° C в течение 4 часов.

Бактериальные лизаты получали обработкой ультразвуком в буфере А, pH 8, содержащем 50 мМ фосфата натрия, 300 мМ NaCl и лизоцим до конечной концентрации 1 мг / мл. Слитый белок, связанный с колонкой Protino-Ni (Macherey-nagel), элюировали буфером A, содержащим 250 мМ имидазола, после промывки колонки буфером A. Элюированная фракция подвергалась диализу против буфера, содержащего 0,05 M трис-HCl (pH 8,8). ), 1 мМ ЭДТА и 10% глицерина. Белок смешивали с загрузочным буфером 2 × SDS и затем разделяли электрофорезом в 12.5% акриламидный гель. Затем полосу белка разрезали, секвенировали на N-конце и разрезали на кусочки для инъекции кролику с целью получения поликлональной антисыворотки против Wpgrp1 в CovalAb Lyon (Франция), которую собирали через 74 дня после первоначальной инокуляции.

Вестерн-блот-анализ

Вестерн-блот-анализ выполняли с использованием системы вестерн-блоттинга с усиленной хемилюминесценцией (ECL) (Amersham Biosciences, Пискатауэй, Нью-Джерси, США). Образцы белка из бактериома смешивали с буфером для образцов, кипятили в течение 5 мин и загружали в 12.5% SDS-PAGE. Белки наносили на лист PVDF-мембраны (Amersham). После блоттинга мембрану блокировали инкубацией в 3% растворе желатина, инкубировали с раствором антисыворотки против wpgrp1 (1: 500 об. / Об.) При комнатной температуре в течение 2 ч и промывали TBST (100 мМ трис-HCl, pH 8,100. мМ NaCl, 0,1% Твин 20). Для нормализации блоты зондировали антителом к ​​β-тубулину, полученным из β-тубулина Drosophila melanogaster (тебу-био, 1: 500 об. / Об.). Затем мембрану инкубировали с разведенными 1: 5000 (об. / Об.) Антителами против кроличьего IgG-пероксидазы, продуцированными у коз (Sigma).После повторной промывки мембрану инкубировали с реагентами для обнаружения ECL (Amersham Biosciences) и экспонировали с пленкой.

Системный нокдаун гена в ткани бактериома

BMC Biotechnol. 2009; 9: 44.

, 1 , 1 , 2 и 1

Agnès Vallier

1 Université de Lyon, INRA, INSA-Lyon, IFR-41, UMR203 BF2I, Biologie Fonctionnel Insectes et Interactions, 20 авеню Эйнштейна, F-69621 Villeurbanne, France

Carole Vincent-Monégat

1 Université de Lyon, INRA, INSA-Lyon, IFR-41, UMR203 BF2I, Biologie Fon et Interactions Insectes, 20 ave A Einstein, F-69621 Villeurbanne, France

Anne Laurençon

2 Université de Lyon, Lyon, F-69003, France, Université de Lyon 1, CNRS, UMR5534, Centre de Génétique Moléculaire et Cellulaire, F- 69622, Франция

Abdelaziz Heddi

1 Université de Lyon, INRA, INSA-Lyon, IFR-41, UMR203 BF2I, Biologie Fonctionnelle Insectes et Interactions, 20 авеню Эйнштейна, F-69621 Villeurbanne, 4 9004 Лионский университет, INRA, INSA -Lyon, IFR-41, UMR203 BF2I, Biologie Fonctionnelle Insectes et Interactions, 20 ave A Einstein, F-69621 Villeurbanne, France

2 Université de Lyon, Lyon, F-69003, France, Université Lyon 1, CNRS, UMR5534, Centre de Génétique Moléculaire et Cellulaire, Villeurbanne, F-69622, France

Автор, отвечающий за переписку.

Поступило 8 февраля 2009 г .; Принято 15 мая 2009 г.

Copyright © 2009 Vallier et al; лицензиат BioMed Central Ltd.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе. при условии правильного цитирования оригинала.

Эта статья цитируется в других статьях в PMC.

Абстракция

Фон

Долгоносики Sitophilus spp.являются одними из важнейших космополитических вредителей хранимых зерновых культур. Однако их биология и физиология плохо изучены, главным образом из-за того, что стадии развития насекомых происходят в зернах злаков и из-за отсутствия специфичных для генов молекулярных манипуляций.

Результаты

Чтобы получить доступ к различным стадиям развития насекомых, самкам долгоносиков позволяли откладывать яйца на гранулы крахмала, а вылупившиеся эмбрионы собирали путем растворения крахмала в воде.Эмбрионы были перенесены между двумя стеклянными пластинами, заполненными упакованной мукой (GPF), чтобы имитировать компактную текстуру зерна злаков, и эта система позволила нам восстановить определенные стадии развития. Чтобы подавить ген, экспрессируемый в органе, несущем бактерии (бактериом), целым личинкам инъецировали дцРНК для нацеливания на ген wpgrp1 , а затем их оставляли для развития еще на 4 дня. Количественный анализ RT-PCR и вестерн-блоттинга бактериома этих животных выявил подавление экспрессии wpgrp1 как на уровне транскрипта, так и на уровне белка.

Заключение

Эти результаты демонстрируют, что инъекция дцРНК цельной личинке приводит к высокому и системному снижению как мРНК, так и белка в ткани бактериома. Это, наряду с возможностью доступа к стадиям развития насекомых, открывает новые возможности для исследования специфических функций генов у злаковых долгоносиков.

Общие сведения

Зерновые культуры являются основным продуктом питания в мире и являются источником энергии и белка для многих групп населения, особенно в развивающихся странах.К сожалению, потери зерна зерновых при хранении в некоторых странах могут достигать 50% от общего урожая, что представляет собой всемирные потери, эквивалентные тысячам миллионов евро [1]. Зерновые долгоносики Sitophilus spp. (Dryophthoridae, Curculionoidea) хорошо известны как основные основные вредители хранимых зерен зерновых, вызывающие повреждение и повышающие уязвимость зерна к атакам вторичных насекомых-вредителей, таких как Tribolium .

Род Sitophilus включает три кормовых вида злаковых ( Sitophilus oryzae , Sitophilus zeamais и Sitophilus granarius ).Интересно, что все три вида разделяют внутриклеточный симбиоз с грамотрицательной γ-Proteobacterium [2,3]. Симбиотические бактерии (эндосимбионты) передаются потомству от матери, и на ранней стадии эмбриогенеза хозяина эти бактерии вызывают дифференциацию специализированных хозяйских клеток (бактериоцитов), в которых находятся бактерии, защищая их от иммунной системы хозяина [4,5 ] и образуют симбиотический орган (бактериом), который сохраняется на протяжении личиночных стадий [6]. Эндосимбиотические бактерии уравновешивают рацион насекомых зерновыми культурами, богатыми крахмалом, но бедными аминокислотами, липидами и витаминами [7-9].Это улучшает митохондриальный энергетический метаболизм и влияет, таким образом, на приспособленность насекомого , способность к полету и способность к инвазии [10,6,12].

Борьба с этими насекомыми-хранителями в основном осуществляется с помощью синтетических инсектицидов, которые вызывают высокие экологические издержки и приводят к появлению устойчивых к инсектицидам штаммов [13]. Следовательно, разработка методов, облегчающих молекулярные манипуляции с этими насекомыми, представляет большой интерес. Поскольку из-за отсутствия эндосимбионтов физиология и размножение насекомых резко нарушаются, одна инновационная стратегия будет полагаться на лучшее понимание взаимодействия симбионтов-хозяев.

Секвенирование генома эндосимбионта Sitophilus , наряду с разработкой экспрессируемых тегов последовательностей, помогает лучше узнать биологию и физиологию долгоносиков [14,4,15]. Одним из очень многообещающих методов целенаправленного подавления экспрессии генов у широкого круга организмов является РНК-интерференция (РНКи) [16]. РНКи также превратилась в мощный инструмент для исследования функции генов у Drosophila , Tribolium , Caenorhabditis elegans и мышей.Доставка дцРНК или миРНК в клетку запускает отмену целевой мРНК. Предыдущие эксперименты показали возможность использования РНКи для отмены экспрессии транскриптов генов у некоторых насекомых [17].

Было показано, что ряд животных клеток естественным образом поглощает экзогенную дцРНК и использует ее для инициации молчания РНКи. У некоторых организмов, таких как Drosophila и Bombyx mori , определенные клетки демонстрируют эффективное поглощение дцРНК, но они, по-видимому, неспособны передавать эту дцРНК другим клеткам организма [17,18].Организмы, такие как C. elegans , могут как захватывать дцРНК, так и распространять ее системно, вызывая ответ РНКи по всему организму. Интересно, что первый системный РНКи-ответ у насекомых был зарегистрирован у мучного жука Tribolium castaneum : инъекция дцРНК личинкам приводит к специфическому подавлению гена у взрослых особей [19]. Этот эффект также может передаваться из поколения в поколение [20]. Этот вид жесткокрылых близкородственен Sitophilus как филогенетически, так и экологически.

Таким образом, мы провели исследование, чтобы получить доступ к биологическим и физиологическим аспектам системы Sitophilus на основе использования геномных инструментов. Образ жизни и поведение долгоносиков ограничивают развитие эмбрионов, личинок и нимф только внутри зерна. Таким образом, долгоносики не могут выжить или размножаться на зерновой муке так, как это делают насекомые Tribolium . Здесь мы представляем новые условия выращивания, которые обеспечивают экспериментальный доступ к различным эмбриональным и личиночным стадиям злакового долгоносика Sitophilus .Эта система позволяет нам поддерживать жизнь насекомых вне злаков на протяжении всего жизненного цикла. Чтобы проверить протоколы сайленсинга гена в Sitophilus , мы выбрали ген, специфически экспрессируемый в бактериоме, который кодирует белок узнавания пептидогликана ( wpgrp1 ) [21,4]. Используя введенную дцРНК, мы представляем доказательства наличия системных РНКи у долгоносика Sitophilus spp.

Методы

Разведение насекомых

Насекомых вида Sitophilus zeamais (штамм Lagoa) выращивали, как описано в [21].Личинки обычно растут внутри зерна пшеницы до тех пор, пока через месяц после кладки яиц не появятся взрослые особи, при температуре 27,5 ° C и относительной влажности 70%. Для экспериментов с РНКи личинки третьей возрастной стадии вырезали из зерен и оставляли в живых во влажной атмосфере при 27,5 ° C в течение всего эксперимента.

Использование стеклянных тарелок, наполненных фасованной мукой (GPF) для искусственного выращивания

Обычно личинки зернового долгоносика не питаются вне зерен по поведенческим причинам. Чтобы преодолеть этот барьер, мы создали искусственную систему, имитирующую компактность зерна злаков, которая заключается в заполнении пшеничной мукой пространства между двумя стеклянными пластинами, разделенными 1.Прокладки толщиной 5 мм (рисунок). Особи долгоносика (личинки или зародыши) помещаются между двумя слоями насыпанной пшеничной муки. Сначала мы кладем первый слой муки между стеклянными пластинами, затем лаву и, наконец, извлекаем личинок вторым слоем муки. Эта система также может быть адаптирована для пробирки Эппендорфа.

Стеклянные тарелки, наполненные фасованной мукой (GPF) . Эта искусственная система призвана имитировать компактность зерна злаков. Он заключается в заполнении пространства между двумя стеклянными пластинами, разделенными 1.Прокладки толщиной 5 мм, пропитанные пшеничной мукой. Долгоносиков по отдельности помещают между двумя слоями упакованной пшеничной муки и переносят в инкубатор (27,5 ° C и относительная влажность 70%). Этот протокол может быть адаптирован к системе флаконов Eppendorf.

Чтобы получить доступ к эмбриональной и постэмбриональной стадиям насекомых, как эмбрионы, так и личинки третьего возраста выращивали в GPF и держали при 27,5 ° C и относительной влажности 70% до появления взрослых особей. Самкам позволяли откладывать яйца на гранулы крахмала (L’amidon Remy, ADS) в течение 4 часов, и эмбрионы собирали путем растворения крахмала в воде.Эмбрионы были немедленно перенесены в систему GPF и оставлены в инкубаторе до появления взрослых особей. Личинки третьего возраста удаляли непосредственно из зерен пшеницы после вскрытия.

Синтез и инъекция дцРНК

Метод, используемый для синтеза дцРНК, аналогичен описанному в [22]. Праймеры были разработаны с помощью программного обеспечения E-RNAi, доступного по адресу http://www.dkfz.de/signaling2/e-rnai/. Для гена wpgrp1 мы использовали праймеры 5’wpgrp1-T7dsRNA и 3’wpgrp1-T7dsRNA, которые совпадают в кодирующей последовательности, а для гена gfp мы использовали праймеры 5’gfp-T7dsRNA и 3’gfp- T7dsRNA (см. Таблицу).Нуклеотиды, выделенные жирным шрифтом, относятся к промотору РНК-полимеразы Т7.

Таблица 1

Последовательности праймеров, используемые для синтеза дцРНК, ОТ ПЦР в режиме повторной реакции и амлификации кДНК wpgrp1. Нуклеотид, выделенный жирным шрифтом, относится к промотору РНК-полимеразы Т7.

Праймеры, используемые для синтеза дцРНК
5’pgrp1-T7dsRNA 5′-TAATACGACTCACTATAGGGCCAGTCCCTTACGTCGTCAT-3′
3’pgrp1-T7dsRNA 5′-TAATACGACTCACTATAGGGTCTGTTTCTCGGACTTGCCT-3′
5’gfp-T7dsRNA 5 ‘ 5′-TAATACGACTCACTATAGGGCAAGGAGGACGGCAACATCC-3′
3’gfp-T7dsRNA 5’TAATACGACTCACTATAGGGTAGTAG2 9066 9066 9066 9066 9066 9066 9066 9066 9066 9066 9066 9066 Амплификация транскрипта ПЦР
wpgrp1-For 5′-ATAATTTCGCTGTTGGAGGG-3 ‘
wpgrp1-Rev 5′-TCTCGGACTTGCC’TATGACT-3′ GACTGACT-90CC-3 ’90CCGACTGACTGACTGACT 90CC-3′ ‘
gapdh-Rev 5′-GCGCCCATGTATGTAGTTGG-3′
Грунтовки, используемые для ПЦР-амплификация кДНК wpgrp1
кДНК For-wpgrp1 5′-ATGTCCAGTAAGCAATCACGG-3 ‘
Rev-wpgrp1 кДНК
Rev-wpgrp1 кДНК 5′-TAAGAC35 5′-TAAGAC35 Плазмида1-topo-wpgrp1 [21] и pw8-gfp [23] были использованы в качестве матрицы для амплификации соответственно wpgrp1 и gfp с помощью смеси полимераз BD Advantage 2 (BD Biosciences). Продукты ПЦР очищали с помощью набора NucleoSpin Extract II (MachereyNagel) и использовали в качестве матриц для синтеза дцРНК in vitro с использованием набора MEGAscript RNAi Kit (Ambion, Austin, TX). После синтеза дцРНК осаждали в течение ночи при -80 ° C с помощью 0,3 М ацетата натрия, 1,5 мкл гликогена и 2 объемов 100% этанола, повторно суспендированных в воде до конечной концентрации 2.89 мкг / мкл. Чистоту и целостность определяли с помощью Nanodrop и электрофореза в агарозном геле. РНК хранили при -20 ° C перед инъекцией в течение следующих 7 дней.

200 нг дцРНК (69 нл) вводили в спинную и заднюю часть личинок третьего возраста с помощью наноинъектора Nanoinject II (Drummond Scientific), и их держали в системе GPF в течение 4 дней. Затем были выделены бактериомы для выделения РНК.

Экстракция общей РНК и синтез кДНК

Бактериомы были выделены (25 для каждого образца РНК) у личинок четвертого возраста, и общая РНК была экстрагирована с помощью набора для выделения РНК на микромасштабах RNA Water ® -Micro (Ambion), как описана в процедуре производителя, которая включает заключительный этап обработки ДНКазой.После очистки концентрацию РНК в каждом образце измеряли спектрофотометром Nanodrop ® , а качество общей РНК проверяли электрофорезом. Обратную транскрипцию в кДНК первой цепи проводили с использованием системы синтеза первой цепи для набора RT-PCR (Invitrogen).

Количественная оценка транскриптов ОТ ПЦР в реальном времени

Количественные измерения были выполнены на образцах РНК, происходящих из 5 независимых повторов. Количественный анализ проводили на приборе LightCycler ® с использованием набора LightCycler Fast Start DNA Master SYBR green I (Roche Diagnostics).Данные были нормализованы с использованием отношения концентрации целевой кДНК к концентрации гена глицеральдегид-3-фосфатдегидрогеназы ( gapdh ). Экспрессия этого гена существенно не зависит от лечения, и она аналогична экспрессии гена рибосомного белка L29 (данные не показаны). Праймеры были разработаны для амплификации фрагментов длиной менее 300 п.н .; wpgrp1-For и wpgrp1-Rev генерируют фрагмент wpgrp1 длиной 248 п.н., а gapdh-For и gapdh-Rev генерируют фрагмент gapdh длиной 277 п.н. (таблица).

Реакции ПЦР проводили в 96-луночных планшетах LightCycler в конечном объеме 10 мкл, содержащем 2,5 мкл образцов кДНК (разведенных в пять раз) и 7,5 мкл смеси Light Cycler ® 480 SYBR Green Master 1 с 0,5 мкл 10 мМ каждого праймера, 1,5 мкл h3O и 5 мкл Mastermix. После 5 мин при 95 ° C условия циклирования были следующими: 45 циклов при 95 ° C в течение 10 с, 56 ° C в течение 20 с и 72 ° C в течение 30 с. Для идентификации продукта в конце каждой ПЦР строили кривую плавления путем нагревания в течение 30 с при 66 ° C, а затем повышения температуры до 95 ° C со скоростью приращения 0.11 ° C / с. Реакции осуществлялись охлаждением при 40 ° C в течение 30 с.

Эффективность ПЦР (Эффективность (E) рассчитывается по наклону стандартной кривой, полученной с различными матричными величинами. E = 10 -1 / наклон , в этом исследовании E составляла 97,7% для gapdh и 94,4% для wpgrp1 ), а для отдельных образцов точка пересечения (Cp, точка, в которой амплифицированный продукт впервые виден в данных) и концентрация (конц.) wpgrp1 (или были определены транскрипты gapdh ).Поскольку количественная оценка зависит от эффективности ПЦР в каждом эксперименте, соотношения затем нормализовали с помощью gapdh . Относительное соотношение для каждого образца рассчитывали по формуле: (конц. wpgrp1 (образец) / конц. gapdh (образец)). Нормализованные данные были проанализированы с использованием однофакторного дисперсионного анализа и апостериорного теста Tukey HSD [24].

Экспрессия рекомбинантного белка в

Escherichia coli для препарата антитела

Общая кДНК из личиночных бактериомов Sitophilus zeamais служила в качестве матрицы в ПЦР-амплификации для выделения кДНК wpgrp1 .

