Таблица по обществу линии сравнения: Заполните таблицу.   Линии сравнения         Формационный подход      

Содержание

Заполните таблицу.   Линии сравнения         Формационный подход      

1) Формационный подход — Материальные факторы (прежде всего производство) играют решающую роль в развитиии общества.

Локально — цивилизованный подход — Ценностные установки, мировоззрение играют в развитиии общества не меньшую роль, чем материальные факторы, а в ряде случаев могут стать определяющими.

2) Формационный подход — Общество движется от более низкой к более высокой ступени развития.

Локально — цивилизованный подход — Каждая цивилизация неповторима.

3) Фомационный подход — Главные критерии прогресса связаны с совершенствованием производственных отношений.

Локально — цивилизованный подход — Прогресс относителен, он может охватывать отдельные сферы общества: экономику, технологии. Приминительно к духовной сфере это понятие можно использовать очень ограничено.

4) Формационный подход — Объективные закономерности носят всеобщий характер. Хотя общественные законы прокладывают себе путь через деятельность людей, они непреложны.

Локально — цивилизованный подход — Человек — единственный творец истории, стоит в центре прошлого и настоящего. Познание человека через формы и продукты его деятельности — залог общественно — исторического развития.

 

 

ВЫВОД

 

Формационный подход позволяет

— Увидеть то общее, что было в историческом развитии различных народов

— Представить историю человечества как единый процесс

— Установить определенные закономерности историчесого развития общества

— Предложить определенную переодизацию всемирной истории и истории отдельных стран

Локально — цивилизованный подход позволяет

— Глубоко изучить историю конкретных обществ и народов во всем их многообразии

— Ориентирует на изучение тех сторон общественной жизни, которые обычно выпадают из поля зрения (ценности, национальные особенности, духовая жизнь, психология, менталитет, и д.р.)

— Ставит в центр исследования человеческую деятельность и человека

 

Сравнительная таблица по обществознанию «Типология обществ»

Сравнительная таблица по типологии общества

Линия сравнения

Традиционное (доиндустриальное, аграрное)

Индустриальное

Постиндустриальное (информационное)

Основной фактор производства

Земля

Капитал

Знания, информация

Основная сфера производства

Сельское хозяйство

Промышленность

Сфера услуг

Характерные черты производства

Ручной труд

Широкое применение механизмов, технологий

Автоматизация производства, компьютеризация общества

Социальная структура

Сословия, касты.

Низкая социальная мобильность

Классы.

Высокая социальная мобильность

Страты.

Высокая социальная мобильность

Продолжительность жизни

40-50 лет

Свыше 70 лет

Свыше 70 лет

Взаимодействие с природой

Человек не отделяет себя от природы, не преобразует её

Глобальное, неконтролируемое

Глобальное, контролируемое

Взаимодействие с другими странами

Несущественное

Тесная взаимосвязь

Открытость общества

Политическая жизнь

Преобладание монархических форм правления; отсутствие политических свобод; власть выше закона

Провозглашение политических свобод, равенства перед законом, демократические преобразования

Политический плюрализм, сильное гражданское общество, правовое государство

Духовная жизнь

Традиционные религиозные ценности; преобладает устная передача информации; мало образованных людей; борьба с неграмотностью

Утверждаются новые ценности прогресса, личного успеха, веры в науку; возникновение и лидерство массовой культуры

Особая роль науки, образования; развитие индивидуализированного сознания; непрерывное образование

Основные типы экономических систем (таблица) :: BusinessMan.

ru

Основы финансовых знаний требуются человеку всю жизнь. Для ориентации в сложных вопросах современности уже в восьмом классе изучаются типы экономических систем. Таблица помогает разложить знания по полочкам и запомнить материал.

Определение экономической системы

Словосочетание «экономическая система» имеет несколько значений.