В качестве праймеров использовали кДНК For-wpgrp1 и кДНК Rev-wpgrp1 (таблица). Полученная ДНК кодировала 263 остатка зрелого белка. Продукт ПЦР (789 п.н.) клонировали в вектор экспрессии pTrc-His-Topo (Invitrogen), и полученный вектор вводили в штамм E.coli TOP10. Нуклеотидную последовательность синтезированного гена проверяли секвенированием дидезоксинуклеотидов, и рекомбинантную плазмиду трансформировали в штамм E.coli BL21. Экспрессия рекомбинантного белка Wpgrp1, фланкированного 6 гистидинами на N-конце, была индуцирована 1 мМ изопропил-D-тиогалактопиранозидом при оптической плотности 0.6 при 30 ° C в течение 4 часов.

Бактериальные лизаты получали обработкой ультразвуком в буфере А, pH 8, содержащем 50 мМ фосфата натрия, 300 мМ NaCl и лизоцим до конечной концентрации 1 мг / мл. Слитый белок, связанный с колонкой Protino-Ni (Macherey-nagel), элюировали буфером A, содержащим 250 мМ имидазола, после промывки колонки буфером A. Элюированная фракция подвергалась диализу против буфера, содержащего 0,05 M трис-HCl (pH 8,8). ), 1 мМ ЭДТА и 10% глицерина. Белок смешивали с загрузочным буфером 2 × SDS и затем разделяли электрофорезом в 12.5% акриламидный гель. Затем полосу белка разрезали, секвенировали на N-конце и разрезали на кусочки для инъекции кролику с целью получения поликлональной антисыворотки против Wpgrp1 в CovalAb Lyon (Франция), которую собирали через 74 дня после первоначальной инокуляции.

Вестерн-блот-анализ

Вестерн-блот-анализ выполняли с использованием системы вестерн-блоттинга с усиленной хемилюминесценцией (ECL) (Amersham Biosciences, Пискатауэй, Нью-Джерси, США). Образцы белка из бактериома смешивали с буфером для образцов, кипятили в течение 5 мин и загружали в 12.5% SDS-PAGE. Белки наносили на лист PVDF-мембраны (Amersham). После блоттинга мембрану блокировали инкубацией в 3% растворе желатина, инкубировали с раствором антисыворотки против wpgrp1 (1: 500 об. / Об.) При комнатной температуре в течение 2 ч и промывали TBST (100 мМ трис-HCl, pH 8,100. мМ NaCl, 0,1% Твин 20). Для нормализации блоты зондировали антителом к ​​β-тубулину, полученным из β-тубулина Drosophila melanogaster (тебу-био, 1: 500 об. / Об.). Затем мембрану инкубировали с разведенными 1: 5000 (об. / Об.) Антителами против кроличьего IgG-пероксидазы, продуцированными у коз (Sigma).После повторной промывки мембрану инкубировали с реагентами для обнаружения ECL (Amersham Biosciences) и экспонировали с пленкой.

Результаты и обсуждение

В этой статье мы сначала разработали новый протокол, позволяющий искусственно выращивать долгоносиков с доступом к различным стадиям развития, а, во-вторых, мы продемонстрировали, что технология РНКи может применяться для подавления экспрессии генов.

Применение методологии искусственного выращивания для манипуляции с долгоносиком

В отличие от Tribolium , личинки долгоносика не могут питаться пшеничной мукой или выживать вне зерен злаков по поведенческим и морфологическим причинам.Личинкам требуется компактная текстура, которая оказывает давление на их спину, что необходимо для доступа к пище с помощью их нижних челюстей. Чтобы имитировать эту структуру, мы создали аппарат для искусственного выращивания, который состоит из помещения зародышей и личинок долгоносика между двумя слоями упакованной пшеничной муки (см. Рис.). Чтобы получить доступ к более поздним стадиям жизненного цикла долгоносиков (т. Е. Третьей и четвертой стадиям личинок), личинок собирали непосредственно при рассечении зерна. Раннее развитие возможно при использовании стадий эмбриона, восстановленных после 2–4-часовых отложений на крахмальных зернах.Эмбрионы собирают после того, как самки откладывают яйца, растворяя крахмал в воде. Их можно либо манипулировать, либо передавать в систему GPF для получения более поздних стадий развития. Показатели выживаемости, представленные в таблице, показывают, что до 34% эмбрионов смогли достичь взрослой стадии. Когда личинки переносятся и выращиваются в GPF, урожай близок к 100% (данные не показаны).

Таблица 2

Процент вылупившихся взрослых зародышей долгоносиков, выращенных в GPF

Эксперимент 1 902 902 902 902 902 902
Количество эмбрионов за эксперимент % вылетов имаго Время развития (дни) *
41 34.1 37
Эксперимент 2 38 36,8 38
Эксперимент 3 42 33,9 38

Эта система представляет интерес для прикладных и фундаментальных наук, поскольку позволяет легко переходить к различным этапам. Представляющие интерес лекарства и молекулы могут быть смешаны с мукой и, таким образом, испытаны непосредственно на различных вариантах насекомых.

Тестирование опосредованного РНКи сайленсинга гена у

Sitophilus

РНКи тестировали на насекомых Sitophilus с геном wpgrp1 в качестве мишени. Мы недавно идентифицировали ген wpgrp1 путем подавления субтрактивной гибридизации при скрининге генов, экспрессия которых повышается в ткани бактериома [14]. Чтобы исследовать функцию wpgrp1 более подробно, мы вывели поликлональное антитело Wpgrp1 и подтвердили присутствие большого количества белка wpgrp1 в бактериоме с помощью вестерн-блоттинга (рис.).

Вестерн-блоттинг стабильных уровней белка Wpgrp1 в ткани бактериома через четыре дня после обработки личинками . Инъекция gfp-dsRNA дала результат, аналогичный результату обработки PBS (данные не показаны). А и В представляют собой блоты, зондированные антителами против Wpgrp1 и против тубулина соответственно.

Когда личинкам третьей стадии инъецировали стерильный PBS или gfp _dsRNA, уровень транскрипта wpgrp1 в бактериоме находился в том же диапазоне, что и в бактериоме неинъектированных контрольных личинок.Однако инъекция 200 нг wpgrp1 _dsRNA в личиночную гемолимфу приводит к 98% сокращению целевого гена по сравнению с gfp _dsRNA control на уровнях транскрипта wpgrp1 бактериома (рис.). Кроме того, это подавление на уровне транскрипта также влияет на количество белка Wpgrp1 в бактериоме (рис.). Эти данные подчеркивают эффективность подавления гена РНКи у насекомых Sitophilus и показывают, что метод РНКи может быть успешно использован для нокдауна генов-мишеней в ткани бактериома.

ПЦР-анализ Q-RT транскриптов wpgrp1 , выделенных из тканей бактериома, взятых от личинок четвертой стадии через четыре дня после обработок . C — необработанные контрольные личинки; PBS, ds-gfp и ds-wpgrp1 представляют собой личинки, инъецированные PBS, gfp-dsRNA и wpgrp1-dsRNA соответственно. Данные нормализованы по уровням транскрипта gapdh , выражены как среднее значение 5 независимых повторений и проанализированы с помощью однофакторного дисперсионного анализа ANOVA и апостериорного теста Tukey HSD. Звездочки показывают значимые различия ( p <0.05).

Заключение

РНКи — это метод, с помощью которого дцРНК может быть введена непосредственно животным для запуска значительного подавления экспрессии специфических генов. В свете наших данных установление системного пути РНКи у этого злакового долгоносика открывает путь для более подробных всесторонних исследований на молекулярном уровне биологии долгоносика. Системный путь РНКи может также предоставить возможности для разработки видоспецифичных и, следовательно, экологически безопасных методов борьбы с вредителями.Геномные подходы недавно предоставили 10 000 унигенов, которые помогут разработать общегеномные приложения РНКи, решающие фундаментальные вопросы физиологии, развития и регуляции генов злаковых долгоносиков.

Вклад авторов

AV установил и выполнил эксперименты с системой GPF и RNAi, выполнил Q-RT PCR; CVM экспрессировал белок wpgr1 и провел вестерн-блоттинг; AL внес свой вклад в эксперименты с РНКи; AH задумал работу; Все авторы внесли свой вклад в написание рукописи.

Благодарности

Мы благодарим Дж. Рика за его технические советы, M.O. Fauvarque и E. Bergeret за техническую поддержку, E. Cortier за поставку капилляров, A. Vigneron за статистический анализ, V. James за английские поправки. Авторы также хотели бы поблагодарить анонимных рецензентов за конструктивную критику. Эта работа была поддержана IFR41 (Федеральный институт исследований био-окружающей среды и Санте) и французским ANR-06-BLAN-0316 (EndoSymArt).

Каталожные номера

  • Haff RPSD. Рентгеновское обследование пшеницы на зараженность амбарным долгоносиком в режиме реального времени. Sitophilus granarius (L.) Транзакции ASAE. 2004. 47: 531–537. [Google Scholar]
  • Heddi A, Charles H, Khatchadourian C, Bonnot G, Nardon P. Молекулярная характеристика основных симбиотических бактерий долгоносика Sitophilus oryzae : своеобразное содержание G — C в эндоцитобиотической ДНК. J Mol Evol. 1998. 47: 52–61. DOI: 10.1007 / PL00006362. [PubMed] [CrossRef] [Google Scholar]
  • Charles H, Heddi A, Rahbé Y.Предполагаемая внутриклеточная кладка стволовых эндосимбионтов насекомых в составе Enterobacteriaceae, полученная в результате филогенетического анализа, основанного на гетерогенной модели эволюции ДНК. C R Acad Sci Paris. 2001. 324: 489–494. [PubMed] [Google Scholar]
  • Anselme C, Perez-Brocal V, Vallier A, Vincent-Monegat C, Charif D, Latorre A, Moya A, Heddi A. Идентификация иммунных генов долгоносиков и их экспрессия в тканях бактериома . BMC Biol. 2008; 6: 43. DOI: 10.1186 / 1741-7007-6-43. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Reynolds S, Rolff J.Иммунная функция держит эндосимбионтов под контролем. J Biol. 2008; 7: 28. DOI: 10.1186 / jbiol88. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Heddi A, Grenier AM, Khatchadourian C, Charles H, Nardon P. Четыре внутриклеточных генома прямой биологии долгоносика: ядерный, митохондриальный, основные эндосимбионты и Wolbachia . Proc Natl Acad Sci USA. 1999; 96: 6814–6819. DOI: 10.1073 / pnas.96.12.6814. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Wicker C.Дифференциальная потребность симбиотиков и апосимбиотиков в витаминах и холине Sitophilus oryzae (Coleoptera: Curculionidae) Comp Biochem. 1983; 76A: 177–182. DOI: 10.1016 / 0300-9629 (83)
-0. [CrossRef] [Google Scholar]
  • Wicker C, Guillaud J, Bonnot G. Сравнительный состав свободных, пептидных и белковых аминокислот в симбиотических и апосимбиотических Sitophilus oryzae (Coleoptera, Curculionidae) Insect Biochem. 1985; 15: 537–541. DOI: 10.1016 / 0020-1790 (85) -8.[CrossRef] [Google Scholar]
  • Нардон П., Гренье AM. Генетические и биохимические взаимодействия между хозяином и его эндосимбиотами у долгоносика Sitophilus (Coleoptera Curculionidae) и других родственных видов. В: Scannerini S и др., Редактор. Сигналы от клетки к клетке в симбиозе растений, животных и микробов. Springer-verlag Berlin; 1988. С. 255–270. [Google Scholar]
  • Хедди А., Лефевр Ф., Нардон П. Влияние эндоцитобиотических бактерий на ферментативную активность митохондрий долгоносика Sitophilus oryzae (Coleoptera, Curculionidae) Насекомое Biochem Mol Biol.1993; 23: 403–411. DOI: 10.1016 / 0965-1748 (93) -M. [CrossRef] [Google Scholar]
  • Grenier AMNP, Nardon C. Роль симбиотов в летной активности долгоносиков Sitophilus. Entomologia Experimentalis et Applicata. 1994; 70: 201–208. DOI: 10.1007 / BF02380553. [CrossRef] [Google Scholar]
  • Хедди А., Нардон П. Sitophilus oryzae L .: Модель внутриклеточного симбиоза в симбиозе долгоносиков Dryophthoridae (Coleoptera). 2005; 39: 1–11. [Google Scholar]
  • Sighamony SAI, Chandrakala TS, Kaiser J.Продукты из местных растений в качестве защиты зерна от Sitophilus oryzae (L) и Rhyzopertha dominica (F) J Исследование хранимых продуктов. 1990; 22: 21–23. DOI: 10.1016 / 0022-474X (86)

    -1. [CrossRef] [Google Scholar]

  • Heddi A, Vallier A, Anselme C, Xin H, Rahbe Y, Wackers F. Молекулярные и клеточные профили бактериоцитов насекомых: мутуализм и вред на начальном этапе эволюции симбиогенеза. Cell Microbiol. 2005; 7: 293–305. [PubMed] [Google Scholar]
  • Гил Р., Белда Э., Госальбес М.Дж., Делай Л., Валлье А., Винсент-Монегат К., Хедди А., Сильва Ф.Дж., Моя А., Латорре А.Большое количество вставных последовательностей в геноме SOPE, первичного эндосимбионта рисового долгоносика Sitophilus oryzae. Int Microbiol. 2008; 11: 41–48. [PubMed] [Google Scholar]
  • Fire A, Xu S., Montgomery MK, Kostas SA, Driver SE, Mello CC. Сильная и специфическая генетическая интерференция двухцепочечной РНК у Caenorhabditis elegans. Природа. 1998. 391: 806–811. DOI: 10,1038 / 35888. [PubMed] [CrossRef] [Google Scholar]
  • Цена DR, Gatehouse JA. РНКи-опосредованная защита растений от насекомых.Trends Biotechnol. 2008; 26: 393–400. DOI: 10.1016 / j.tibtech.2008.04.004. Epub, 2008, май 2022 г. [PubMed] [CrossRef] [Google Scholar]
  • Маркус Дж. М.. Прыгающие гены и карты AFLP: трансформация генетики цветового узора чешуекрылых. Evol Dev. 2005. 7: 108–114. DOI: 10.1111 / j.1525-142X.2005.05012.x. [PubMed] [CrossRef] [Google Scholar]
  • Томоясу Y, Denell RE. РНКи личинок в Tribolium (Coleoptera) для анализа развития взрослых особей. Dev Genes Evol. 2004. 214: 575–578. DOI: 10.1007 / s00427-004-0434-0.Epub 2004, сентябрь 2009 г. [PubMed] [CrossRef] [Google Scholar]
  • Bucher G, Scholten J, Klingler M. Родительские РНКи в Tribolium (Coleoptera) Curr Biol. 2002; 12: R85–86. DOI: 10.1016 / S0960-9822 (02) 00666-8. [PubMed] [CrossRef] [Google Scholar]
  • Ансельм С., Валлиер А., Бальманд С., Фоварк, Миссури, Хедди А. Экспрессия гена хоста PGRP и высвобождение бактерий при эндосимбиозе долгоносика Sitophilus zeamais . Appl Environ Microbiol. 2006. 72: 6766–6772. DOI: 10.1128 / AEM.00942-06. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Goto A, Blandin S, Royet J, Reichhart JM, Levashina EA. Подавление компонентов пути Toll путем прямой инъекции двухцепочечной РНК взрослым мухам дрозофилы. Nucleic Acids Res. 2003. 31: 6619–6623. DOI: 10,1093 / нар / gkg852. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Лоппин Б., Лепетит Д., Дорус С., Кубл П., Карр Т.Л. Происхождение и неофункционализация гена отцовского эффекта дрозофилы, необходимого для жизнеспособности зиготы.Curr Biol. 2005; 15: 87–93. DOI: 10.1016 / j.cub.2004.12.071. [PubMed] [CrossRef] [Google Scholar]
  • Team RDC R: язык и среда для статистических вычислений. R Фонд статистических вычислений. Вена, Австрия. 2005. http://www.R-project.org
  • Идентификация иммунных генов долгоносиков и их экспрессия в тканях бактериома

    , 1 , 2 , 1 , 1 , 3 , 2 , 2 и 1

    Кэролайн Ансельм

    1 Université de Lyon, INRA, INSA-Lyon, IFR-41, UMR203 BF2I, Biologie Fonctionnelle Insectes et Interactions, F-69621 Villeurbanne Франция

    Vicente Pérez-Brocal

    2 Institut Cavanilles de Biodiversitat i Biologia Evolutiva, Universitat de València, Apartado de Correos 22085, 46071 Валенсия, Испания

    Agnès Vallier 9430003, Agnès Vallier, INRA 9430003 Lyon, IFR-41, UMR203 BF2I, Biologie Fonctionnelle Insectes et Interactions, F-69621 Villeurbanne, France

    Carole Vincent-Monegat

    1 Université de Lyon, INRA, INSA-Lyon, IFR-41, UMI Фон ctionnelle Insectes et Interactions, F-69621 Villeurbanne, France

    Delphine Charif

    3 UMR CNRS 5558 Laboratoire de Biométrie et Biologie Evolutive, Université Claude Bernard Lyon, F-69621 Villeurbanner , Франция Institut Cavanilles de Biodiversitat i Biologia Evolutiva, Universitat de València, Apartado de Correos 22085, 46071 Valencia, Spain

    Andrés Moya

    2 Institut Cavanilles de Biodiversitat i Biologia Evolutiva, Apartado de Correos 22071, Apartado de Correos 22071 Испания

    Abdelaziz Heddi

    1 Université de Lyon, INRA, INSA-Lyon, IFR-41, UMR203 BF2I, Biologie Fonctionnelle Insectes et Interactions, F-69621 Villeurbanne, France

    1 Université de Lyon INSA-Lyon, IFR-41, UMR203 BF2I, Biologie Fonctionnelle Insectes et Interactions, F-69621 Villeurbanne, France

    2 Institut Cavanilles de Biodiversitat i Biologia Evolutiva, Universitat de València, Apartado de Correos 22085, 46071 Валенсия, Испания

    3 UMR CNRS 5558 Laboratoire de Biométrie et Biologie Evolutive, Universitat de Biométrie et Biologie Evolutive, Universitat de la Villeon 9, Франция-Лион, 69000, Франция, Лайон-де-Вильон, 69000, Франция, Лион, Франция, 9 Автор, ответственный за переписку.

    Поступило 21 января 2008 г .; Принято 16 октября 2008 г.

    Copyright © 2008 Anselme et al; лицензиат BioMed Central Ltd.

    Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе. при условии правильного цитирования оригинала.

    Эта статья цитируется в других статьях в PMC.
    Дополнительные материалы

    Дополнительный файл 1 Характеристики EST из вычтенной библиотеки с гомологией с иммунными генами.

    GUID: CDE1D333-3E44-464A-9885-B3BB94318FBD

    Дополнительный файл 2 Праймеры, используемые для 3′- и 5′-RACE (GSP1 и GSP2 соответственно) и qRT-PCR.

    GUID: EA8A95AA-033A-4DF5-A529-8A15595E9A78

    Реферат

    Предпосылки

    Стойкие инфекции, вызываемые мутуалистическими внутриклеточными бактериями (эндосимбионтами), широко представлены у насекомых и считаются движущей силой эволюции. Однако, хотя патогенные отношения были хорошо изучены за последние десятилетия, очень мало известно о распознавании эндосимбионтов иммунной системой хозяина и механизме, ограничивающем их инфекцию тканью хозяина, несущей бактерии (бактериом).

    Результаты

    Для изучения иммунной специфичности бактериома мы сначала идентифицировали иммунные гены долгоносика Sitophilus zeamais с помощью супрессивной субтрактивной гибридизации (SSH), а затем проанализировали их полноразмерные кодирующие последовательности, полученные с помощью экспериментов RACE-PCR. Затем мы измерили экспрессию иммунного гена в бактериоме и в апосимбиотических личинках после инъекции первичного эндосимбионта S. zeamais (SZPE) в гемолимфу, чтобы рассмотреть вопросы иммунной специфичности бактериома и гуморального ответа насекомых на симбионтов.Мы показываем, что заражение личинок эндосимбионтом приводит к значительной индукции антибактериальных пептидных генов, что свидетельствует о том, что вне бактериома SZPE распознаются хозяином как микробные вторжения. В бактериоме анализ экспрессии генов показывает сверхэкспрессию одного антибактериального пептида из семейства колеоптерицина и, что интересно, гомологи генов, описываемых как иммуномодуляторы (то есть, PGRP-LB, Tollip ) также показали высокую экспрессию. в бактериоме.

    Заключение

    Текущие данные дают первое описание экспрессии иммунных генов в бактериоме насекомых. По сравнению с гуморальным ответом насекомых на SZPE, бактериом экспрессирует несколько генов среди исследованных в этой работе. Эта локальная экспрессия иммунного гена может помочь поддерживать эндосимбионт в бактериоме и предотвратить его вторжение в ткани насекомых. Дальнейшие исследования генов колеоптерицина , PGRP и Tollip должны пролить свет на роль иммунной системы хозяина в поддержании и регуляции эндосимбиоза.

    Предпосылки

    Хронические бактериальные инфекции широко распространены в природе и проявляют широкий спектр взаимодействий со своим хозяином, от мутуализма до паразитизма. У насекомых симбиотические внутриклеточные бактерии (эндосимбионты) глубоко интегрированы в биологию и развитие клетки-хозяина, поскольку они передаются по материнской линии через сотни поколений хозяев, и на ранних этапах эмбриогенеза насекомых они вторгаются в специализированные клетки-хозяева, называемые бактериоцитами, которые иногда образуют специфический орган. бактериом [1-3].Физиологические и молекулярные исследования предоставили доказательства того, что эндосимбионты снабжают рацион своего хозяина ограниченными питательными веществами, тем самым улучшая свою инвазивную способность и их способность оседать на бедных питательными веществами источниках и средах обитания, таких как кровь ( Glossina , Rhodnius ), сок растений ( тли, псиллиды, белокрылки, мучнистые червецы) и зерновых культур ( Sitophilus ) [2,4].

    Однако, хотя физиологические и эволюционные аспекты эндосимбиоза насекомых были тщательно исследованы за последние два десятилетия, очень мало известно о молекулярных механизмах, которые позволяют установить, а затем поддерживать и регулировать такие полезные взаимодействия.Один поразительный вопрос касается взаимодействия между бактериями и врожденной иммунной системой хозяина — области, которая относительно хорошо изучена в отношении патогенных взаимоотношений по сравнению с мутуалистическими ассоциациями, которые недавно были изучены лишь в нескольких системах [5-8].

    Чтобы бороться с инфекцией, насекомые полагаются на множественные врожденные защитные реакции. Иммунитет насекомых включает физические барьеры, а также местные и системные иммунные ответы, включающие как клеточные, так и гуморальные пути (см. Обзор [9]).Активация гуморального пути состоит из ассоциированного с микробами распознавания молекулярного паттерна рецепторами распознавания паттерна, такими как белки распознавания пептидогликана (PGRP), и активации внутриклеточных сигнальных путей, таких как Toll и пути иммунодефицита (Imd). Эти пути активируют, в частности, продукцию и секрецию группы антимикробных пептидов (AMP) в ответ на грамположительные и грамотрицательные бактерии. Помимо продукции AMP, гуморальный ответ насекомых также включает протеолитический каскад, ведущий к активации пропенолоксидазы (PPO) и последующему синтезу меланина в месте повреждения кутикулы.Эта реакция, называемая меланизацией, играет ключевую роль в заживлении ран, инкапсуляции, секвестрации микробов и производстве токсичных промежуточных продуктов [10]. В то время как системный ответ является наиболее изученным путем среди иммунных реакций, только недавно было показано, что местный иммунный ответ (также известный как эпителиальный иммунитет) вносит значительный вклад в защиту от вторжения микроорганизмов в пищеварительный тракт и трахеи. Например, в кишечнике происходит индуцируемое местное производство AMP.Этот ответ запускается при естественном инфицировании грамотрицательными бактериями и опосредуется путем Imd [11]. Эпителий кишечника также экспрессирует амидазу PGRP. Было показано, что эти PGRP, которые поглощают пептидогликан, высвобождаемый комменсальными бактериями, снижают иммунную реактивность кишечника и предотвращают состояние постоянной иммунной активации в этой ткани [12,13].

    В предыдущей работе по мутуалистическому взаимодействию между долгоносиком Sitophilus zeamais и γ-протеобактериями под названием S.zeamais первичный эндосимбионт (SZPE) (см. [14] обзор модели), мы обнаружили сверхэкспрессию члена семейства гена PGRP в бактериомной ткани хозяина [15,16]. Мы показали, что wPGRP индуцируется после бактериального заражения и что экспрессия гена wPGRP зависит от роста бактерий. Более того, мы показали, что ген wPGRP индуцировался одновременно с высвобождением эндосимбионта из бактериоцитов во время нимфоза, демонстрируя, что семейство генов PGRP участвует во взаимодействии хозяин-симбионт [16].

    Это исследование было посвящено расширению панели иммунных генов насекомых, участвующих во взаимодействии хозяин-симбионт. Сначала мы идентифицировали иммунно-релевантные гены хозяина с помощью супрессивной субтрактивной гибридизации (SSH) и проанализировали in silico, их полноразмерные кодирующие последовательности, завершенные с помощью RACE-PCR. Затем мы измерили их стационарные уровни у апосимбиотических личинок, зараженных SZPE, и в клетках бактериоцитов естественно инфицированных личинок. Мы показываем, что экспериментальное заражение личинок SZPE приводит к значительной индукции AMP и что в ткани бактериома накапливаются лишь немногие транскрипты иммунных генов, включая гомологи антибактериального пептида и иммуномодуляторы.Эти данные показывают, что эндосимбионты воспринимаются как нарушители, пока присутствуют в гемолимфе, и что в бактериоме существует локальная экспрессия иммунного гена. Это исследование является первым показателем того, как насекомые могут поддерживать эндосимбионтов внутри бактериома и предотвращать их вторжение в ткани насекомых.

    Результаты

    Идентификация иммунных генов в

    Sitophilus zeamais

    Поскольку геном Sitophilus не был секвенирован, мы применили технологию SSH к кДНК из E.coli -инфицированных личинок и кДНК от наивных личинок для идентификации иммунных генов, представляющих интерес для данной работы. Для получения генов, экспрессируемых на разных фазах иммунного ответа, три образца РНК были извлечены через 3, 6 и 12 часов после заражения Escherichia coli и смешаны перед синтезом кДНК. Мы секвенировали 485 экспрессируемых тегов последовательностей (EST) из выделенной библиотеки. После анализа качества, обрезки и переваривания химерных последовательностей (см. «Материалы и методы» ) мы собрали 475 последовательностей в 273 предполагаемых транскрипта, состоящих из 62 контигов и 211 синглетонов (таблица).

    Таблица 1

    Общие характеристики Sitophilus zeamais EST в результате супрессивной субтрактивной гибридизации между E. coli -инфицированными и наивными личинками

    Всего

    2 проанализированных кДНК 9019 2 902 902 2 2
    902 902 902 902 902 902 902 3 Рост 22902 9066 9066 906 локализация
    Общее количество считываний кДНК
    475

    Средняя длина EST (п.о.) 373

    9068

    Количество EST в контигах 264

    Количество контигов 62

    9066 902 902 2 902 902 консенсуса 273 9 0268

    Избыточность b 55%

    Количество контигов, содержащих

    От 5 до 10 EST 8

    > 10 EST 5

    902 902
    9026 902 902 902
    Нет Uniprot c попаданий 17%

    Нет назначения GO 37%
    GO Biological Process (Уровень 2) 902 con689
    Репродукция 90 162 2

    Процесс иммунной системы 6

    Процесс обмена 71

    Вирусное размножение 2

    Репродуктивный процесс

    Многоклеточный организменный процесс 4

    Процесс развития
    1

    Реакция на стимул 13

    26

    Процесс нескольких организмов 1

    Биологическая регуляция продуктов EST, мы сравнили полученные 273 последовательности с базами данных UniProt и классифицировали их, используя схему Gene Ontology (GO).Кроме того, мы создали базу данных, в которой можно найти все EST и полный список совпадений BlastX, а также их функциональную классификацию. Из этих 273 последовательностей 83% успешно совпали с базой данных UniProt, а 63% были функционально классифицированы (таблица). Что касается иммунных генов, около 12% EST имеют сходство с транскриптами, которые, как известно, кодируют белки, участвующие в иммунной функции. В соответствии с идентичностью последовательностей некоторые EST показали лишь слабое сходство с антибактериальными пептидами, такими как диптерицин A, цекропин A1, саркотоксин II-1 и люксуриозин.Тем не менее, учитывая их высокую избыточность (12, 4, 15 и 4 копии соответственно), мы включили их в это исследование. Кроме того, анализ последовательности EST, сходных с диптерицином, тенецином и люксуриоцином, выявил различные изоформы этих пептидов (см. Дополнительный файл 1). Однако из-за высокой идентичности последовательностей ДНК и белков (от 76% до 97% и от 91% до 100% соответственно) в этой работе мы проанализировали только одну изоформу каждого семейства генов.

    Анализ полноразмерной кДНК иммунных генов, полученной с помощью RACE-PCR

    Для улучшения сходства последовательностей мы применили технологию RACE-PCR и секвенировали полные последовательности кДНК EST (по одному EST для каждого кластера) со сходством с антибактериальными пептиды, лизоцимы, PGRP и Tollip (рисунок).Мы также проанализировали последовательности кДНК in silico для идентификации консервативных белковых доменов и прогнозирования клеточной локализации пептидов и белков.

    Схематические изображения предполагаемых белков Sitophilus zeamais , сходных с антибактериальными пептидами, лизоцимами, PGRP и Tollip . Для каждого гена полную последовательность кДНК получали из соответствующего EST с помощью RACE-PCR и затем подтверждали амплификацией всей кДНК и секвенированием.Для каждой кДНК ORF была предсказана с использованием программного пакета MacMolly. Верхняя шкала показывает длину различных доменов белков (аминокислотных остатков). Черные области указывают на предсказанный сигнальный пептид (TargetP), а серые области — на предполагаемый пропептидный домен в соответствии с консервативным мотивом R-x- (K / R) -R. mcs: минимальный сайт расщепления, соответствующий мотиву R-x-x-R с дополнительным аргинином в положении P6, который может усиливать расщепление. Области, похожие на консервативные домены, обнаруженные с помощью InterProScan, обозначены заштрихованными областями с соответствующим значением E.Колеоптерицин, IPR009382; Дефенсин, IPR001542; Куниц, IPR002223; Лизоцим, IPR000974; Дестабилаза, IPR008597; ПГРП, ИПР002502; C2, IPR000008; CUE, IPR003892. Номера доступа полных кодирующих последовательностей: INF-18, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «EU282111», «term_id»: «167444199», «term_text»: «EU282111»}} EU282111; INF-145, {«тип»: «энтрез-нуклеотид», «attrs»: {«текст»: «EU282117», «term_id»: «167444211», «term_text»: «EU282117»}} EU282117; INF-42, {«тип»: «энтрез-нуклеотид», «attrs»: {«текст»: «EU282112», «term_id»: «167444201», «term_text»: «EU282112»}} EU282112; INF-163, {«тип»: «энтрез-нуклеотид», «attrs»: {«текст»: «EU282118», «term_id»: «167444213», «term_text»: «EU282118»}} EU282118; INF-165, {«тип»: «энтрез-нуклеотид», «attrs»: {«текст»: «EU282113», «term_id»: «167444203», «term_text»: «EU282113»}} EU282113; INF-479, {«тип»: «энтрез-нуклеотид», «attrs»: {«текст»: «EU282119», «term_id»: «167444215», «term_text»: «EU282119»}} EU282119; INF-217, {«тип»: «энтрез-нуклеотид», «attrs»: {«текст»: «EU282115», «term_id»: «167444207», «term_text»: «EU282115»}} EU282115; INF-282, {«тип»: «энтрез-нуклеотид», «attrs»: {«текст»: «EU282114», «term_id»: «167444205», «term_text»: «EU282114»}} EU282114; INF-152, {«тип»: «энтрез-нуклеотид», «attrs»: {«текст»: «EU282120», «term_id»: «167444217», «term_text»: «EU282120»}} EU282120; INF-441, {«тип»: «энтрез-нуклеотид», «attrs»: {«текст»: «EU282121», «term_id»: «167444219», «term_text»: «EU282121»}} EU282121; INF-9, {«тип»: «энтрез-нуклеотид», «attrs»: {«текст»: «EU282122», «term_id»: «167444221», «term_text»: «EU282122»}} EU282122; INF-359, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «EU282116», «term_id»: «167444209», «term_text»: «EU282116»}} EU282116.

    Противомикробные пептиды

    AMP обычно содержат менее 100 аминокислотных остатков, разделенных в большинстве случаев на три домена: сигнальный пептид, пропептид (мотивы R-x- (K / R) -R) и зрелый пептид. Первые два домена протеолитически расщепляются с высвобождением зрелого пептида, активного против бактерий [17-19].

    Сигнальный пептид и мотив Rx- (K / R) -R были предсказаны для всех предполагаемых антибактериальных пептидов S. zeamais , за исключением INF-163 и INF-479, для которых является только сигнальный пептид. надежно предсказан (рисунок).По сходству белков мы подтвердили идентификацию двух AMP (INF-18 и INF-145, идентичность 40%), принадлежащих к семейству колеоптерицинов, дефенсина с последовательностью идентичности 66% (32/48) тененину (INF-217). ), и гомолог люксуриозина, AMP, характеризующийся доменом Куница [20], с идентичностью последовательностей 42% (45/106). Для EST INF-42, INF-163 и INF-165 полноразмерные транскрипты все еще демонстрируют слабое сходство с AMP, и для предполагаемых пептидов не было идентифицировано характерного домена, который нельзя рассматривать как антибактериальные пептиды без дальнейшего анализа (рисунок) .

    Лизоцимы

    Лизоцимы — широко распространенные ферменты, характеризующиеся их способностью расщеплять бактериальные пептидогликаны. Среди лизоцимов было описано несколько типов в соответствии с геномной структурой и филогенетическими данными: c (курица), g (гусь), i (беспозвоночные), фаговые, бактерии и типы растений [21]. Здесь, в соответствии с гомологией последовательностей, мы идентифицировали два лизоцима: i-тип (INF-152), с доменом, связанным с дестабилазой, идентифицированным в лизоциме i-типа из пиявки [22], и лизоцим c-типа ( INF-282) с характерным лизоцимным доменом.Оба белка имеют предсказанный сигнальный пептид.

    PGRP

    Два транскрипта PGRP были идентифицированы в вычтенной библиотеке. Один EST (INF-9) соответствует ранее идентифицированному гену wPGRP [15,16], тогда как EST INF-441 является дополнительным геном долгоносика PGRP . Эти два гена будут обозначаться как wPGRP1 и wPGRP2 соответственно. Анализ продукта RACE-PCR показал, что два белка wPGRP имеют 30% идентичность и оба имеют консервативные остатки, необходимые для активности амидазы [23].Согласно анализу in silico , wPGRP1 может быть внутриклеточной амидазой, тогда как wPGRP2 может секретироваться в гемолимфе.

    Tollip (белок, взаимодействующий с Toll)

    Среди EST вычтенной библиотеки мы обнаружили последовательность (INF-359), гомологичную Tollip, регулятору пути Toll-подобных рецепторов, описанному у млекопитающих [24-26]. Анализ продукта RACE-PCR подтвердил гомологию с генами млекопитающих, поскольку предсказанный белок S. zeamais имеет 46% идентичности (127/275) с белком Tollip из Mus musculus .

    Анализ экспрессии генов после стерильного или септического повреждения апосимбиотических личинок долгоносика

    Для определения генов, индуцированных ранением (эффект укола), и генов, специфически индуцированных бактериальным заражением, с помощью qRT-PCR мы сравнили уровни транскриптов в апосимбиотических личинках после стерильных и гнойное поражение и у наивных апосимбиотических личинок, взятых в качестве контроля (таблица).

    Таблица 2

    Иммуно-связанные EST и сравнение экспрессии генов между наивными личинками, ложно инфицированными личинками и личинками, зараженными Escherichia coli .

    2 INF-145 9132 9132 904 904 9126 9126 904 904 9126 2
    LL INF-902 926 9 15 902 10xt 9027a Суммарный тест согласно Wall большинство генов со сходной последовательностью с AMP сильно индуцируются (от 30 до 300 раз) после инфицирования E. coli , включая гены без какого-либо значимого антибактериального домена (таблица и рисунок). Некоторые пептидные гены, такие как INF-18, INF-42 и INF-217, также слегка индуцируются (в 10 раз) после стерильного повреждения.INF-479, гомолог люксуриозина , является единственным пептидным геном, индуцированным после стерильного повреждения, но не в ответ на заражение E. coli . Наконец, оба гена лизоцима (INF-152 и INF-282) индуцируются после стерильного повреждения независимо от бактериальной инфекции.

    Данные qRT-PCR показывают, что оба гена wPGRP активированы. Однако, в то время как wPGRP1 (INF-9) слабо индуцируется повреждением (в 2,3 раза) и сильнее индуцируется после инфицирования E. coli (6.7-кратно), wPGRP2 (INF-441) индуцируется только стерильным повреждением (от 7,8 до 11,6 раза).

    В качестве регуляторов мы количественно оценили экспрессию генов, сходных с протеазами и ингибиторами протеаз, в дополнение к гену Tollip . Было показано, что ген Tollip (INF-359) и два гена, сходных с протеиназами (INF-459 и INF-515), экспрессируются конститутивно. Все остальные гены были индуцированы после стерильного повреждения, за исключением богатого цистеином гомолога ядовитой протеиназы (INF-91), который был индуцирован после заражения E.coli . Однако отсутствуют данные о функции этого белка, идентифицированного в слюнной железе Aedes albopictus .

    В дополнение к генам гуморального иммунного ответа мы количественно определили два гена цитоскелета, поскольку участие актиновых белков регуляции цитоскелета в врожденном иммунитете было установлено с помощью функционального геномного анализа фагоцитоза [27]. Однако не наблюдалось изменений в уровнях транскрипта ни для гена актина, , ни для гомолога профилина , регулятора полимеризации актина (INF-13).

    Анализ экспрессии генов у апосимбиотических личинок, зараженных SZPE

    Для изучения иммунного ответа на SZPE, присутствующего в личиночной гемолимфе, мы количественно определили уровни транскриптов генов у апосимбиотических личинок после инъекции SZPE. Зная, что SZPE не может делить in vitro , мы вводили приблизительно 1 × 10 5 жизнеспособных или убитых нагреванием SZPE (рисунок), количество E. coli , необходимое для индукции иммунного ответа (данные не показаны).