  1. Принятая и функционирующая схема принципов производства товаров, их последующего распределения и обмена, потребления пользователями.
  2. Систематизация экономической жизни.
  3. Вид устройства хозяйственной жизни в обществе, определяющий распределение недостающих ресурсов.

Потребитель и производитель стремятся к противоположным целям. Потребитель – к удовлетворению запросов с минимальными затратами. Производитель – к получению прибыли при уменьшении издержек.

Основные типы систем

Принято выделять три основных типа экономических систем:

1) традиционная;

2) рыночная;

3) командная.

Все чаще стали выделять четвёртый вид – смешанную. Ее также включает таблица «Типы экономических систем». 8 класс — время, когда дети знакомятся с этой информацией. Таблица представляет характеристики каждого вида, отличающиеся друг от друга ответами на главные вопросы экономического производства: что производить, для кого и как.

Традиционный тип

Само название говорит о критерии выделения: изготовление товаров основано на традициях. Принятый в обществе уклад, передающиеся навыки производства лежат в основе экономической системы. Социальные роли человека передаются по наследству, попытки изменить пресекаются и возникают крайне редко. Технологии производства ограничены, не меняются и производимые блага и услуги. Нововведения не приветствуются, так как посягают на подрыв устоявшегося уклада жизни.

Достоинства системы: стабильность, качественность товаров, предсказуемость развития. Её недостатки: отрицание прогресса, движение к застою, беззащитность перед внешними факторами.

В двадцать первом веке на этой ступени экономического развития находятся слаборазвитые страны.

Рыночный тип

При переходе на индустриальный уровень общественного прогресса формируется рыночная система. Она открывает простор для ответов на экономические запросы. Что, для кого и как изготовлять, решает производитель, ориентируясь на цены и спрос на товар. Собственный риск, а не традиционное решение лежит в основе хозяйствования.

Достоинства системы: стремление к прогрессу, свобода деятельности, личная ответственность и заинтересованность в получение прибыли, структура ценообразования. Её недостатки: неравномерность развития (спады и подъёмы), вероятность безработицы, риск, отрицание общественных интересов, ликвидация социальных гарантий.

В большей части стран мира в двадцатом веке установилась рыночная система.

Командный тип

Когда государство берёт на себя право принятия решений по главным экономическим вопросам, происходит переход к командному типу. Каждая производственная структура получает специальную директиву, касающуюся ее хозяйственной деятельности. Инициатива не приветствуется, пресекается. Государственная собственность на средства производства не позволяет быстро реагировать на изменяющиеся потребности членов общества.

Достоинства системы: стабильность, социальные гарантии, предсказуемость на уровне центрального управления, эффективность в перераспределении ресурсов, высокие моральные мотивы к труду. Её недостатки: ответственность центральной власти за составление планов, незаинтересованность трудящихся в итогах трудовой деятельности, дефицит некоторых товаров, жёсткий контроль и учёт.

Распространение система получила в двадцатом веке, классические примеры проявления – это Германия в тридцатые годы и СССР в эпоху функционирования социализма.

Смешанный тип

Попытка взять достоинства рыночной и командной систем и родить нечто новое без недостатков привела к формированию смешанного вида. Сравнив рыночный и командный типы экономических систем, таблица представляет достоинства каждой из них. Регулирование экономики государством гармонично сочетается со свободой производителей в решении главных экономических вопросов. На предпринимателей наложена ответственность за удовлетворение потребностей клиента. Государство призвано проводить социальную, налоговую и антимонопольную политику для роста экономики и улучшения жизни жителей страны.

Функции государства:

  • управление ценами;
  • создание условий для производства общественных благ;
  • антимонопольная деятельность;
  • законотворческая деятельность;
  • защита наиболее бесправных и уязвимых слоев населения;
  • макроэкономический контроль.

Сравнительные таблицы

Чётко показывает сравнение типов экономических систем таблица. Попробуем представить возможные структуры сопоставления достоинств и недостатков каждого типа экономики. Рассмотрим каждый вариант, его плюсы и минусы.