    Анализ экспрессии иммунных генов у апосимбиотических личинок, зараженных первичным эндосимбионтом Sitophilus zeamais .Транскрипт генов, индуцированных заражением E. coli , количественно оценивали с помощью qRT-PCR у необработанных апосимбиотических личинок (контроль) и у личинок через шесть часов после инъекции 69 мкл либо стерильной воды (стерильные), либо клеток SZPE (убитых нагреванием или жизнеспособный), полученный из 50 бактериомов, выделенных из симбиотических личинок четвертого возраста. EST были классифицированы по сходству последовательностей, как в таблице. Каждая полоса представляет собой среднее значение трех независимых измерений со стандартной ошибкой.

    Не было показано значительных различий между инъекциями воды и симбионта для wPGRP1 (INF-9), тогда как все гены со сходной последовательностью с AMP были достоверно индуцированы симбионтом.Более того, было показано, что убитая нагреванием E. coli вызывает более слабый иммунный ответ, чем необработанная E. coli (данные не показаны), возможно потому, что рост и деление бактерий у личинок может привести к увеличению плотности бактерий, а затем в более сильном иммунном ответе [16]. В отличие от E. coli , не было обнаружено различий между личинками, которым инъецировали жизнеспособный или убитый нагреванием SZPE, что согласуется с отсутствием пролиферации симбионтов в гемоцеле.

    Анализ экспрессии генов в личиночном бактериоме

    Поскольку бактериом не может развиваться в отсутствие эндосимбионтов, профиль экспрессии иммунного гена исследовали в бактериоме и сравнивали со средними уровнями транскриптов из цельных апосимбиотических тканей личинки.Как показано на рисунке, большинство генов, сверхэкспрессируемых у личинок, инфицированных E. coli (таблица) или SZPE (рисунок), были слабо (или не экспрессировались вообще) в бактериоме, за исключением двух генов: wPGRP1 Ген (INF-9; 39-кратный) и один из двух генов колеоптерицина (INF-18; 10-кратный). Интересно, что этот эксперимент также выявил высокий уровень экспрессии гена Tollip (INF-359; 5-кратный) в ткани бактериома. Более того, было показано, что гены, кодирующие цитоскелет, значительно недоэкспрессируются в бактериоме.Транскрипты актина были в 800 раз меньше представлены в бактериоме по сравнению с целыми апосимбиотическими личинками. Хотя описано множество случаев манипулирования цитоскелетом хозяина бактериями [28,29], мы не можем исключить возможность того, что разница в уровнях транскрипции актина между бактериомом и личинками обусловлена ​​высоким содержанием мышечного актина у личинок. Точно так же изобилие (или отсутствие) продуктов определенных генов в основных тканях (например, изобилие лизоцима в кишечнике и слюнных железах) может создавать очевидную недостаточную (или избыточную) экспрессию в бактериоме, и для таких генов эти результаты следует учитывать. с осторожностью.Однако стоит отметить, что сравнения профилей экспрессии бактериоцитов и всего тела дали ранее значимые результаты [15,30].

    Анализ экспрессии генов в ткани бактериома . Как описано в «Материалы и методы» , транскрипты генов-кандидатов количественно оценивали с помощью qRT-PCR у целых апосимбиотических личинок четвертого возраста (контроль) и в бактериомах, выделенных от симбиотических личинок четвертого возраста. EST были классифицированы по сходству последовательностей, как в таблице.Каждая полоса представляет собой среднее значение трех независимых измерений со стандартной ошибкой. Звездочка представляет собой значимое ( p <0,05) различие между бактериомом и контролем, а значительная высокая экспрессия в бактериоме указана стрелкой. ND, не определено.

    Обсуждение

    Имеются убедительные доказательства того, что внутриклеточные бактериальные инфекции могут устанавливать хронические несептические отношения с клетками-хозяевами на протяжении многих поколений. Некоторые бактерии (например, Chlamydophila и Salmonella ) проникают и быстро размножаются в своем хозяине, вызывая заболевания, в то время как другие (например, Mycobacterium tuberculosis ) остаются латентными и могут реактивироваться через месяцы или годы после первоначального воздействия, вызывая хронические заболевания. болезнь [31].В мире насекомых некоторые внутриклеточные бактерии могут создавать долгосрочные отношения внутри хозяина, не вызывая каких-либо заболеваний или вторгаясь в какие-либо ткани хозяина, кроме половых клеток и бактериоцитов. Сверхэкспрессия гена wPGRP1 в бактериоме долгоносика предполагает тесное взаимодействие между иммунной системой хозяина и эндосимбионтами.

    Чтобы определить, как иммунная система насекомых распознает бактерии и предотвращает бактериальное вторжение в ткани насекомых, мы сначала идентифицировали с помощью технологии SSH иммунные гены, индуцированные у насекомых, зараженных E.coli . Биоинформатический анализ показал относительно высокую долю EST, сходных с иммунными генами, включая несколько антибактериальных пептидов, лизоцимов, PGRP, и белки пути PPO (таблица), что подчеркивает эффективность субтрактивного подхода. Дальнейший анализ in silico полноразмерных кодирующих последовательностей подтвердил идентификацию гена лизоцима i-типа и c-типа (INF-152, INF-282) и по меньшей мере четырех генов антибактериальных пептидов: двух членов колеоптерицина. семейство (INF-18, INF-145), дефенсин (INF-217) и гомолог люксуриозина (INF-479), антимикробный пептид из Acalolepta luxuriosa [20].Мы также проверили гомолог Tollip , гена, который до сих пор изучался только у млекопитающих, который, по-видимому, отсутствует в геноме Drosophila , и ген PGRP ( wPGRP2 , INF-441) в дополнение к ранее описанному. описан ( ген wPGRP1, , INF-9). Профиль экспрессии всех предполагаемых иммунных генов затем охарактеризовали с помощью экспериментов с заражением личинок в сочетании с количественной оценкой транскриптов ОТ-ПЦР (таблица). Таким образом, мы продемонстрировали, что все изученные гены были индуцибельными, за исключением гомологов Tollip (INF-359) и протеиназы гемолимфы 17 (INF-459), которые, по-видимому, являются конститутивными.

    Чтобы выяснить конкретные иммунные особенности бактериома, мы сначала исследовали системный ответ хозяина после инъекции апосимбиотическим личинкам SZPE (рисунок), а затем мы измерили экспрессию иммунного гена в бактериоме естественно инфицированных личинок (рисунок). Экспериментальное инфицирование личинок привело к системному иммунному ответу с активизацией всех генов, сходных с AMP, что свидетельствует о том, что SZPE распознается как микробный нарушитель, находясь в гемолимфе.Примечательно, что в отличие от SZPE, Spiroplasma не индуцирует транскрипты хозяина, кодирующие AMP, у Drosophila , пока они присутствуют в гемолимфе. Однако отсутствие структуры бактериальной клеточной стенки у Spiroplasma , вероятно, является лучшим объяснением очевидного отсутствия гуморального ответа хозяина на эту бактерию [32].

    У симбиотических личинок долгоносика, помимо гена wPGRP1 , в бактериоме сверхэкспрессируется один антибактериальный пептид, индуцированный бактериальным заражением (то есть ген колеоптерицина ).Эти данные подтверждают наличие иммунного ответа в ткани бактериома и предоставляют первые элементы, объясняющие, как ассоциация хозяин-эндосимбионт может сохраняться в отношении иммунной системы хозяина и размножения бактерий.

    Поскольку все гены AMP активируются после заражения гемолимфы SZPE, уникальная сверхэкспрессия гена колеоптерицина в бактериоме предполагает конститутивную экспрессию в этой ткани, а не индукцию SZPE, если только регуляция гена колеоптерицина не включает отдельный путь от тех, которые запускают синтез других AMP.Мы можем только строить догадки по этому поводу, поскольку сравнение бактериоцитов, полных симбионтов, и бактериоцитов, свободных от симбионтов, невозможно, так как до сих пор не было обнаружено бактериомов, свободных от симбионтов, у апосимбиотических насекомых Sitophilus . Принимая во внимание, что некоторые АМП конститутивно экспрессируются в клетках, потенциально находящихся в контакте с окружающей средой [11,33,34], и что ген колеоптерицина кодирует сигнальный пептид, эти данные предполагают, что ген колеоптерицина экспрессируется конститутивно и секретируется вне бактериоцитов.Колеоптерицин в настоящее время исследуется, чтобы определить, может ли этот пептид предотвратить инвазию эндосимбионта в ткань хозяина и / или может защитить популяцию эндосимбионтов от заражения бактериями окружающей среды, поскольку ткань бактериома тесно связана с передней кишкой насекомого. Более того, другой интересной задачей было бы изучить, может ли экспрессия колептерицина в бактериоме защитить хозяина от патогенов. Это может быть дополнительным примером «защиты, опосредованной симбионтами» [35].

    Хотя отсутствие гуморального иммунного ответа хозяина на внутриклеточный симбионт и конститутивная экспрессия колеоптерицина в бактериоме согласуются с современными знаниями об иммунном ответе насекомых, сверхэкспрессия гомологов гена PGRP-LB (что is, wPGRP1 ) и Tollip довольно интригующе. Было показано, что ингибирование гена PGRP-LB у Drosophila приводит к значительной индукции антибактериальных пептидов [13], тогда как Tollip считается негативным регулятором иммунного ответа млекопитающих [24,25].Более того, эти два гена сверхэкспрессируются в эпителии кишечника и, как предполагается, играют роль в контроле иммунной реактивности хозяина к присутствию бактерий в кишечнике. Следовательно, сверхэкспрессия этих двух генов в бактериоме может соответствовать иммунной модуляции, которая ингибирует продукцию AMP в этом органе, как это было описано в эпителии кишечника. Вместе со сверхэкспрессией AMP (то есть колеоптерицина ) эти результаты раскрывают поразительное сходство между иммунным профилем бактериома и локальным иммунным ответом в эпителии кишечника, который находится в постоянном контакте с комменсальными и мутуалистическими бактериями [9,11,13 , 33,36,37].В настоящее время разрабатывается исследование сайленсинга гена у долгоносика для подтверждения функции гена колеоптерицина , wPGRP1 и Tollip и их вклада в поддержание симбиоза.

    Примечательно, что эта работа была выполнена на недавно установленном симбиозе, где, в отличие от древних симбиотических ассоциаций, известных резким уменьшением размера генома эндосимбионтов, таких как ассоциация тли / Buchnera [38], SZPE демонстрирует сходные черты с таковыми. свободноживущих грамотрицательных бактерий [39–43].Следовательно, вопрос о том, развивается ли иммунный ответ хозяина параллельно с редукцией генома симбионта и каким образом, составляет ключевой аспект в понимании взаимодействия между хозяином и симбионтом в ходе эволюции. Недавно было проведено транскриптомное исследование бактериоцитов тли с целью выявления представляющего интерес гена во внутриклеточном симбиозе [30]. Интересно, что в бактериоцитах тли не экспрессируется гомолог каких-либо известных иммунных генов, за исключением лизоцимов i-типа, функция которых в бактериоцитах остается неизвестной.Поскольку было показано, что лизоцимы долгоносиков i-типа и c-типа слабо экспрессируются в бактериоцитах, эти данные позволяют предположить, что иммунный профиль бактериоцитов мог развиваться вместе с бактериальной коэволюцией с хозяином, за исключением иммунного ответа долгоносиков (голометаболических насекомых). значительно отличается от тлей (гетерометаболических насекомых).

    Какими бы ни были противомикробные эффекторы (то есть антибактериальные пептиды, лизоцим), их постоянная экспрессия в бактериоцитах может представлять собой общий механизм ограничения локализации мутуалистических симбионтов, что, вероятно, необходимо для оптимизации взаимодействия между хозяином и симбионтом.Без этого ограничения внутриклеточные симбиотические бактерии могут вторгаться во весь организм, не вызывая синтеза антибактериальных пептидов, как было показано на примере Drosophila , инфицированного Wolbachia , паразитическим симбионтом, широко распространенным в тканях хозяина [44].

    Заключение

    Эта работа обеспечивает первый профиль экспрессии иммунных генов в бактериоме насекомых и выявляет сверхэкспрессию по крайней мере трех гомологов иммунных генов: члена семейства PGRP, гена, участвующего в распознавании бактерий, антибактериального пептида, участвующего в бактериальный клиренс и ген, участвующий в иммуномодуляции у млекопитающих.Этот иммунный профиль обнаруживает поразительное сходство между бактериомом и эпителием кишечника, который находится в постоянном контакте с бактериями окружающей среды. Принимая во внимание, что эндосимбионт распознается как нарушитель гемолимфы хозяина, эти результаты также указывают на то, что иммунная система хозяина может предотвращать инвазию эндосимбионтов в ткани насекомых аналогично локальному иммунному ответу кишечника, который помогает ограничивать микробиоту тканями насекомых. кишечника, избегая постоянной системной реакции на комменсальные бактерии.

    Методы

    Выращивание насекомых

    Насекомых из моносимбиотического штамма SZPE ( S. zeamais Lagoa) и из соответствующего апосимбиотического штамма выращивали и собирали, как описано в Anselme et al. [16].

    Бактериальное заражение

    Апосимбиотических личинок четвертого возраста заражали путем укола стерильными заостренными иглами (имитация инфекции) или иглами, предварительно погруженными в осадок из E. coli (TOP10, Invitrogen) в течение ночи с культурами, и держали во влажном Атмосфера на 27.5 ° C в течение 3, 6 и 12 часов. Живые личинки хранили при -80 ° C для приготовления РНК. Незараженные личинки (наивные личинки) обрабатывали параллельно в качестве контроля.

    Для изучения иммунного ответа хозяина на SZPE личинкам вводили 69 нл стерильной воды или бактериального раствора, содержащего приблизительно 1 × 10 5 жизнеспособных или убитых нагреванием (5 мин при 95 ° C) бактериальных клеток. Раствор SZPE был свежеприготовлен из бактериомов личинок четвертого возраста. Пятьдесят бактерий препарировали в буфере А (25 мМ KCl, 10 мМ MgCl 2 , 250 мМ сахароза, 35 мМ Трис-HCl, pH 7.5), переносили в тефлоновый гомогенизатор Dounce и осторожно измельчали ​​в буфере А. После удаления клеточного дебриса низкоскоростным центрифугированием (400 g, 10 мин) бактерии осаждали (10000 g, 5 мин) и ресуспендировали до концентрации приблизительно 1,45 × 10 6 бактерий / мкл в буфере A.

    Выделение общей РНК

    Суммарную РНК из инфицированных и наивных личинок экстрагировали с использованием реагента TRIzol ® (Invitrogen), обработанного ДНКазой, не содержащей РНКаз (Promega), и очищены с помощью колонок мини-набора RNeasy (Qiagen), как описано в процедурах производителя.После очистки концентрацию РНК в каждом образце измеряли спектрофотометром Nanodrop ® , а качество общей РНК проверяли электрофорезом.

    Подавление субтрактивной гибридизации

    Мы применили технологию SSH, используя набор для вычитания кДНК, отобранных методом ПЦР (лаборатории Clontech). Для синтеза кДНК из инфицированных личинок E. coli , используемых в качестве тестера, три образца РНК были извлечены через 3, 6 и 12 часов после заражения и смешаны перед синтезом кДНК.

    Вкратце, синтез кДНК проводили на аликвоте 1 мкг из смеси 1 мкг каждого образца инфицированной РНК для тестера и из РНК наивных личинок для драйвера (набор для синтеза кДНК SMART PCR, лаборатории Clontech). После очистки фенол-хлороформ инфицированную кДНК личинки переваривали с помощью RsaI, лигировали с двумя адаптерами отдельно (1 и 2R), затем гибридизовали с кДНК наивной личинки, переваренной с помощью RsaI. После гибридизации вычтенные кДНК амплифицировали с помощью ПЦР в соответствии с инструкциями производителя (Clontech, набор для вычитания кДНК).Амплифицированные продукты непосредственно клонировали в плазмиду pCR 2.1-TOPO (Invitrogen).

    Секвенирование клонов, поиск гомологии Blast и присвоение GO

    После трансформации электропорацией из чашек с агаром Luria Broth было выделено около 500 колоний. Их подвергали экстракции плазмид (NucleoSpin ® Plasmid Kit, Macherey-Nagel) и секвенировали в Institut Cavanilles de Biodiversitat i Biologia Evolutiva (Валенсия, Испания). Доступные 485 последовательностей были обрезаны с помощью SeqClean http: // compbio.dfci.harvard.edu/tgi/software/ для удаления фланкирующих векторных последовательностей, адаптеров (совпадение по крайней мере с 98% идентичностью по крайней мере по 11 парам оснований) и поли (A / T) хвостов, а оставшиеся последовательности короче 60 пар оснований были отброшен. Поскольку построение библиотеки с вычитанием включает этап переваривания RsaI и лигирования адаптера, где химерная кДНК может быть сформирована путем лигирования кДНК, мы проверили сайты RsaI в EST и отбросили химеры из нашего набора данных.

    Оставшиеся последовательности были кластеризованы с использованием программы сборки TGICL [45], и консенсусные последовательности были сохранены для вычтенной библиотеки.Затем все последовательности (консенсусные и одиночные) сравнивали с UniProt с помощью BlastX. Для задания GO мы сохранили первое попадание по крайней мере с одной аннотацией GO среди пяти лучших совпадений. Затем результаты аннотации GO были классифицированы с использованием WEGO [46].

    Секвенирование иммуно-релевантной полноразмерной кДНК

    Полные последовательности интересующих транскриптов были получены с помощью 3 ‘и 5’ RACE, выполненного с помощью набора для амплификации кДНК SMART RACE, включая набор для ПЦР Advantage II (Clontech Laboratories).Для каждого гена нуклеотидные последовательности 3 ‘и / или 5’ праймеров (GSP1 и GSP2) были сконструированы на соответствующем EST (см. Дополнительный файл 2). КДНК первой цепи, используемую для 5 ‘и 3’RACE, получали с использованием 1 мкг смеси инфицированной РНК, приготовленной для метода SSH, и с использованием праймеров, предоставленных в наборе. Амплификация продуктов RACE проводилась в соответствии с инструкциями производителя. Фрагменты ПЦР очищали с помощью набора Nucleotrap Gel Extraction Kit (Clontech Laboratories) и вставляли в плазмидный вектор pCR2.1-ТОПО (Invitrogen). Последовательности были созданы Genome Express Company (Гренобль, Франция) с векторными праймерами M13 и M13rev.

    Полноразмерная последовательность транскрипта была предсказана с использованием программного пакета MacMolly в соответствии с продуктом RACE PCR и в соответствии с присутствием как внутрикадровых стоп-кодонов перед предполагаемым стартовым сайтом метионина, так и поли (A) хвоста. после предполагаемого стоп-кодона. Затем предсказанная последовательность была подтверждена с помощью ПЦР-амплификации и секвенирования.Предполагаемые белки сравнивали с последовательностями белков в Swiss-Prot-Trembl для подтверждения первой гомологии и анализировали с помощью InterProScan http://www.ebi.ac.uk/InterProScan, который сочетает в себе различные методы распознавания сигнатур белков.

    Количественная оценка транскриптов ОТ-ПЦР в реальном времени

    Количественная оценка транскриптов ОТ-ПЦР в реальном времени была выполнена с помощью прибора LightCycler ® с использованием набора LightCycler Fast Start DNA Master SYBR Green I (Roche Diagnostics), как описано в Anselme et al. al.[16]. Экстракцию РНК на трех независимых биологических образцах проводили для каждого состояния (наивные личинки, ложно инфицированные личинки и инфицированные личинки) через 6 часов после обработки и на образцах 100 бактериомов, выделенных из наивных симбиотических личинок. После очистки образца проводили обратную транскрипцию в кДНК первой цепи с помощью набора First-Strand Synthesis System for RT-PCR (Invitrogen) с использованием олиго (dT) праймеров. Праймеры для ПЦР были сконструированы на основе последовательностей EST или кДНК, при необходимости, для амплификации фрагментов размером менее 300 п.н. (см. Дополнительный файл 2).

    Реакции ПЦР проводили в капиллярах LightCycler в конечном объеме 20 мкл, содержащем 2 мкл образцов кДНК (разведенных в 5 раз), 3,5 мМ MgCl 2 , 0,5 мкМ каждого праймера и 2 мкл LC-Fast. Start Reaction Master SYBR Green I. Через 8 мин при 95 ° C условия цикла были следующими: 45 циклов при 95 ° C в течение 10 с, температура отжига праймера в течение 20 с и затем 72 ° C в течение 30 с. Для идентификации продукта в конце каждой ПЦР строили кривую плавления путем нагревания в течение 5 с при 95 ° C и в течение 15 с при температуре, соответствующей на 10 ° C выше температуры отжига праймера, а затем повышении температуры до 95 ° C с шагом 0.1 ° C / с. Реакции останавливали охлаждением до 4 ° C.

    Для отдельных образцов определяли точку пересечения (Cp) и, согласно стандартной кривой, концентрации транскриптов. Кривые плавления каждого образца анализировали, и концентрации образцов, демонстрирующих образование димера праймера, считали «неопределенными» (ND). Данные были нормализованы с использованием отношения концентрации целевой кДНК к концентрации гена домашнего хозяйства, глицеральдегид-3-фосфатдегидрогеназы ( gapdh ).Экспрессия этого гена существенно не зависит от лечения, и она аналогична экспрессии гена рибосомного белка L29 (данные не показаны). Нормализованные данные анализировали с помощью непараметрических тестов.

    Последовательности EST и полноразмерной кДНК, описанные в этой статье, депонированы в базе данных GenBank (номера доступа от {«type»: «entrez-nucleotide», «attrs»: {«text»: » EY122775 «,» term_id «:» 211887299 «,» term_text «:» EY122775 «}} EY122775 на {» type «:» entrez-нуклеотид «,» attrs «: {» text «:» EY123248 «,» term_id «: «211863834», «term_text»: «EY123248»}} EY123248 и from {«type»: «entrez-nucleotide», «attrs»: {«text»: «EU282111», «term_id»: «167444199», «term_text «:» EU282111 «}} EU282111 до {» type «:» entrez-нуклеотид «,» attrs «: {» text «:» EU282122 «,» term_id «:» 167444221 «,» term_text «:» EU282122 «}} EU282122 соответственно).Более подробный анализ EST (например, номера доступа, сборка EST, результаты взрыва) доступен по адресу http://mandragore.univ-lyon1.fr/sitozea (логин: sitophilus, пароль: zeamais).

    Вклад авторов

    CA разработала и провела эксперименты, проанализировала данные (статистика и биоинформатика), написала статью и участвовала в биоинформатическом анализе вычтенной библиотеки; VPB участвовал в молекулярных исследованиях и секвенировал вычтенную библиотеку. AV провела вскрытие и ОТ-ПЦР в реальном времени, а CVM участвовала в молекулярных исследованиях и анализе последовательностей.DC провел биоинформатический анализ и построение URL для вычитаемой библиотеки; AL и AM упорядочили вычитанную библиотеку и предоставили критические комментарии к рукописи. AH задумал исследование, координировал работу и помог составить черновик и написать рукопись. Все авторы прочитали и одобрили окончательную рукопись.

    Примечание авторов

    При подготовке этой рукописи была опубликована экспериментальная идентификация генов, индуцируемых в ответ на септическое повреждение у красного мучного жука Tribolium castaneum с использованием метода SSH [47].Сравнивая последовательность EST с базами данных последовательностей Tribolium , авторы идентифицировали 75 иммуно-индуцируемых генов в T. castaneum , потенциально участвующих в иммунной защите, передаче сигналов и других связанных с иммунитетом клеточных процессах, включая гомологи, например, Toll, PGRP-SC, лизоцим и множественные изоформы дефенсинов и тауматин-подобных пептидов. Они также выполнили qRT-PCR для определения регуляции транскрипции выбранных генов (то есть дефенсина, тауматина и генов, связанных со стрессом) в ответ на септическое или стерильное повреждение или тепловой шок.

    В то время как это исследование изучало иммунный ответ Tribolium с учетом всех клеточных процессов, мы сосредоточили наше исследование на иммунных путях и эффекторах Sitophilus . Следует отметить, что, в отличие от этого исследования, мы идентифицировали представителей различных семейств антибактериальных пептидов (например, колеоптерицин, дефенсин). Мы также идентифицировали некоторые гомологи тауматиноподобных пептидов (например, INF-475, INF-332, INF-CL57Contig1), но не смогли количественно определить их без специфической амплификации.

    Дополнительный материал

    Дополнительный файл 1:

    Характеристики EST из вычтенной библиотеки с гомологией с иммунными генами.

    Дополнительный файл 2:

    Праймеры, используемые для 3′- и 5′-RACE (GSP1 и GSP2 соответственно) и qRT-PCR.

    Благодарности

    Мы благодарны М. Вейру и С. Гийону за их техническую помощь, Я. Рахбе за полезные обсуждения и В. Джеймсу за исправления на английском языке.Авторы также хотели бы поблагодарить анонимных рецензентов за конструктивную критику. Эта работа была поддержана Национальным институтом агрономических исследований (INRA), Национальным институтом прикладных наук (INSA) и французским ANR-06-BLAN-0316 (EndoSymArt).

    Список литературы

    • Бюхнер П. Эндосимбиоз животных с растительными микроорганизмами. Нью-Йорк, Лондон, Сидней: Interscience Publishers, подразделение Wiley & sons, Inc; 1965. [Google Scholar]
    • Heddi A, Grenier AM, Khatchadourian C, Charles H, Nardon P.Четыре внутриклеточных генома определяют биологию долгоносика: ядерный, митохондриальный, основные эндосимбионты и Wolbachia . Proc Natl Acad Sci U S. A. 1999; 96: 6814–6819. DOI: 10.1073 / pnas.96.12.6814. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    • Брандл С., Миура Т., Бикель Р., Шинглтон А.В., Камбхампати С., Стерн Д.Л. Происхождение и эволюция бактериоцитов в симбиозе тлей- Buchnera . PLoS Biol. 2003; 1: e21. DOI: 10.1371 / journal.pbio.0000021. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    • Douglas AE.Польза для хозяев и развитие специализации в симбиозе. Наследственность. 1998. 81: 599–603. DOI: 10.1038 / sj.hdy.6884550. [CrossRef] [Google Scholar]
    • Ракофф-Нахум С., Паглино Дж., Эслами-Варзане Ф., Эдберг С., Меджитов Р. Распознавание комменсальной микрофлоры толл-подобными рецепторами необходимо для гомеостаза кишечника. Клетка. 2004. 118: 229–241. DOI: 10.1016 / j.cell.2004.07.002. [PubMed] [CrossRef] [Google Scholar]
    • Goodson MS, Kojadinovic M, Troll JV, Scheetz TE, Casavant TL, Soares MB, McFall-Ngai MJ.Идентификация компонентов пути NF-kappaB в симбиозе полезных органов Euprymna scolopes-Vibrio fischeri . Appl Environ Microbiol. 2005; 71: 6934–6946. DOI: 10.1128 / AEM.71.11.6934-6946.2005. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    • Mazmanian SK, Liu CH, Tzianabos AO, Kasper DL. Иммуномодулирующая молекула симбиотических бактерий направляет созревание иммунной системы хозяина. Клетка. 2005. 122: 107–118. DOI: 10.1016 / j.cell.2005.05.007. [PubMed] [CrossRef] [Google Scholar]
    • Cash HL, Whitham CV, Behrendt CL, Hooper LV.Симбиотические бактерии направляют экспрессию кишечного бактерицидного лектина. Наука. 2006; 313: 1126–1030. DOI: 10.1126 / science.1127119. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    • Lemaitre B, Hoffmann J. Защита хозяина Drosophila melanogaster . Анну Рев Иммунол. 2007; 25: 697–743. DOI: 10.1146 / annurev.immunol.25.022106.141615. [PubMed] [CrossRef] [Google Scholar]
    • Christensen BM, Li J, Chen CC, Nappi AJ. Иммунные реакции меланизации у комаров-переносчиков.Trends Parasitol. 2005; 21: 192–199. DOI: 10.1016 / j.pt.2005.02.007. [PubMed] [CrossRef] [Google Scholar]
    • Tzou P, Ohresser S, Ferrandon D, Capovilla M, Reichhart JM, Lemaitre B, Hoffmann JA, Imler JL. Тканеспецифическая индуцируемая экспрессия генов антимикробных пептидов в поверхностном эпителии Drosophila . Иммунитет. 2000; 13: 737–748. DOI: 10.1016 / S1074-7613 (00) 00072-8. [PubMed] [CrossRef] [Google Scholar]
    • Bischoff V, Vignal C, Duvic B, Boneca IG, Hoffmann JA, Royet J.Подавление иммунного ответа Drosophila пептидогликановыми белками SC1 и SC2. PLoS Pathog. 2006; 2: с14. DOI: 10.1371 / journal.ppat.0020014. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    • Зайдман-Реми А., Эрве М., Пойдевин М., Пили-Флури С., Ким М. С., Блано Д., О Б. Х., Уэда Р., Менгин-Лекреулкс Д., Леметр Б. Амидаза PGRP-LB Drosophila модулирует иммунный ответ на бактериальную инфекцию. Иммунитет. 2006. 24: 463–473. DOI: 10.1016 / j.Immuni.2006.02.012. [PubMed] [CrossRef] [Google Scholar]
    • Хедди А., Нардон П. Sitophilus oryzae L .: Модель внутриклеточного симбиоза в симбиозе долгоносиков Dryophthoridae (Coleoptera). 2005; 39: 1–11. [Google Scholar]
    • Хедди А., Валлиер А., Ансельм С., Синь Х, Рахбе И., Векерс Ф. Молекулярные и клеточные профили бактериоцитов насекомых: мутуализм и вред на начальном этапе эволюции симбиогенеза. Cell Microbiol. 2005; 7: 293–305. [PubMed] [Google Scholar]
    • Ансельм С., Валлье А., Бальманд С., Фоварк, МО, Хедди А.Хозяин Экспрессия гена PGRP и высвобождение бактерий при эндосимбиозе долгоносика Sitophilus zeamais . Appl Environ Microbiol. 2006. 72: 6766–6772. DOI: 10.1128 / AEM.00942-06. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    • Hosaka M, Nagahama M, Kim WS, Watanabe T., Hatsuzawa K, Ikemizu J, Murakami K, Nakayama K. Arg-X-Lys / Arg-Arg мотив как сигнал для расщепления предшественника, катализируемого фурином в рамках конститутивного секреторного пути. J Biol Chem. 1991; 266: 12127–12130.[PubMed] [Google Scholar]
    • Lazzaro BP, Clark AG. Молекулярная популяционная генетика индуцибельных генов антибактериальных пептидов у Drosophila melanogaster . Mol Biol Evol. 2003. 20: 914–923. DOI: 10.1093 / molbev / msg109. [PubMed] [CrossRef] [Google Scholar]
    • Булет П., Стоклин Р. Антимикробные пептиды насекомых: структуры, свойства и регуляция генов. Protein Pept Lett. 2005; 12: 3–11. DOI: 10.2174 / 0
    • 6053406011. [PubMed] [CrossRef] [Google Scholar]
    • Уэда К., Сайто А., Имамура М., Миура Н., Ацуми С., Табуноки Х., Ватанабэ А., Китами М., Сато Р.Очистка и клонирование кДНК люксуриозина, нового антибактериального пептида с доменом Куница из жука-усачей, Acalolepta luxuriosa . Biochim Biophys Acta. 2005; 1722: 36–42. [PubMed] [Google Scholar]
    • Джоллес П., Джоллес Дж. Что нового в исследованиях лизоцима? Всегда образцовая система, сегодня, как вчера. Mol Cell Biochem. 1984. 63: 165–189. DOI: 10.1007 / BF00285225. [PubMed] [CrossRef] [Google Scholar]
    • Завалова Л.Л., Баскова И.П., Лукьянов С.А., Сасс А.В., Снежков Е.В., Акопов С.Б., Артамонова И.И., Архипова В.С., Несмеянов В.А., Козлов Д.Г. и др.Дестабилаза из медицинской пиявки является представителем нового семейства лизоцимов. Biochim Biophys Acta. 2000; 1478: 69–77. [PubMed] [Google Scholar]
    • Ким М.С., Бюн М., О Б.Х. Кристаллическая структура белка распознавания пептидогликана LB из Drosophila melanogaster . Nat Immunol. 2003. 4: 787–793. DOI: 10,1038 / Ni952. [PubMed] [CrossRef] [Google Scholar]
    • Burns K, Clatworthy J, Martin L, Martinon F, Plumpton C, Maschera B, Lewis A, Ray K, Tschopp J, Volpe F. Tollip, новый компонент IL Путь -1RI связывает IRAK с рецептором IL-1.Nat Cell Biol. 2000; 2: 346–351. DOI: 10,1038 / 35014038. [PubMed] [CrossRef] [Google Scholar]
    • Чжан Г., Гош С. Отрицательная регуляция передачи сигналов, опосредованной Toll-подобным рецептором, с помощью Tollip. J Biol Chem. 2002; 277: 7059–7065. DOI: 10.1074 / jbc.M109537200. [PubMed] [CrossRef] [Google Scholar]
    • Didierlaurent A, Brissoni B, Velin D, Aebi N, Tardivel A, Kaslin E, Sirard JC, Angelov G, Tschopp J, Burns K. Толлип регулирует провоспалительные реакции на интерлейкин-1 и липополисахарид. Mol Cell Biol.2006; 26: 735–742. DOI: 10.1128 / MCB.26.3.735-742.2006. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    • Рамет М., Манфруэлли П., Пирсон А., Мэти-Превот Б., Эзековиц Р.А. Функциональный геномный анализ фагоцитоза и идентификация рецептора Drosophila для E. coli . Природа. 2002; 416: 644–648. DOI: 10,1038 / природа735. [PubMed] [CrossRef] [Google Scholar]
    • Barbieri JT, Riese MJ, Aktories K. Бактериальные токсины, которые изменяют актиновый цитоскелет.Annu Rev Cell Dev Biol. 2002. 18: 315–344. DOI: 10.1146 / annurev.cellbio.18.012502.134748. [PubMed] [CrossRef] [Google Scholar]
    • Kimbell JR, McFall-Ngai MJ. Симбионт-индуцированные изменения актина хозяина во время начала благоприятной ассоциации между животными и бактериями. Appl Environ Microbiol. 2004; 70: 1434–1441. DOI: 10.1128 / AEM.70.3.1434-1441.2004. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    • Накабачи А., Сигенобу С., Сакадзуме Н., Шираки Т., Хаяшизаки И., Карнинчи П., Исикава Х., Кудо Т., Фукацу Т.Транскриптомный анализ бактериоцитов тли, симбиотической клетки-хозяина, в которой обитает внутриклеточная мутуалистическая бактерия, Buchnera . Proc Natl Acad Sci U S. A. 2005; 102: 5477–5482. DOI: 10.1073 / pnas.040
    45 (1990).

    Артикул CAS PubMed PubMed Central Google ученый

  • 23.

    Поуп, К., Карант, С. и Лю, Дж. Фармакология и токсикология ингибиторов холинэстеразы: использование и неправильное использование общего механизма действия. Экологическая токсикология и фармакология 19 , 433–446, https://doi.org/10.1016/j.etap.2004.12.048 (2005).

    Артикул CAS PubMed PubMed Central Google ученый

  • 24.

    Park, G.-H. и др. . Фумигационная активность этилформиата и фосфина против Tetranychus urticae (Acari: Tetranychidae) на импортной сладкой тыкве. Журнал экономической энтомологии 111 , 1625–1632, https: // doi.org / 10.1093 / jee / toy090% J Journal of Economic Entomology (2018).

  • 25.

    Choi, Y. & Chan, A. P. Веб-сервер PROVEAN: инструмент для прогнозирования функционального эффекта аминокислотных замен и отступов. Биоинформатика 31 , 2745–2747, https://doi.org/10.1093/bioinformatics/btv195 (2015).

    Артикул CAS PubMed PubMed Central Google ученый

  • 26.

    Ефремов Р.Г., Сазанов Л.A. Структура мембранного домена респираторного комплекса I. Nature 476 , 414–420, https://doi.org/10.1038/nature10330 (2011).

    Артикул ОБЪЯВЛЕНИЯ CAS PubMed PubMed Central Google ученый

  • 27.

    Нат, Н. С., Бхаттачарья, И., Так, А. Г., Шлипалиус, Д. И., Эберт, П. Р. Механизмы токсичности фосфина. Журнал токсикологии 2011 , 494168, https: // doi.org / 10.1155 / 2011/494168 (2011).

    Артикул CAS PubMed PubMed Central Google ученый

  • 28.

    Прайс, Н. Р. Влияние фосфина на дыхание и окисление митохондрий у чувствительных и устойчивых штаммов Rhyzopertha dominica . Насекомое. Биохимия 10 , 65–71, https://doi.org/10.1016/0020-1790(80)

    -2 (1980).

    Артикул CAS Google ученый

  • 29.

    Скиуто, А. М., Вонг, Б. Дж., Мартенс, М. Е., Хорд-Фручи, Х. и Перкинс, М. В. Токсичность фосфина: история нарушения метаболизма митохондрий. Анналы Нью-Йоркской академии наук 1374 , 41–51, https://doi.org/10.1111/nyas.13081 (2016).

    Артикул ОБЪЯВЛЕНИЯ CAS PubMed PubMed Central Google ученый

  • 30.

    Харитос, В. С., Дойчинов, Г. Ингибирование цитохрома c оксидазы у рисового долгоносика Sitophilus oryzae (L.) формиатом, токсичным метаболитом летучих алкилформиатов. Сравнительная биохимия и физиология, часть C: Сравнительная фармакология 136 , 135–143 (2003).

    CAS Google ученый

  • 31.

    Granada, Y., Mejia-Jaramillo, AM, Strode, C. & Triana-Chavez, O. Точечная мутация V419L в гене натриевого канала из природных популяций Aedes aegypti участвует в устойчивости к лямбда-цигалотрин в Колумбии. Насекомые 9 , https://doi.org/10.3390/insects

    23 (2018).

  • 32.