Можно представить в другом виде типы экономических систем. Таблица по обществознанию позволяет выделить основные критерии сравнивания.

Критерии сравнения Традиционная система Рыночная система Командная система
Что производить? Проблемы производства решаются согласно устоявшимся традициям. Товары, обладающие востребованностью. Блага для всего общества.
Для кого производить? Для потребителя конкретного товара. Для многообразия потребителей
Как производить? Решает предприниматель, ориентируясь на получение прибыли. Решают только центральные органы власти в государстве.
Кому принадлежит собственность? Обществу. Преобладает частная собственность, присутствует государственная и групповая. Преобладает государственная собственность.
Какова роль государства в экономике? Государства ещё нет или его роль заключается в сохранении традиций. Отводится роль «ночного сторожа»: охрана границ государства и правопорядка внутри страны. Все определяющие вопросы решаются на государственном уровне.

Такие критерии определяют основные типы экономических систем. Таблица может быть дополнена ещё смешанным видом. Этот тип экономической системы так отвечает на представленные вопросы.

Что производить? Для кого производить? Как производить? Кому принадлежит собственность? Какова роль государства в экономике?
Потребительские товары и общественные блага. Как для конкретных потребителей, так и для всего общества. Государство принимает решение о производстве благ, предприниматель — о выпуске товаров. Равноправие разнообразных видов, преобладание государственной и частной собственности. Регулирование цен; организация и обеспечение производства общественных благ; борьба с монополиями, защита конкуренции; законотворческая деятельность для защиты участников рыночных отношений; защита малоимущих, охрана от влияния внешних факторов всего населения; стимулирование роста и стабилизация экономики.

Можно провести и другие линии сравнения. Типы экономической системы таблица позволяет исследовать всесторонне. Для удобства восприятия она может быть повернута из вертикального в горизонтальное положение, то есть вопросы предстанут в первой горизонтальной строке, а названия типов систем в первом вертикальном столбце.

Дополнительные критерии сравнения

Чтобы углублённо сравнить типы экономических систем, таблица может содержать и другие критерии оценивания. Обычно этот материал подается на более высоком уровне обучения, характерном для старшеклассников или для учащихся, увлекающихся экономикой. Ниже приведены основные типы экономических систем. Таблица критериев позволяет сравнить их с учетом современных реалий.

Объём обобществления производства Вид бюджетного ограничения Преобладание формы собственности
Определяющий принцип хозяйствования Стимулы повышения производительности труда Существование конкуренции
Существование теневой экономики Способы ценообразования Способы контроля объектов производства
Регулирование экономики Обеспечение социальных гарантий Формирование заработной платы

Ответив на эти вопросы, можно всесторонне охарактеризовать типы экономических систем, плюсы и минусы таблица отразит для каждого вида.

Индустриальное постиндустриальное и традиционное общество признаки сравнение (таблица)

Признаки, критерий

Традиционное общество

Индустриальное общество

Постиндустриальное общество

Причина названия

Традиции-главный социальный регулятор; новшества медленны и маломасштабны, носят вынужденный характер.

(Начинается с промышленного переворота) Это общество, основанное на промышленности с гибкими динамичными структурами, для которого характерны: разделение труда, широкое развитие средств массовой коммуникации и высокий уровень урбанизации.

Это общество, в экономике которого в результате научно-технической революции и существенного роста доходов населения приоритет перешёл от преимущественного производства товаров к производству услуг. Производственным ресурсом становятся информация и знания. Научные разработки становятся главной движущей силой экономики. Наиболее ценными качествами являются уровень образования, профессионализм, обучаемость и креативность работника.