    Ибрагим, С. и др. . Устойчивость к пиретроидам основного переносчика малярии Anopheles funestus усугубляется избыточной экспрессией и гиперактивностью P450 CYP6AA1 по всей Африке. Гены 9 , 140 (2018).

    Артикул CAS Google ученый

  • 33.

    Nansen, C., Baissac, O., Нансен, М., Поуис, К. и Бейкер, Г. Поведенческое избегание — повлияет ли физиологический уровень устойчивости штаммов насекомых к инсектицидам на их откладывание яиц и реакцию движения? PLoS One 11 , e0149994, https://doi.org/10.1371/journal.pone.0149994 (2016).

    Артикул CAS PubMed PubMed Central Google ученый

  • 34.

    Tmimi, F. Z. et al . Устойчивость к инсектицидам и мутации сайтов-мишеней (G119S ace-1 и L1014F kdr) Culex pipiens в Марокко. Parasit Vectors 11 , 51, https://doi.org/10.1186/s13071-018-2625-y (2018).

    Артикул CAS PubMed PubMed Central Google ученый

  • 35.

    Лант, С. Ю. и Вандер Хайден, М. Г. Аэробный гликолиз: удовлетворение метаболических требований пролиферации клеток. Ежегодный обзор клеточной биологии и биологии развития 27 , 441–464, https://doi.org/10.1146/annurev-cellbio-0

  • -154237 (2011).

    Артикул CAS PubMed PubMed Central Google ученый

  • 36.

    Liberti, M. V. & Locasale, J. W. Эффект Варбурга: как он полезен для раковых клеток? Тенденции в биохимических науках 41 , 211–218, https://doi.org/10.1016/j.tibs.2015.12.001 (2016).

    Артикул CAS PubMed PubMed Central Google ученый

  • 37.

    Коппенол, В. Х., Баундс, П. Л. и Данг, К. В. Вклад Отто Варбурга в современные концепции метаболизма рака. Nature Reviews Cancer 11 , 325–337, https://doi.org/10.1038/nrc3038 (2011).

    Артикул CAS PubMed PubMed Central Google ученый

  • 38.

    Кантор, Дж. Р. и Сабатини, Д. М. Метаболизм раковых клеток: один признак, много лиц. Cancer Discovery 2 , 881–898, https: // doi.org / 10.1158 / 2159-8290.CD-12-0345 (2012).

    Артикул CAS PubMed PubMed Central Google ученый

  • 39.

    Куо, И. Ю. и Эрлих, Б. Э. Сигналы при сокращении мышц. Cold Spring Harb Perspect Biol 7 , a006023, https://doi.org/10.1101/cshperspect.a006023 (2015).

    Артикул CAS PubMed PubMed Central Google ученый

  • 40.

    Бабуин, Л. и Яффе, А. С. Тропонин: биомаркер выбора для обнаружения сердечного повреждения. Журнал Канадской медицинской ассоциации 173 , 1191–1202, https://doi.org/10.1503/cmaj/051291 (2005).

    Артикул Google ученый

  • 41.

    Бласко, Б., Лерой, Д. и Фидок, Д. А. Устойчивость к противомалярийным препаратам: соединение биологии паразитов Plasmodium falciparum с клиникой. Nature Medicine 23 , 917–928, https: // doi.org / 10.1038 / nm.4381 (2017).

    Артикул CAS PubMed PubMed Central Google ученый

  • 42.

    Lee, D. W. et al. . Потеря консервативного остатка тирозина цитохрома b вызывает продукцию активных форм кислорода цитохромом bc . Journal of Biological Chemistry 286 , 18139–18148, https://doi.org/10.1074/jbc.M110.214460 (2011).

    Артикул CAS PubMed PubMed Central Google ученый

  • 43.

    Блисс, К. И. Метод пробитов. Наука 79 , 38–39, https://doi.org/10.1126/science.79.2037.38 (1934).

    Артикул ОБЪЯВЛЕНИЯ CAS PubMed PubMed Central Google ученый

  • 44.

    Натанаилидес К. и Тайлер Д. Определение максимальной активности цитохром с-оксидазы в мышцах рыб . Европейский журнал трансляционной миологии 5 , 99–102 (1995).

    Google ученый

  • 45.

    Эллман, Г. Л., Кортни, К. Д., Андрес, В. мл. И Фезер-Стоун, Р. М. Новое и быстрое колориметрическое определение активности ацетилхолинэстеразы. Биохимическая фармакология 7 , 88–95 (1961).

    Артикул CAS PubMed PubMed Central Google ученый

  • 46.

    Mackness, M. I., Walker, C.H., Rowlands, D.Г. и Прайс, Н. Р. Эстеразная активность в гомогенатах трех штаммов ржавого красного мучного жука Tribolium castaneum (Herbst). Сравнительная биохимия и физиология, часть C: сравнительная . Фармакология 74 , 65–68, https://doi.org/10.1016/0742-8413(83)-0 (1983).

    Артикул Google ученый

  • 47.

    Habig, W. H. & Jakoby, W. B. In Methods in Enzymology Vol.77 398–405 (Academic Press, 1981).

  • 48.

    Li, R. et al. . Сборка de novo геномов человека с массовым параллельным секвенированием короткого чтения. Genome Research 20 , 265–272, https://doi.org/10.1101/gr.097261.109 (2010).

    Артикул CAS PubMed PubMed Central Google ученый

  • 49.

    Bernt, M. et al. . MITOS: улучшенная de novo аннотация митохондриального генома многоклеточных животных. Молекулярная филогенетика и эволюция 69 , 313–319, https://doi.org/10.1016/j.ympev.2012.08.023 (2013).

    Артикул PubMed PubMed Central Google ученый

  • 50.

    Author: alexxlab

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

  • EST Описание белка E-value Целевой организм UniProt Acc. Num. qRT-PCR Fold change
    Антибактериальные пептиды 9026 9026 902 902 INF-18 Колеоптерицин 3E-15 Zophobas atratus {«type»: «entrez-protein», «attrs»: {«text»: «P80032», «term_id»: «116876 «,» term_text «:» P80032 «}} P80032 11.4 * 86,1 * (*)

    INF-42 Диптерицин А 2,6 Glossina morsitans {«тип att»: «entrez»: «entrez» : {«текст»: «Q8WTD5», «term_id»: «74820404», «term_text»: «Q8WTD5»}} Q8WTD5 > 10 * > 300 * (*)

    Acaloleptin A 2E-15 Acalolepta luxuriosa {«type»: «entrez-protein», «attrs»: {«text»: «Q76K70», «term_id»: «74797591 «,» term_text «:» Q76K70 «}} Q76K70 1.8 43,1 *

    INF-163 Цекропин A1 0,68 Drosophila mauritiana {«type»: «entrez» «:» P81685 «,» term_id «:» 10719931 «,» term_text «:» P81685 «}} P81685 1 31,5 *

    INF-165 II-Sarcoto 0,67 Sarcophaga peregrina {«type»: «entrez-protein», «attrs»: {«text»: «P24491», «term_id»: «134864», «term_text»: «P24491»} } P24491 0.8 31,6 *

    INF-217 Tenecin-1 3E-13 Tenebrio molitor {«тип»: «attrez-rus» {«text»: «Q27023», «term_id»: «24
  • «, «term_text»: «Q27023»}} Q27023
  • 9,7 * 314,9 * (*)

    INF-479 Люксуриозин 0,18 Acalolepta luxuriosa {«type»: «entrez-protein», «attrs»: {«text»: «Q60FC9», «term_id»: «741″, «term_text»: «Q60FC9»}} Q60FC9 2.8 * 4,5 *

    Лизоцимы
    1E-05 Anopheles gambiae {«type»: «entrez-protein», «attrs»: {«text»: «Q6GU90», «term_id»: «74847770», «term_text»: » Q6GU90 «}} Q6GU90 7,8 * 5.2 *

    INF-282 Лизоцим С-1 6E-17 Anas platyrhynchos {«тип»: «entre» белок » text «:» P00705 «,» term_id «:» 126592 «,» term_text «:» P00705 «}} P00705 7.1 * 5,4 *

    P

    INF-9 PGRP sb2 7E-57 Aedes 90 «тип» энтрец 68 « Aedes 90″ тип » attrs «: {» текст «:» Q1HRh4 «,» term_id «:» 121959342 «,» term_text «:» Q1HRh4 «}} Q1HRh4 2.3 * 6,7 * (*)

    INF-441 PGRP 9E-38 Biomphalaria glabrata
    Иммунный регулятор


    {«type»: «entrez-protein», «attrs»: {«text»: «Q9QZ06», «term_id»: «20140896», «term_text»: «Q9QZ06»}} Q9QZ06 1.2 1,7

    Фенолоксидазный путь Holotrichia diomphalia {«type»: «entrez-protein», «attrs»: {«text»: «Q9GRW0», «term_id»: «74824253», «term_text»: «Q9GRW0»}} Q9GRW0 2,8 * 2.7 *

    INF-74 Serpin-4A 2E-20 Manduca sexta {«type»: «entrez-protein», «text attrs»: {» «:» Q6Q2D8 «,» term_id «:» 74794070 «,» term_text «:» Q6Q2D8 «}} Q6Q2D8 2,8 * 2,9 *


    INF-20 IMPI 2E-11 Entrezella «{тип. «attrs»: {«текст»: «P82176», «term_id»: «33860163», «term_text»: «P82176»}} P82176 2.3 * 3,4 *

    INF-91 Ядовоподобный белок, богатый цистеином 7E-09 Aedes albopictus ent {«тип» белок , «attrs»: {«text»: «Q5MIW2», «term_id»: «74767429», «term_text»: «Q5MIW2»}} Q5MIW2 3,4 * 7,5 * (*)

    INF-258 Сериновая протеиназа распознавания образов 7E-28 Manduca sexta {«type»: «entrez-protein», «attrs»: {«text»: «Q69BL0», «term_id» «:» 74847496 «,» term_text «:» Q69BL0 «}} Q69BL0 ND ND

    INF-459 Гемолимфа протеиназа 68 10xt Гемолимфа протеиназа 17 {«type»: «entrez-protein», «attrs»: {«text»: «Q5MPB8», «term_id»: «75003794», «term_text»: «Q5MPB8»}} Q5MPB8 1.7 4,4

    INF-515 Трипсиноподобная сериновая протеиназа 5E-27 Anthonomus grandis {«тип att»: «entrez-белок» : {«text»: «Q64ID5», «term_id»: «75006550», «term_text»: «Q64ID5»}} Q64ID5 1,4 1,1

    9016

    INF-13 profilin 3E-29 Apis mellifera «тип 904» attrs «: {» текст «:» Q6QEJ7 «,» term_id «:» 56404802 «,» term_text «:» Q6QEJ7 «}} Q6QEJ7 0.9 0,8

    актин Sitophilus zeamais 1 913rus

    02. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Scanga CA, Mohan VP, Yu K, Joseph H, Tanaka K, Chan J, Flynn JL. Истощение CD4 (+) Т-клеток вызывает реактивацию стойкого туберкулеза у мышей, несмотря на продолжающуюся экспрессию гамма-интерферона и синтазы оксида азота 2.J Exp Med. 2000; 192: 347–358. DOI: 10.1084 / jem.192.3.347. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Hurst GD, Anbutsu H, Kutsukake M, Fukatsu T. Скрыто от хозяина: Spiroplasma бактерии, инфицирующие Drosophila , не вызывают иммунного ответа, но подавляются эктопической иммунной активацией. Насекомое Mol Biol. 2003; 12: 93–97. DOI: 10.1046 / j.1365-2583.2003.00380.x. [PubMed] [CrossRef] [Google Scholar]
  • Schröder JM. Эпителиальные пептидные антибиотики.Biochem Pharmacol. 1999. 57: 121–134. DOI: 10.1016 / S0006-2952 (98) 00226-3. [PubMed] [CrossRef] [Google Scholar]
  • Ryu JH, Nam KB, Oh CT, Nam HJ, Kim SH, Yoon JH, Seong JK, Yoo MA, Jang IH, Brey PT и др. Ген гомеобокса Caudal регулирует конститутивную локальную экспрессию генов антимикробных пептидов в эпителии Drosophila . Mol Cell Biol. 2004. 24: 172–185. DOI: 10.1128 / MCB.24.1.172-185.2004. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Haines LR.Симбионт-опосредованная защита. Proc Biol Sci. 2008. 275: 353–361. DOI: 10.1098 / rspb.2007.1211. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Вернер Т., Лю Дж., Канг Д., Экенгрен С., Штайнер Х., Халтмарк Д. Семейство белков распознавания пептидогликанов в плодовой мушке Drosophila melanogaster . Proc Natl Acad Sci U S. A. 2000; 97: 13772–13777. DOI: 10.1073 / pnas.97.25.13772. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Мелмед Г., Томас Л.С., Ли Н., Тесфай С.Ю., Лукасек К., Мичелсен К.С., Чжоу Й., Ху Б., Ардити М., Абреу М.Т.Эпителиальные клетки кишечника человека практически не реагируют на Toll-подобные рецепторы 2 бактериальные лиганды: последствия для микробных взаимодействий хозяина в кишечнике. J Immunol. 2003; 170: 1406–1415. [PubMed] [Google Scholar]
  • Сигенобу С., Ватанабе Х., Хаттори М., Сакаки Ю., Исикава Х. Последовательность генома внутриклеточного бактериального симбионта тлей Buchnera sp . APS. Природа. 2000. 407: 81–86. DOI: 10,1038 / 35024074. [PubMed] [CrossRef] [Google Scholar]
  • Charles H, Condemine G, Nardon C, Nardon P.Характеристика размера генома основных внутриклеточных симбиотических бактерий долгоносика Sitophilus oryzae с использованием гель-электрофореза в импульсном поле. Насекомое Biochem Mol Biol. 1997. 27: 345–350. DOI: 10.1016 / S0965-1748 (97) 00005-2. [CrossRef] [Google Scholar]
  • Heddi A, Charles H, Khatchadourian C, Bonnot G, Nardon P. Молекулярная характеристика основных симбиотических бактерий долгоносика Sitophilus oryzae : своеобразное содержание G — C в ДНК эндоцитобиотиков.J Mol Evol. 1998. 47: 52–61. DOI: 10.1007 / PL00006362. [PubMed] [CrossRef] [Google Scholar]
  • Charles H, Heddi A, Rahbé Y. Предполагаемая внутриклеточная кладка ствола эндосимбионта насекомого в составе Enterobacteriaceae, полученная в результате филогенетического анализа, основанного на гетерогенной модели эволюции ДНК. C R Acad Sci III. 2001. 324: 489–494. [PubMed] [Google Scholar]
  • Дейл С., Чума Г.Р., Ван Б., Охман Х., Моран Н.А. Системы секреции типа III и эволюция мутуалистического эндосимбиоза.Proc Natl Acad Sci U S. A. 2002; 99: 12397–12402. DOI: 10.1073 / pnas.182213299. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Lefèvre C, Charles H, Vallier A, Delobel B, Farrell B, Heddi A. Филогенез эндосимбионтов у долгоносиков Dryophthoridae: доказательства бактериальной замены. Mol Biol Evol. 2004; 21: 965–973. DOI: 10.1093 / molbev / msh063. [PubMed] [CrossRef] [Google Scholar]
  • Бурсис К., Петтигрю М.М., О’Нил С.Л. Wolbachia не индуцирует и не подавляет транскрипты, кодирующие антимикробные пептиды.Насекомое Mol Biol. 2000. 9: 635–639. DOI: 10.1046 / j.1365-2583.2000.00224.x. [PubMed] [CrossRef] [Google Scholar]
  • Pertea G, Huang X, Liang F, Antonescu V, Sultana R, Karamycheva S, Lee Y, White J, Cheung F, Parvizi B., et al. Инструменты кластеризации генных индексов TIGR (TGICL): программная система для быстрой кластеризации больших наборов данных EST. Биоинформатика. 2003. 19: 651–652. DOI: 10.1093 / биоинформатика / btg034. [PubMed] [CrossRef] [Google Scholar]
  • Ye J, Fang L, Zheng H, Zhang Y, Chen J, Zhang Z, Wang J, Li S, Li R, Bolund L.WEGO: веб-инструмент для создания аннотаций GO. Nucleic Acids Res. 2006; 34: W293–297. DOI: 10.1093 / nar / gkl031. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Алтинчичек Б., Кнорр Э., Вилцинскас А. Иммунитет к жукам: идентификация иммуно-индуцируемых генов у модельного насекомого Tribolium castaneum . Dev Comp Immunol. 2008. 32: 585–595. DOI: 10.1016 / j.dci.2007.09.005. [PubMed] [CrossRef] [Google Scholar]
  • Стабильность и тканеспецифическая сверхэкспрессия Cry10Aa улучшает устойчивость хлопка к хлопковому долгоносику

    https: // doi.org / 10.1016 / j.biori.2019.12.003Получить права и содержание

    Реферат

    Хлопковый долгоносик (CBW, Anthonomus grandis ) является наиболее разрушительным насекомым-вредителем хлопка, поражающим хлопковые посевы. Чтобы преодолеть эту проблему, были успешно получены устойчивые к CBW генетически модифицированные растения хлопка, сверхэкспрессирующие энтомотоксины Bacillus thuringiensis . Предыдущие результаты показали, что сверхэкспрессия протоксина Cry10Aa приводит к высокой смертности личинок CBW в тепличных условиях.В этом исследовании мы продвинули еще три поколения (от T2 до T4) с несколькими объектами хлопка, постоянно избыточно экспрессирующими протоксин Cry10Aa, а также исследовали стабильность трансгена и агрономические характеристики. Кроме того, был получен и охарактеризован стабильный трансгенный хлопок, сверхэкспрессирующий активный Cry10Aa (протоксин Cry10Aa, лишенный N-конца α-спирали), управляемый промоторами, специфичными для бутонов хлопка. Хлопок, конститутивно или тканеспецифично сверхэкспрессирующий белок Cry10Aa (протоксин или активный), представлял процент смертности личинок CBW до 85% у растений в тепличных условиях.События сверхэкспрессии Cry10Aa, активного под контролем промотора, специфичного для цветочных бутонов, показали более высокое накопление белка в тычинках и плодолистиках по сравнению с событиями с конститутивной экспрессией. Наши результаты свидетельствуют о том, что высокая стабильность трансгена Cry10Aa и повышенный уровень экспрессии и накопление белка в тканях цветочных почек (прежде всего в тычинках и плодолистиках) способствуют повышению устойчивости к личинкам CBW. Наконец, были выбраны некоторые примечательные события, которые могут быть использованы в будущих полевых испытаниях в различных хлопкопроизводящих регионах Бразилии.Следовательно, события хлопка, сверхэкспрессирующие высокие уровни белка Cry10Aa в ткани цветочных бутонов, могут иметь большой потенциал для коммерческого использования в комплексном управлении CBW.

    Ключевые слова

    Стабильная наследственность

    Насекомые-вредители

    Управление устойчивостью

    Bacillus thuringiensis, энтомотоксин.

    Рекомендуемые статьиЦитирующие статьи (0)

    © 2019 Sociedade Brasileira de Biotecnologia. Опубликовано Elsevier Editora Ltda.

    Рекомендуемые статьи

    Цитирующие статьи

    Секвенирование антенного транскриптома и идентификация белков-кандидатов в хеморецепторы инвазивного вредителя, американского пальмового долгоносика, Rhynchophorus palmarum

  • 1.