Экономическая сфера

Ведущий экономический сектор

Аграрный

Промышленность

Сервис, сфера услуг

Главный фактор производства

Земля

Капитал

Информация и знания

Уровень развития технологий

Рутинный, экстенсивный

Машинный, экстенсивный и интенсивный

Интеллектуальный и интенсивный

Тип хозяйства и хозяйствования

Натуральное хозяйство, производство на заказ, отсутствие рыночных связей

Рынок, товарное производство

Рынок, товарное производство

Принципы хозяйствования

Простое воспроизводство

Экономическая эффективность

Экономическая эффективность

Характер труда

Ручной, индивидуальный

Конвейерный, машинный

Творчески-креативный

Основной вид экспорта

Сырьё

Продукты производства

Услуги, технологии

Преобладающая форма собственности

Общинная, коллективная, государственная

Частная

Интеллектуальная и частная

Воздействие человека на природу

Локальное, неконтролируемое, человек приспосабливается не нарушаю законов природы

Глобальное, человек-покоритель, следовательно возникают глобальные проблемы человечества

Глобальная, но контролируемая (ресурсосберегающие технологии). Воспроизводство природы

Политическая сфера

Форма правления

Абсолютная монархия (самодержавие)

Конституционная монархия (республика)

Ограниченная монархия

Диалог власти и общества

Невозможен, попытки свержения власти

Возможен

Формируется гражданское общество

Разделение властей

Нет

Есть

Есть

Признание и гарантия прав человека

Нет правовых отношений, но есть зарождение права

Есть, Правовое государство (признание прав человека главной ценностью)

Есть, Правовое государство (признание прав человека главной ценностью)

Оппозиция

Острые социально-политические конфликты

Парламентские формы борьбы

Парламентские формы борьбы

Правовая/политическая культура

Патриархальная, подданническая

Активистская культура участия

Активистская культура участия

Политический режим

Авторитарный

Демократический

Демократический

Социальная сфера

Тип социальной культуры

Сословно-кастовая

Классовая

Сложная

Основной стратификационный критерий

Происхождение

Собственность и твоя функция в процессе производства

Знания, профессия

Характер социальной культуры

Замкнутая

Открытая

Открытая

Социальная мобильность

Низкая,нулевая

Высокая

Неограниченная

Значение личности

Нулевое

Высокое

Ценность индивидуальности

Тип семьи

Патриархальная

Нуклеарная (современная)

Нуклеарная (современная)

Социокультурные ценности

Престиж

Доход, карьера и успех

Образование

Урбанизация

Нет

Есть

Есть

Демография

Рост рождаемости

Рост смертности

Продолжительность жизни низакая

Взрыв рождаемости

Смертность низкая

Продолжительность жизни растет

Депопуляция

Смертность низкая

Продолжительность жизни высокая

Главные социальные институты

Церковь, семья, государство

Семья, государство

Семья, наука и образование

Национальная политика

Национальная дифференциация

Национальная дифференциация

Мультикультуризм

Духовная сфера

Тип культуры

Гомогенная(однородная культура)

Гетерогенная(несколько культур)

Гетерогенная(несколько культур)

Уровень образования

Низкий

Высокий

Непрерывное образование

Идеология

Монорелигия общественности

Секуляризация сознания и свобода выбора

Секуляризация сознания и свобода выбора

Мировоззрение

Догматизм,ксенофобия

Плюрализм, толерантность

Плюрализм, толерантность

СМИ

Нет, слухи, сплетни, домыслы

Газеты, ТВ, радио

Главный ресурс, влияющий на общество

Таблица роста и веса детей до двух лет

Все дети разные, и каждый ребенок развивается по-своему. При каждом вашем посещении врача он заполняет таблицу роста ребенка, чтобы убедиться, что малыш развивается нормально. Возможно, поначалу в таблице будет понятно не все, но врач поможет вам разобраться и посоветует, как интерпретировать результаты исходя из вашей конкретной ситуации. Эту статью мы написали, чтобы немного упростить вашу задачу и дать вам несколько общих рекомендаций, как пользоваться таблицей роста ребенка.

Развитие ребенка по месяцам: что собой представляет таблица роста ребенка?