    Ханссон Б.С. и Стенсмир М.С. Эволюция обоняния насекомых. Нейрон 72 , 698–711 (2011).

    CAS PubMed PubMed Central Статья Google ученый

  • 2.

    Бреер, Х., Флейшер, Дж., Прегитцер, П. и Кригер, Дж. Молекулярный механизм обоняния насекомых: обонятельные рецепторы. в Обонятельные концепции борьбы с насекомыми — альтернатива инсектицидам 93–114 (Springer, 2019).

  • 3.

    Робертсон, Х. М. Молекулярная эволюция основных семейств генов хеморецепторов членистоногих. Annu. Преподобный Энтомол. 64 , 227–242 (2019).

    CAS Статья Google ученый

  • 4.

    Ян, Х. и др. Эволюция, экспрессия в процессе развития и функция рецепторов запаха у насекомых. J. Exp. Биол. 223 , jeb20821 (2020).

    Артикул Google ученый

  • 5.

    Чжу, Дж., Иовинелла, И., Дани, Ф. Р., Пелоси, П. и Ван, Г. Хемосенсорные белки: универсальное связывающее семейство. в Обонятельные концепции борьбы с насекомыми — альтернатива инсектицидам 147–169 (Springer, 2019).

  • 6.

    Larsson, M.C. et al. Or83b кодирует широко экспрессируемый рецептор запаха, необходимый для обоняния Drosophila . Нейрон 43 , 703–714 (2004).

    CAS Статья Google ученый

  • 7.

    Vosshall, L. B. & Hansson, B. S. Единая система номенклатуры обонятельного корецептора насекомых. Chem. Чувства 36 , 497–498 (2011).

    Артикул Google ученый

  • 8.

    Stengl, M. & Funk, N. W. Роль корецептора Orco в обонятельной трансдукции насекомых. J. Comp. Physiol. A. 199 , 897–909 (2013).

    CAS Статья Google ученый

  • 9.

    Leal, W. S. Прием одоранта у насекомых: роль рецепторов, связывающих белков и разрушающих ферментов. Annu.Преподобный Энтомол. 58 , 373–391 (2013).

    CAS Статья Google ученый

  • 10.

    Rogers, ME, Sun, M., Lerner, MR & Vogt, RG Snmp-1, новый мембранный белок обонятельных нейронов шелковой моли Antheraea polyphemus с гомологией с семейством мембранных белков CD36. . J. Biol. Chem. 272 , 14792–14799 (1997).

    CAS Статья Google ученый

  • 11.

    Jin, X., Ha, T. S. и Smith, D. P. SNMP — это сигнальный компонент, необходимый для чувствительности к феромонам у Drosophila . Proc. Natl. Акад. Sci. 105 , 10996–11001 (2008).

    ADS CAS PubMed PubMed Central Статья Google ученый

  • 12.

    Scott, K. et al. Семейство хемосенсорных генов, кодирующих кандидатные вкусовые и обонятельные рецепторы у Drosophila . Cell 104 , 661–673 (2001).

    CAS Статья Google ученый

  • 13.

    Vosshall, L. B. & Stocker, R. F. Молекулярная архитектура запаха и вкуса у Drosophila . Annu. Rev. Neurosci. 30 , 505–533 (2007).

    CAS Статья Google ученый

  • 14.

    Clyne, P.J. et al. Новое семейство дивергентных семи-трансмембранных белков: кандидаты в пахучие рецепторы у Drosophila . Neuron 22 , 327–338 (1999).

    CAS Статья Google ученый

  • 15.

    Gao, Q. & Chess, A. Идентификация обонятельных рецепторов-кандидатов Drosophila по последовательности геномной ДНК. Genomics 60 , 31–39 (1999).

    CAS Статья Google ученый

  • 16.

    Vosshall, L. B., Amrein, H., Morozov, P.С., Ржецкий А. и Аксель Р. Пространственная карта экспрессии обонятельных рецепторов в антенне Drosophila . Cell 96 , 725–736 (1999).

    CAS Статья Google ученый

  • 17.

    Монтанье, Н., де Фушье, А., Ньюкомб, Р. Д. и Жакен-Жоли, Э. Успехи в идентификации и характеристике обонятельных рецепторов у насекомых. в Прогресс в молекулярной биологии и переводческих науках , Vol.130 55–80 (Elsevier, 2015).

  • 18.

    Liu, Y., Gu, S., Zhang, Y., Guo, Y. & Wang, G. Кандидаты в гены обоняния, идентифицированные в транскриптоме антенн Helicoverpa armigera . PLoS ONE 7 , e48260 (2012).

    ADS CAS PubMed PubMed Central Статья Google ученый

  • 19.

    Bengtsson, J. M. et al. Предполагаемые хемосенсорные рецепторы плодожорки, Cydia pomonella , идентифицированные с помощью анализа транскриптома усиков. PLoS ONE 7 , e31620 (2012).

    ADS CAS PubMed PubMed Central Статья Google ученый

  • 20.

    Gonzalez, F., Witzgall, P. & Walker, W. B. Антеннальные транскриптомы трех бабочек-мучнистых бабочек выявляют предполагаемые консервативные хемосенсорные рецепторы для социальных и естественных обонятельных сигналов. Sci. Отчетность 7 , 41829 (2017).

    ADS CAS PubMed PubMed Central Статья Google ученый

  • 21.

    Cao, D. et al. Идентификация обонятельных генов-кандидатов в Chilo suppressalis с помощью анализа транскриптома антенн. Внутр. J. Biol. Sci. 10 , 846 (2014).

    CAS PubMed PubMed Central Статья Google ученый

  • 22.

    Andersson, M. N. et al. Антеннальный транскриптомный анализ семейств хемосенсорных генов у древесных короедов, Ips typographus и Dendroctonus ponderosae (Coleoptera: Curculionidae: Scolytinae). BMC Genomics 14 , 1–16 (2013).

    Артикул CAS Google ученый

  • 23.

    Liu, S. et al. Идентификация хемосенсорных генов-кандидатов в транскриптоме усиков Tenebrio molitor (Coleoptera: Tenebrionidae). Комп. Biochem. Physiol. D: Genomics Proteomics 13 , 44–51 (2015).

    ADS CAS Статья Google ученый

  • 24.

    Ху, П., Ван, Дж., Цуй, М., Тао, Дж. И Луо, Ю. Анализ антенного транскриптома азиатского усачьего жука Anoplophora glabripennis . Sci. Отчет 6 , 1–12 (2016).

    Артикул CAS Google ученый

  • 25.

    Engsontia, P. et al. Большой нос красного мучного жука: расширенное семейство генов рецепторов запаха в Tribolium castaneum . Insect Biochem.Мол. Биол. 38 , 387–397 (2008).

    CAS Статья Google ученый

  • 26.

    Mitchell, R.F. et al. Секвенирование и характеристика пахучих рецепторов жука-церамбицида Megacyllene caryae . Insect Biochem. Мол. Биол. 42 , 499–505 (2012).

    CAS PubMed PubMed Central Статья Google ученый

  • 27.

    Бин, S.-Y., Qu, M.-Q., Pu, X.-H., Wu, Z.-Z. И Лин, Ж.-Т. Антеннальный транскриптом и анализ экспрессии обонятельных генов у сладкого картофельного долгоносика Cylas formicarius . Sci. Отчет 7 , 1–14 (2017).

    ADS Статья CAS Google ученый

  • 28.

    Antony, B. et al. Идентификация генов, участвующих в приеме запаха и обнаружении у пальмового долгоносика Rhynchophorus ferrugineus , важного карантинного вредителя, с помощью анализа транскриптома усиков. BMC Genomics 17 , 69. https://doi.org/10.1186/s12864-016-2362-6 (2016).

    CAS Статья PubMed PubMed Central Google ученый

  • 29.

    Tang, Q. F. et al. Анализ антенного транскриптома кукурузного долгоносика Sitophilus zeamais : Идентификация и профилирование тканевой экспрессии генов кандидатов-связывающих одорант белков. Arch. Насекомое Biochem. Physiol. 101 , e21542 (2019).

    Артикул CAS Google ученый

  • 30.

    Hallett, R. et al. Феромоны агрегации двух азиатских пальмовых долгоносиков, Rhynchophorus ferrugineus и R. уязвимый . Naturwissenschaften 80 , 328–331 (1993).

    ADS CAS Статья Google ученый

  • 31.

    Peri, E. et al. Rhynchophorus ferrugineus : поведение, экология и общение.в Handbook of Major Palm Pests: Biology and Management , 105–130 (2017).

  • 32.

    Oehlschlager, A., Chinchilla, C. & Gonzalez, L. Оптимизация ловушки с феромонами для американского пальмового долгоносика Rhynchophorus palmarum (L.) . in Proceedings of International Oil Palm Congress 645–660 (Куала-Лумпур, сентябрь 1993 г.).

  • 33.

    Gonzalez, F., Kharrat, S., Rodríguez, C., Calvo, C. & Oehlschlager, A. Исследовательская статья (комплексное управление: насекомые) красный пальмовый долгоносик ( Rhynchophorus ferrugineus Olivier): недавний достижения. Arab J. Pl. Prot. 37 , 178–187 (2019).

    Google ученый

  • 34.

    Hagley, E. A. Роль пальмового долгоносика, Rhynchophorus palmarum , как переносчика красной кольцевой болезни кокосов. I. Результаты предварительных расследований. J. Econ. Энтомол. 56 , 375–380 (1963).

    Артикул Google ученый

  • 35.

    Шиншилла, К. М. Синдром красного кольца-маленького листочка у масличной пальмы и кокоса. Бол. Tec Opo-CB 2 , 113–136 (1988).

    Google ученый

  • 36.

    Гербер К. и Гиблин-Дэвис Р. М. Ассоциация красной кольцевой нематоды и других видов нематод с пальмовым долгоносиком, Rhynchophorus palmarum . J. Nematol. 22 , 143 (1990).

    CAS PubMed PubMed Central Google ученый

  • 37.

    Oehlschlager, A.C., Chinchilla, C., Castillo, G. & Gonzalez, L. Борьба с болезнью красного кольца путем массового отлова Rhynchophorus palmarum (Coleoptera: Curculionidae). Флорида Энтомол. 85 , 507–513 (2002).

    Артикул Google ученый

  • 38.

    Родригес К., Ольшлагер А. и Шиншилла К. Исследование критических компонентов феромонных ловушек Rhynchophorus palmarum . ASD Oil Palm Papers 46 , 15 (2016).

    Google ученый

  • 39.

    Oehlschlager, C. Оптимизация отлова пальмовых долгоносиков и жуков. Acta Hortic. 736 , 347–368. https://doi.org/10.17660/ActaHortic.2007.736.33 (2007).

  • 40.

    Rochat, D. et al. Rhynchophorus ferrugineus : Таксономия, распространение, биология и жизненный цикл. в Handbook of Major Palm Pests: Biology and Management , 69–104 (2017).

  • 41.

    Antony, B. et al. Глобальное профилирование транскриптома и функциональный анализ показывают, что тканеспецифическая конститутивная сверхэкспрессия цитохрома P450s придает толерантность к имидаклоприду у пальмовых долгоносиков на полях финиковых пальм. BMC Genomics 20 , 1-23 (2019).

    CAS Статья Google ученый

  • 42.

    Antony, B., Johny, J. & Aldosari, S. A. Подавление пахнущего белка RferOBP1768 снижает сильное предпочтение пальмового долгоносика ферругинеолу, феромонному соединению основной агрегации. Фронт. Physiol. 9 , 252 (2018).

    PubMed PubMed Central Статья Google ученый

  • 43.

    Antony, B. et al. Феромоновый рецептор глобально инвазивного карантинного вредителя пальмового дерева, красного пальмового долгоносика ( Rhynchophorus ferrugineus ). Мол. Ecol. 30 , 1–15. https://doi.org/10.1111/mec.15874 (2021 г.).

  • 44.

    Nagnan-Le Meillour, P., Франсуа, М.-К. & Jacquin-Joly, E. Идентификация и молекулярное клонирование предполагаемых связывающих запах белков из американского пальмового долгоносика, Rhynchophorus palmarum L .. J. Chem. Ecol. 30 , 1213–1223 (2004).

    CAS Статья Google ученый

  • 45.

    Mortazavi, A., Williams, B.A., McCue, K., Schaeffer, L. & Wold, B. Картирование и количественная оценка транскриптомов млекопитающих с помощью RNA-Seq. Нац. Методы 5 , 621–628 (2008).

    CAS Статья Google ученый

  • 46.

    Симау, Ф. А., Уотерхаус, Р. М., Иоаннидис, П., Кривенцева, Е. В. и Здобавов, Е. М. БУСКО: оценка сборки генома и полноты аннотаций с помощью ортологов с единственной копией. Биоинформатика 31 , 3210–3212 (2015).

    PubMed PubMed Central Статья CAS Google ученый

  • 47.

    Уотерхаус, Р. М. et al. Приложения BUSCO от оценки качества до генного прогнозирования и филогеномики. Мол. Биол. Evol. 35 , 543–548 (2018).

    CAS Статья Google ученый

  • 48.

    Като, К., Розевицки, Дж. И Ямада, К. Д. Онлайн-сервис MAFFT: множественное выравнивание последовательностей, интерактивный выбор последовательностей и визуализация. Бриф. Биоинформ. 20 , 1160–1166 (2019).

    CAS PubMed PubMed Central Статья Google ученый

  • 49.

    Тамура, К., Стечер, Г., Петерсон, Д., Филипски, А., Кумар, С. MEGA6: анализ молекулярной эволюционной генетики, версия 6.0. Мол. Кипятить. Evolut. 30 , 2725–2729 (2013).

    CAS Статья Google ученый

  • 50.

    Эдлер Д., Кляйн Дж., Антонелли А.& Сильвестро, Д. raxmlGUI 2.0 beta: графический интерфейс и инструментарий для филогенетического анализа с использованием RAxML. BioRxiv , 800912 (2019).

  • 51.

    Letunic, I. & Bork, P. Interactive Tree Of Life (iTOL): онлайн-инструмент для отображения и аннотации филогенетического дерева. Биоинформатика 23 , 127–128 (2007).

    CAS Статья Google ученый

  • 52.

    Войтасек, Х., Ханссон, Б.С. и Леал, В. С. Притягивает или отталкивает? — Дело о двух нейронах, одном феромон-связывающем белке и хиральном центре. Biochem. Биофиз. Res. Commun. 250 , 217–222 (1998).

    CAS Статья Google ученый

  • 53.

    Diakite, M. M., Wang, J., Ali, S. & Wang, M.-Q. Идентификация семейств хемосенсорных генов у Rhyzopertha dominica (Coleoptera: Bostrichidae). Банка. Энтомол. 148 , 8–21 (2016).

    Артикул Google ученый

  • 54.

    Vogt, R.G. et al. Семейство генов SNMP насекомых. Insect Biochem. Мол. Биол. 39 , 448–456 (2009).

    CAS Статья Google ученый

  • 55.

    Митчелл, Р. Ф., Шнайдер, Т. М., Шварц, А. М., Андерссон, М. Н. и Маккенна, Д. Д. Разнообразие и эволюция рецепторов запахов у жуков (Coleoptera). Insect Mol. Биол. 29 , 77–91 (2020).

    CAS Статья Google ученый

  • 56.

    Oehlschlager, A.C. et al. Разработка системы отлова на основе феромонов для Rhynchophorus palmarum (Coleoptera: Curculionidae). J. Econ. Энтомол. 86 , 1381–1392 (1993).

    Артикул Google ученый

  • 57.

    Rochat, D. et al. Ecologie chimique des charançons des palmiers, Rhynchophorus spp. (Coleoptera). Oléagineux 48 , 225–236 (1993).

  • 58.

    Ходдл, М. и Ходдл, К. Палмагеддон: продолжается вторжение в Калифорнию южноамериканского пальмового долгоносика. CAPCA Advis 20 , 40–44 (2017).

    Google ученый

  • 59.

    Witzgall, P., Кирш П. и Корк А. Половые феромоны и их влияние на борьбу с вредителями. J. Chem. Ecol. 36 , 80–100 (2010).

    CAS Статья Google ученый

  • 60.

    Venthur, H. & Zhou, J.-J. Рецепторы одоранта и белки, связывающие одорант, как цели борьбы с насекомыми-вредителями: сравнительный анализ. Фронт. Physiol. 9 , 1163 (2018).

    PubMed PubMed Central Статья Google ученый

  • 61.

    Андерссон, М. Н., Килинг, К. И. и Митчелл, Р. Ф. Геномное содержание хемосенсорных генов коррелирует с кругом хозяев у древесных жуков ( Dendroctonus ponderosae, Agrilus planipennis и Anoplophora glabripennis ). BMC Genomics 20 , 1–17 (2019).

    CAS Статья Google ученый

  • 62.

    Yang, H. et al. Молекулярная характеристика, характер экспрессии и лиганд-связывающие свойства гена феромон-связывающего белка из Cyrtotrachelus buqueti . Physiol. Энтомол. 42 , 369–378 (2017).

    CAS Статья Google ученый

  • 63.

    Жакен-Жоли, Э., Фогт, Р. Г., Франсуа, М.-К. & Nagnan-Le Meillour, P. Анализ функциональных характеристик и экспрессии хемосенсорных белков, экспрессируемых в антеннах и феромональных железах Mamestra brassicae . Chem. Чувства 26 , 833–844 (2001).

    CAS Статья Google ученый

  • 64.

    Гу, С.-Х. et al. Функциональные характеристики хемосенсорных белков жука люцерны Adelphocoris lineolatus указывают на их участие в распознавании хозяина. PLoS ONE 7 , e42871 (2012).

    ADS CAS PubMed PubMed Central Статья Google ученый

  • 65.

    Liu, Y.-L., Guo, H., Huang, L.-Q., Pelosi, P. & Wang, C.-Z. Уникальная функция хемосенсорного белка в хоботке двух видов Helicoverpa . J. Exp. Биол. 217 , 1821–1826 (2014).

    Google ученый

  • 66.

    Peng, Y. et al. Идентификация одорант-связывающих белков и хемосенсорных белков в медиаторе Microplitis , а также функциональная характеристика хемосенсорного белка 3. PLoS ONE 12 , e0180775 (2017).

    PubMed PubMed Central Статья Google ученый

  • 67.

    Номура А., Кавасаки К., Кубо Т. и Натори С. Очистка и локализация p10, нового белка, который увеличивается в регенерирующих нимфах ногах Periplaneta americana (американский таракан). Внутр. J. Dev. Биол. 36 , 391–398 (2002).

    Google ученый

  • 68.

    Maleszka, J., Foret, S., Saint, R. & Maleszka, R. Фенотипы, индуцированные РНКи, предполагают новую роль хемосенсорного белка CSP5 в развитии эмбриональных покровов у медоносных пчел ( Apis mellifera ). Dev. Гены. Evol. 217 , 189–196 (2007).

    CAS Статья Google ученый

  • 69.

    Benton, R., Vannice, K. S. & Vosshall, L. B. Существенная роль рецептора, связанного с CD36, в обнаружении феромонов у Drosophila . Природа 450 , 289–293 (2007).

    ADS CAS Статья Google ученый

  • 70.