Таблицы роста ребенка — полезный инструмент, который помогает вашему врачу следить за общим состоянием здоровья и развитием ребенка. Благодаря этим таблицам можно сравнить развитие вашего ребенка с развитием других детей того же возраста и пола и следить в динамике, как растет малыш. Для детей младше 24 месяцев существуют следующие показатели развития, на которые обычно ориентируются врачи:

  • Окружность головы (измеряется по самым выступающим местам головы, показывает динамику развития мозга ребенка)

  • Вес по отношению к длине

  • Вес по отношению к возрасту

  • Длина по отношению к возрасту

Существуют разные таблицы для мальчиков и для девочек, а также для детей младше 24 месяцев и старше 2 лет.

Информацию, которая содержится в этих таблицах, врач может также сопоставить с другими показателями развития, сравнить с параметрами членов семьи и проанализировать их по отношению к другим факторам. Эти таблицы можно скачать по следующим ссылкам.

Таблица роста для мальчиков: от рождения до 24 месяцев

  • Таблица веса по отношению к длине и окружности головы по отношению к возрасту для мальчиков

  • Таблица длины и веса по отношению к возрасту для мальчиков

Таблица роста для девочек: от рождения до 24 месяцев

  • Таблица веса по отношению к длине и окружности головы по отношению к возрасту для девочек

  • Таблица длины и веса по отношению к возрасту для девочек

Развитие ребенка по месяцам: когда и как измеряют рост и вес ребенка?

Скорее всего, во время беременности вы уже подобрали педиатра или другого детского специалиста, который будет наблюдать за здоровьем вашего малыша, а первая встреча с врачом состоится, скорее всего, у вас дома через несколько дней после родов или выписки из роддома. Теперь на каждом приеме врач будет измерять и взвешивать малыша. первый месяц жизни ребенка врач наблюдает его еженедельно, а далее ежемесячно, а когда ребенку исполнится год — раз в два-три месяца. Если ребенка нужно осматривать чаще, врач расскажет вам, когда нужно прийти еще раз и когда записаться на следующий прием. О здоровье ребенка можно и нужно спрашивать и у вашего лечащего врача. Каждый прием у специалиста — это еще одна возможность убедиться, что все в порядке и вы отлично справляетесь с обязанностями матери.

Как правило, на приеме врач измеряет:

  • Окружность головы. Головку ребенка измеряют мягкой сантиметровой лентой по самым выступающим частям — от надбровных дуг над ушками и к затылку.

  • Длина. Малыши редко лежат спокойно, поэтому измерить длину их тела — не такая простая задача, но врачи и медсестры прекрасно с этим справляются. Для этого ребенка кладут на стол или специальный ростомер, расправляют ножки и измеряют длину тела от макушки до пяток.

  • Вес. Вам нужно будет распеленать или раздеть малыша, а врач взвесит его на специальных детских весах.

А здесь мы расскажем, что еще могут проверить на регулярных осмотрах:

Как пользоваться таблицей роста ребенка

О том, как интерпретировать результаты измерений, вам подробно расскажет врач, а здесь мы дадим несколько советов, как пользоваться данными таблицы. Параметры детей отличаются в зависимости от пола, так что сравнивать результаты замеров вашего малыша нужно по отдельной таблице для мальчиков или для девочек.

Окружность головы. В верхней части таблицы указан возраст ребенка в месяцах. Номера поставлены не для всех месяцев, но при этом каждый месяц обозначен вертикальной чертой. В левой части указаны значения окружности головы (в дюймах и сантиметрах). Найдите нужное значение для вашего ребенка и отметьте точку пересечения горизонтальной и вертикальной линии. Скореевсего, эта точка будет на графике. Следуйте до конца за линией графика в правую сторону, и на белом фоне будет указана процентная группа, к которой относится ваш ребенок.

Для примера возьмем трехмесячную девочку, окружность головы которой — 40 см. Процентная группа для этой девочки — 50-й процентиль, то есть у половины всех трехмесячных девочек окружность головы больше, а у другой половины — меньше.

Вес по отношению к длине. Найдите значение длины вашего ребенка в нижней части сетки (в дюймах и сантиметрах). В левой части сетки отметьте вес ребенка (в фунтах и килограммах). Отметьте точку пересечения горизонтальной и вертикальной линии на графике. Следуйте до конца за линией графика, чтобы определить, к какой процентной группе относится ваш ребенок.

Для примера возьмем мальчика весом 4,5 кг и длиной 53 см. Этот малыш относится к 90-му процентилю, то есть 90% мальчиков такой же длины весят меньше, а 10% — больше.

Длина по отношению к возрасту. В левой части сетки отметьте значение длины ребенка (в дюймах или сантиметрах), а в нижней части таблицы — возраст в месяцах. Отметьте точку пересечения горизонтальной и вертикальной линии на графике. Следуйте до конца за линией графика — процентная группа будет указана на белом заштрихованном фоне.

Для примера возьмем девочку возрастом 18 месяцев и длиной 76 см. Эта девочка относится к 10-му процентилю, то есть длина тела 10% девочек аналогичного возраста меньше, а 90% — больше.

Вес по отношению к возрасту. В правой части сетки отметьте вес ребенка (в фунтах или килограммах), а в верхней части — возраст. Отметьте точку пересечения горизонтальной и вертикальной линии на графике. Следуйте до конца за линией графика — процентная группа будет указана на белом заштрихованном фоне.

Возьмем для примера мальчика возрастом 12 месяцев и весом 10,4 кг. Этот малыш относится к 75-му процентилю, то есть 75% годовалых мальчиков весят меньше, а 25% — больше.

Как интерпретировать результаты?

В вопросе интерпретации результатов измерений вашего малыша лучше всего довериться врачу. Нужно помнить, что на таблицах показаны усредненные данные для мальчиков и девочек, а диапазон нормальных показателей довольно широк. Не существует какого-то одного стандарта для конкретного ребенка, но в идеале развитие малыша в динамике должно соответствовать графику — рост и вес должны увеличиваться пропорционально друг другу.

Что такое процентили и что они означают?

В таблице роста ребенка показано, к какому процентилю или процентной группе относится ваш малыш по сравнению с другими детьми того же пола и возраста. Процентили представлены в виде графиков. Например, если ваш ребенок относится к 70-му процентилю по длине к возрасту, это означает, что длина тела у 30% всех детей того же пола и возраста будет больше, а у 70% — меньше.

Однако всего лишь один показатель не дает полной информации. Педиатр будет сравнивать несколько различных показателей за различные периоды, проследит тенденцию развития ребенка и сравнит ее с графиком средних значений, показанным на таблице.

Постарайтесь не беспокоиться по поводу какого-то отдельного показателя. Диапазон нормальных значений роста и веса широк, к тому же на развитие ребенка влияет множество индивидуальных факторов: генетика, условия окружающей среды, питание, уровень активности и наличие или отсутствие проблем со здоровьем. Ростовой скачок также происходит у разных детей в разное время. Например, темпы роста для детей на естественном и искусственном вскармливании немного, но отличаются. Как правило, дети, которых кормят грудью, прибавляют в весе медленнее, чем дети на искусственном вскармливании, ростовой скачок и период интенсивного набора веса у которых происходит уже после трех месяцев. Что касается веса, то, как правило, к пяти-шести месяцам он увеличивается вдвое, а к году — втрое. Но лучше всего все вопросы о темпах роста малыша обсудить с педиатром.

По мере роста ребенка меняется и размер подгузников. Чтобы убедиться, что подгузник подходит ребенку и ничего не протекает, сверьтесь с таблицей размера подгузников по отношению к весу.

Что происходит при изменении темпов роста ребенка?