    Zhang, H.-J. et al. Филогеномический подход к характеристике мембранных белков сенсорных нейронов (SNMP) у чешуекрылых. Insect Biochem. Мол. Биол. 118 , 103313 (2020).

    CAS PubMed PubMed Central Статья Google ученый

  • 71.

    Liu, S. et al. Молекулярная характеристика двух мембранных белков сенсорных нейронов из Chilo suppressalis (Lepidoptera: Pyralidae). Ann. Энтомол. Soc. Являюсь. 106 , 378–384 (2013).

    CAS Статья Google ученый

  • 72.

    Liu, S. et al. Идентификация и характеристика двух мембранных белков сенсорных нейронов из Cnaphalocrocis medinalis (Lepidoptera: Pyralidae). Arch. Насекомое Biochem. Physiol. 82 , 29–42 (2013).

    ADS CAS PubMed PubMed Central Статья Google ученый

  • 73.

    Чжан Дж., Лю Ю., Уокер В. Б., Донг С. Л. и Ван Г. Р. Идентификация и локализация двух мембранных белков сенсорных нейронов из Spodoptera litura (Lepidoptera: Noctuidae). Insect Sci. 22 , 399–408 (2015).

    PubMed PubMed Central Статья CAS Google ученый

  • 74.

    Гиблин-Дэвис, Р. М., Вайслинг, Т. Дж., Эльшлагер, А. и Гонсалес, Л. М. Полевой ответ Rhynchophorus cruentatus (Coleoptera: Curculionidae) на его агрегацию феромона и летучих ферментирующих растений. Флорида Энтомол. 77 , 164–177 (1994).

    CAS Статья Google ученый

  • 75.

    Jaffé, K. et al. Химическая экология пальмового долгоносика Rhynchophorus palmarum (L.) (Coleoptera: Curculionidae): притяжение к растениям-хозяевам и к феромонам агрегации, продуцируемым самцами. J. Chem. Ecol. 19 , 1703–1720 (1993).

    Артикул Google ученый

  • 76.

    Саид И., Рену М., Морин Ж.-П., Феррейра Дж. М. и Рошат Д. Взаимодействие между ацетоином, летучим растением, и феромоном в Rhynchophorus palmarum: поведенческие и обонятельные реакции нейронов. J. Chem. Ecol. 31 , 1789–1805 (2005).

    PubMed PubMed Central Статья CAS Google ученый

  • 77.

    Mansourian, S. & Stensmyr, M. C. Химическая экология мухи. Curr.Opin. Neurobiol. 34 , 95–102 (2015).

    CAS Статья Google ученый

  • 78.

    Андерссон, М. Н., Лёфстедт, К. и Ньюкомб, Р. Д. Обоняние насекомых и эволюция настройки рецепторов. Фронт. Ecol. Evol. 3 , 53 (2015).

    Google ученый

  • 79.

    Caballero-Vidal, G. et al. Машинное обучение расшифровывает химические особенности, чтобы идентифицировать новые агонисты рецептора запаха моли. Sci. Отчет 10 , 1–9 (2020).

    Артикул CAS Google ученый

  • 80.

    Yuvaraj, J. K. et al. Предполагаемые сайты связывания лиганда двух функционально охарактеризованных рецепторов запаха короеда. BMC Biol. 19 , 16 (2021).

  • Долгоносиков на хранящемся зерне

    Джозеф ЛаФорест, Университет Джорджии, Bugwood.org

    Комплекс долгоносиков, рис ( Sitophilus oryza ), зернохранилище ( Sitophilus granarius 161) и кукуруза (161) zeamais ) долгоносики, являются одними из самых разрушительных вредителей зерна, семян и зерновых продуктов, хранящихся в элеваторах и бункерах.Вероятно, они не являются родными для Северной Америки, но занесены в семена, которые поселенцы переносят через порты. Эти долгоносики — вредители зерна во всем мире.

    Описания

    Рисовый долгоносик

    Рисовый долгоносик — это небольшой жук-носорог, который различается по размеру, но в среднем составляет около трех тридцати секунд в длину. Он варьируется от тусклого красно-коричневого до черного и обычно отмечен на спине четырьмя светло-красными или желтыми пятнами. У рисового долгоносика полностью развитые крылья под покровами крыльев, и он может легко летать.Грудь густо ямчатая с точками несколько неправильной формы, за исключением гладкой узкой полосы, идущей вниз посередине спины. Личиночная стадия этого насекомого представляет собой мягкую, белую, безногую, мясистую личинку, которая питается внутренней частью ядра зерна. В зрелом возрасте личинка превращается в голую белую куколку, а затем превращается во взрослого жука.

    Кукурузный долгоносик

    Кукурузный долгоносик — это небольшой жук-носорог, который различается по размеру, в среднем около трех тридцати секунд в длину.Он варьируется от тусклого красно-коричневого до почти черного и обычно отмечен на спине четырьмя светлыми красноватыми или желтоватыми пятнами. Кукурузный долгоносик имеет полностью развитые крылья под покровами крыльев и может легко летать. Грудь густо ямчатая с точками несколько неправильной формы, за исключением гладкой узкой полосы, идущей вниз посередине дорсальной (верхней) стороны. Через несколько дней из яйца вылупляется мягкая, белая, безногая, мясистая личинка, которая питается внутренней частью ядра зерна. Личинка превращается в голую белую куколку, а затем превращается во взрослого жука.Скорость развития кукурузного долгоносика немного ниже, чем у рисового долгоносика. Для прохождения стадии яйца, личинки и куколки требуется минимум тридцать дней.

    Амбарный долгоносик

    Взрослый амбарный долгоносик — это несколько цилиндрический жук длиной около двух десятых дюйма (двух-трех мм). Голова вытянута с отчетливой мордой, простирающейся вниз от головы примерно на четверть длины тела. Долгоносик отполирован от красно-коричневого до черного с ребристыми крыльями и хорошо заметной грудной клеткой с овальными ямками.В отличие от рисового и кукурузного долгоносиков, зерновой долгоносик не умеет летать. Яйцо вылупляется через несколько дней в мягкую, белую, безногую, мясистую личинку, которая питается внутренней частью ядра зерна. Личинка превращается в голую белую куколку, а затем превращается во взрослого жука.

    Истории жизни

    Рисовый долгоносик

    Взрослые рисовые долгоносики живут от четырех до пяти месяцев, и каждая самка за этот период откладывает от 300 до 400 яиц. Самка использует свои сильные челюсти, чтобы прожевать отверстие в зерновом ядре, куда она откладывает единственное яйцо и запечатывает отверстие студенистой жидкостью.В жаркую погоду период развития яйца до взрослой особи может составлять всего 26 дней. Этот период значительно продлевается в прохладную или холодную погоду. Рисовые долгоносики способны летать, и до сбора урожая на поле могут развиться заражения.

    Кукурузный долгоносик

    Кукурузный долгоносик долгое время считался более крупной разновидностью или расой рисового долгоносика, но теперь они признаны отдельным видом. Кукурузный долгоносик немного крупнее, до одной восьмой дюйма (четыре мм) в длину и темнее рисового долгоносика; степень изменчивости внутри каждого вида затрудняет их различение.Грудь кукурузного долгоносика густо и равномерно ямчатая с круглыми точками. Через несколько дней из яйца вылупляется мягкая, белая, безногая, мясистая личинка, которая питается внутренней частью ядра зерна. После завершения личиночных стадий личинка превращается в белую куколку, а затем вырастает во взрослого жука.

    Амбарный долгоносик

    Взрослые амбарные долгоносики живут в среднем от семи до восьми недель. За это время каждая самка откладывает от 50 до 200 белых яиц. Самка использует свои сильные челюсти, чтобы прогрызть небольшое отверстие в зернышке, где она откладывает одно яйцо в отверстие и запечатывает его студенистой жидкостью.В теплую погоду амбарный долгоносик может развиться от яйца до взрослой особи примерно за пять недель. Холодная погода продлевает развитие. Амбарный долгоносик не может летать, поэтому его можно найти там, где хранится зерно, и он перемещается вместе с зараженным зерном.

    Повреждение

    Долгоносики — очень разрушительные вредители зерна. Из трех видов рисовый долгоносик, вероятно, самый коварный, во многом благодаря способности летать. Все три долгоносика развиваются в виде личинок в зернах зерна. Они часто вызывают почти полное разрушение зерна в элеваторах или бункерах, где условия благоприятны и зерно остается нетронутым в течение некоторого времени.Зараженное зерно обычно нагревается на поверхности и может быть влажным, иногда до такой степени, что происходит прорастание. Пшеница, кукуруза, макароны, овес, ячмень, сорго, семена кафра и гречиха — это лишь некоторые из зерновых и продуктов, которыми питаются эти долгоносики.

    Контроль

    Профилактика — лучшая стратегия, позволяющая избежать появления насекомых в хранящемся зерне. Надлежащая дезинфекция бункера перед внесением нового зерна сводит к минимуму потребность в пестицидах. Хорошая санитария предполагает удаление старого зерна и пыли из бункера для зерна и вокруг него.Это включает удаление старого зерна из углов, полов и стен, а также зерна, которое могло просыпаться на внешнюю часть бункера. Любое зерно, оставшееся после опорожнения бункера, может стать источником заражения насекомыми, которые переместятся в новое зерно. После очистки бункера и выполнения всех необходимых ремонтных работ следует обработать поверхность пола и стен как внутри, так и снаружи бункера. Будьте особенно осторожны, чтобы обработать все трещины, щели, участки вокруг дверных проемов и другие места, куда могут спрятаться или проникнуть насекомые.Опрыскайте бункеры за четыре-шесть недель до хранения зерна.

    Перед помещением зерна в бункер его необходимо просеять для удаления мелких частиц и битых зерен. Зерно, помещенное в чистый бункер, следует проверять с интервалом в две недели в теплые месяцы и с интервалом в один месяц в более прохладные месяцы на предмет наличия горячих точек, заплесневелых участков и живых насекомых. Если существует какое-либо из этих условий, зерно следует аэрировать, чтобы снизить уровень влажности и температуру.

    Зерно, которое должно храниться более шести месяцев, может нуждаться в защитном применении одобренного инсектицида.Обработки могут применяться по мере загрузки зерна в бункер с помощью дозатора, откалиброванного для внесения нужных количеств. После того, как зерно будет собрано в бункер и выровнено, можно обработать поверхность, чтобы предотвратить попадание насекомых в зерно на поверхность. Если заражение происходит, несмотря на эти меры предосторожности, необходимо провести фумигацию зерна. Из-за высокой токсичности зарегистрированных фумигантов и технических знаний, необходимых для их правильного использования, для проведения фумигации следует связаться с квалифицированным специалистом по нанесению пестицидов.

    Предупреждение

    Пестициды ядовиты. Прочтите и соблюдайте инструкции и меры безопасности на этикетках. Осторожно обращайтесь и храните в оригинальных емкостях с этикетками в недоступном для детей и домашних животных месте. Немедленно утилизируйте пустые емкости безопасным способом и в месте. Не загрязняйте корм, ручьи или пруды.

    Минимизация трансдукции энергии придает устойчивость к фосфину у рисового долгоносика, Sitophilus oryzae

  • 1.

    Fields, P. G. & White, N.D. Альтернативы обработкам бромистым метилом для хранимых продуктов и карантинных насекомых. Annu Rev Entomol 47 , 331–359, https://doi.org/10.1146/annurev.ento.47.0

    .145217 (2002).

    Артикул CAS PubMed PubMed Central Google ученый

  • 2.

    Даглиш, Дж. Дж., Наяк, М. К. и Павич, Х. Устойчивость к фосфину у Sitophilus oryzae (L.) из восточной Австралии: наследование, приспособленность и распространенность. Journal of Stored Products Research 59 , 237–244, https://doi.org/10.1016/j.jspr.2014.03.007 (2014).

    Артикул Google ученый

  • 3.

    Tang, PA, Duan, JY, Wu, HJ, Ju, XR и Yuan, ML Выбор эталонного гена для определения различий в экспрессии митохондриальных генов в фосфинезависимых и устойчивых к фосфину штаммах Cryptolestes ferrugineus с использованием qRT -PCR. Scientific Reports 7 , 7047, https: // doi.org / 10.1038 / s41598-017-07430-2 (2017).

    Артикул ОБЪЯВЛЕНИЯ CAS PubMed PubMed Central Google ученый

  • 4.

    Konemann, C.E., Hubhachen, Z., Opit, G.P., Gautam, S. & Bajracharya, N. S. Устойчивость к фосфину у Cryptolestes ferrugineus (Coleoptera: Laemophloeidae), собранных из зернохранилищ в США. Оклахома, США. Журнал экономической энтомологии 110 , 1377–1383, https: // doi.org / 10.1093 / jee / tox101 (2017).

    Артикул CAS PubMed PubMed Central Google ученый

  • 5.

    Аффул, Э., Эллиотт, Б., Наяк, М. К. и Филлипс, Т. В. Устойчивость к фосфину в североамериканских полевых популяциях мотылька малой зерновой, Rhyzopertha dominica (Coleoptera: Bostrichidae). Журнал экономической энтомологии 111 , 463–469, https://doi.org/10.1093/jee/tox284 (2018).

    Артикул CAS PubMed PubMed Central Google ученый

  • 6.

    Rafter, M. A., McCulloch, G. A., Daglish, G. J. и Walter, G.H. Развитие устойчивости к фосфину у восприимчивых популяций Tribolium castaneum (Herbst) при различных режимах иммиграции и давления отбора. Evolutionary Applications 10 , 907–918, https://doi.org/10.1111/eva.12493 (2017).

    Артикул CAS PubMed PubMed Central Google ученый

  • 7.

    Chen, Z., Schlipalius, D., Opit, G., Subramanyam, B. & Phillips, T. W. Диагностические молекулярные маркеры устойчивости к фосфину в популяциях США Tribolium castaneum и Rhyzopertha dominica . PLoS One 10 , e0121343, https://doi.org/10.1371/journal.pone.0121343 (2015).

    Артикул CAS PubMed PubMed Central Google ученый

  • 8.

    Като, А. Дж., Эллиотт, Б., Наяк, М. К. и Филлипс, Т. В. Географические различия в устойчивости к фосфину среди североамериканских популяций красного мучного жука (Coleoptera: Tenebrionidae). Journal of Economic Entomology 110 , 1359–1365, https://doi.org/10.1093/jee/tox091 (2017).

    Артикул CAS PubMed PubMed Central Google ученый

  • 9.

    Delcour, I., Spanoghe, P. & Uyttendaele, M. Обзор литературы: Влияние изменения климата на использование пестицидов. Food Research International 68 , 7–15, https://doi.org/10.1016/j.foodres.2014.09.030 (2015).

    Артикул Google ученый

  • 10.

    Kaur, R. et al. . Устойчивость к фосфину в Индии характеризуется вариантом дигидролипоамиддегидрогеназы, который иначе не наблюдается у эукариот. Наследственность (Edinb) 115 , 188–194, https://doi.org/10.1038/hdy.2015.24 (2015).

    Артикул CAS Google ученый

  • 11.

    Нгуен Т. Т., Коллинз П. Дж., Дуонг Т. М., Шлипалиус Д. И. и Эберт П. Р. Генетическая консервация устойчивости к фосфину у рисового долгоносика Sitophilus oryzae (L.). Журнал наследственности 107 , 228–237, https://doi.org/10.1093/jhered/esw001 (2016).

    Артикул CAS PubMed PubMed Central Google ученый

  • 12.

    Коджак, Э. и др. . Определение устойчивости к фосфину у ржавого красного мучного жука, Tribolium castaneum (Herbst.) (Coleoptera: Tenebrionidae) из Турции. Турецкий . Энтомологический журнал 39 , 129–136 (2015).

    Google ученый

  • 13.

    Schlipalius, D. I. et al. . Анализ вариантов сцепления с использованием секвенирования транскриптома de Novo позволяет идентифицировать консервативный ген устойчивости к фосфину у насекомых. Genetics 209 , 281–290, https://doi.org/10.1534/genetics.118.300688%JGenetics (2018).

    Артикул CAS PubMed PubMed Central Google ученый

  • 14.

    Лорини И., Коллинз П. Дж., Даглиш Г. Дж., Наяк М. К. и Павич Х. Обнаружение и характеристика сильной устойчивости к фосфину у бразильской Rhyzopertha dominica (F.) (Coleoptera: Bostrychidae). Наука о борьбе с вредителями 63 , 358–364, https://doi.org/10.1002/ps.1344 (2007).

    Артикул CAS PubMed PubMed Central Google ученый

  • 15.

    Sağlam, Ö., Edde, P. A. и Phillips, T. W. Устойчивость Lasioderma serricorne (Coleoptera: Anobiidae) к фумигации фосфином. Журнал экономической энтомологии 108 , 2489–2495, https://doi.org/10.1093/jee/tov193 (2015).

    Артикул CAS PubMed PubMed Central Google ученый

  • 16.

    Пиментел, М. А. Г., Фарони, Л. Р. Д. А., Сильва, Ф. Х. Д., Батиста, М. Д. и Гуэдес, Р.N. C. Распространение устойчивости к фосфину среди бразильских популяций трех видов насекомых, хранящихся в продуктах. Неотропическая энтомология 39 , 101–107 (2010).

    Артикул CAS PubMed PubMed Central Google ученый

  • 17.

    Hong, K.-J., Lee, W., Park, Y.-J. И Ян, Ж.-О. Первое подтверждение распространения рисового долгоносика Sitophilus oryzae в Южной Корее. Журнал биоразнообразия Азиатско-Тихоокеанского региона 11 , 69–75, https: // doi.org / 10.1016 / j.japb.2017.12.005 (2018).

    Артикул Google ученый

  • 18.

    Шлипалиус Д. И. и др. . Основной метаболический фермент обеспечивает устойчивость к газу фосфину. Наука 338 , 807–810, https://doi.org/10.1126/science.1224951 (2012).

    Артикул ОБЪЯВЛЕНИЯ CAS PubMed PubMed Central Google ученый

  • 19.

    Опит, Г. П., Томс, Э., Филлипс, Т. В. и Пэйтон, М. Е. Эффективность фумигации сульфурилфторидом для борьбы с устойчивыми к фосфину зерновыми насекомыми, поражающими хранимую пшеницу. Журнал экономической энтомологии 109 , 930–941, https://doi.org/10.1093/jee/tov395 (2016).

    Артикул CAS Google ученый

  • 20.

    E, X., Subramanyam, B. & Li, B. Эффективность озона против чувствительных к фосфину и устойчивых штаммов четырех видов насекомых, хранящихся в продуктах. Насекомые 8 , https://doi.org/10.3390/insects8020042 (2017).

  • 21.

    Park, B. S., Lee, B. H., Kim, T. W., Ren, Y. & Lee, S. E. Протеомная оценка взрослых особей Rhyzopertha dominica , устойчивых к фосфину. Экологическая токсикология и фармакология 25 , 121–126, https://doi.org/10.1016/j.etap.2007.10.028 (2008).

    Артикул CAS PubMed PubMed Central Google ученый

  • 22.

    Фукуто, Т. Р. Механизм действия фосфорорганических и карбаматных инсектицидов. Environmental Health Perspectives 87 , 245–254, https://doi.org/10.1289/ehp.