Изменение темпов роста — это не обязательно симптом какого-либо заболевания. Возможно, ваш малыш просто вступил в фазу ростового скачка. Однако иногда такие изменения могут свидетельствовать о наличии проблем, с причиной которых вам поможет разобраться педиатр. Например, если вес или длина вашего ребенка всегда были больше, чем у 40% других детей того же пола и возраста, а сейчас — больше, чем у 80%, это может стать сигналом для педиатра: нужно провести дополнительные исследования и установить причину такого роста. Еще один симптом — неравномерность темпов роста и набора веса. Как правило, темпы роста здорового ребенка, который получает полноценное питание, достаточно предсказуемы. Любое отклонение от таких темпов может стать для врача признаком проблем с питанием, развитием или здоровьем ребенка. И не стоит пугаться: чем раньше врач узнает об этих проблемах, тем быстрее сможет их решить.

Что делать, если показатели роста ребенка существенно больше или меньше средних значений?

Большинство детей относятся к диапазону между 3-м и 97-м процентилем. Однако, если показатели роста ребенка существенно выше или ниже, причина может заключаться в сочетании многих факторов. Например, педиатр обычно сопоставляет данные по другим показателям развития и унаследованный ребенком тип конституции. Одни дети развиваются быстрее, а другие — медленнее, и это нормально. Главное — не волноваться и помнить, что все индивидуально. Если педиатр считает, что у ребенка избыточный или недостаточный вес или что он растет слишком быстро или медленно, не сомневайтесь и не паникуйте, а просто следуйте рекомендациям врача.

Иногда в таблицах роста не так просто разобраться, а результаты измерений могут поставить вас в тупик. Лучше всего не сравнивать малыша с другими, а обращать внимание на индивидуальные особенности его роста. Если врач говорит, что с ребенком все в порядке, нет причин волноваться. Скорее всего, когда вы увидите, насколько вырос ваш ребенок с момента рождения, то придете в восторг (и, возможно, немного удивитесь). А если вы хотите узнать, как обычно растут и развиваются малыши, подпишитесь на ежемесячную рассылку

ВЦИОМ: почти 70% россиян положительно оценили прямую линию с президентом — Общество

МОСКВА, 1 июля. /ТАСС/. Большинство россиян положительно оценивают прошедшую прямую линию с президентом РФ Владимиром Путиным и надеются, что проблемы, обозначенные во время общения, будут решены. Об этом в четверг сообщил руководитель практики политического анализа Всероссийского центра изучения общественного мнения (ВЦОИМ) Михаил Мамонов, представляя исследование, проведенное после прямой линии.

«Очень высокий уровень положительной оценки прошедшего мероприятия в целом, 68% опрошенных заявили, что в целом им понравилась прямая линия, то, как выступал президент, то, как отвечал на вопросы. Это высокий показатель, он выше, чем в 2019 году», — сказал Мамонов в ходе круглого стола на тему «Прямая линия президента РФ как маркер социального запроса».

По словам Мамонова, исследование проводили 30 июня в 10 регионах в ходе групповых дискуссий. «Мы предлагали участникам посмотреть в полном объеме прямую линию, обсудить и оценить», — отметил он, уточнив, что речь пока идет о количественных результатах опроса, которые дают общие тренды. Мамонов отметил, что доля негативной оценки составила 28%, а средний балл мероприятия по десятибалльной шкале — 6,84, что «выше, чем в 2019 году».

«В основе высоких оценок лежал интерес к тому, о чем говорил президент, к тем вопросам, которые задавались. 62% заявили о том, что им было интересно либо все выступление, либо большая часть выступления», — отметил Мамонов. Еще 26% заявили о том, что им было интересна часть выступления, и только 12% участников исследования заявили, что линия в целом была не интересна.

«Мы можем говорить о существенной позитивной динамике по сравнению с 2019 годом (54% опрошенных назвали мероприятие интересным)», — сказал эксперт.

Верят в решение проблем

При оценке эмоционального компонента выступления уровень позитивных отзывов оказался практически в два раза выше уровня негативных, половина респондентов отметили только положительные эмоции при просмотре прямой линии.

«Три доминантные эмоции: надежда, уважение и доверие. 28% назвали только отрицательные эмоции, порядка 20% называли как положительные, так и отрицательные эмоции. В сравнении с 2019 годом мы фиксируем улучшение восприятия», — сказал Мамонов, уточнив, что тогда только положительные эмоции декларировали 47%, только отрицательные — 35% опрошенных.

Наибольшее количество ответов среди отрицательных эмоций набрало беспокойство.

57% участников исследования заявили об актуальности тем прямой линии, о том, что президент говорил о проблемах, которые касаются простых людей. «Показатель также вырос на 4% по сравнению с прошлым общением главы государства с россиянами», — уточнил Мамонов.

По его словам, обратной точки зрения придерживается лишь треть респондентов. «И этот показатель снизился. То есть главная причина высоких оценок — это актуальность в разрезе личной повестки, потому что сейчас по многим нашим исследованиям мы фиксируем фокус на личную проблематику», — сказал Мамонов.

По мнению 62% респондентов, президент понимает проблемы людей, которые принимали участие в исследовании. Противоположное мнение выразили четверть опрошенных. 68% респондентов заявили о том, что президенту было интересно отвечать на вопросы россиян, противоположное мнение высказал лишь каждый шестой участник опроса.

Каждый третий респондент считает, что большинство задач, вопросов и проблем, прозвучавших в ходе прямой линии, будут решены. «Несмотря на то, что 42% заявили о том, что только часть проблем будет решена, в целом мы оцениваем этот показатель как достаточно высокий, потому что россияне — реалисты, понимают, что не все вопросы могут быть решены», — пояснил Мамонов. Сомнения в решении проблем выразили 21% респондентов.

Прямая линия с президентом РФ Владимиром Путиным в этом году продолжалась 3 часа 42 минуты. За это время глава государства ответил на 70 обращений граждан, которые поступили по разным каналам связи. Прямой эфир начался в 12:07 мск и завершился в 15:49 мск. Сообщения от россиян на прямую линию принимались вплоть до окончания программы. По данным телеканала «Россия-24», всего от граждан поступило 2 290 967 вопросов.

Тема 3. Экономические системы и собственность

1.    Экономическая система — установленная и дей­ствующая совокупность принципов, правил, законов, определяющих форму и содержание основных экономи­ческих отношений, которые возникают в процессе про­изводства, распределения, обмена и потребления эконо­мического продукта.

2.    Основные типы экономических систем

Основными проблемами любой экономической систе­мы, функционирующей в рамках ограниченности ресур­сов и возрастающих потребностей, являются вопросы: «Что производить?», «Как производить?», «Для кого производить?».

Линии сравнения

Традиционная

Централизован­ная (командная)

Рыночная

Определе­ние

Способ организа­ции экономиче­ской жизни, ба­зирующийся на отсталой техно­логии, широком распростране­нии ручного тру­да, многоуклад­ности экономики

Способ органи­зации эконо­мической жизни, при котором капи­тал и земля, практически все экономиче­ские ресурсы находятся в собственности государства

Способ орга­низации эко­номической жизни, при котором капи­тал и земля находятся в частной соб­ственности отдельных лиц

Формами собственности

Преимущественно общинные

Преимущественно государственная

Преимущественно частная

Что производить?

Продукты сель­ского хозяйства, охоты, рыболов­ства. Произво­дится мало про­дуктов и услуг. Что произво­дить, определя­ется обычаями и традициями, ко­торые меняются медленно

Определяется группами про­фессионалов: инженеров, экономистов, специалистов по компьюте­рам, предста­вителями промышлен­ности — «пла­новиками»

Определяют сами потреби­тели. Произ­водители про­изводят то, что хотят по­требители, т.е. то, что может быть куплено

Как производить?

Производят так и тем, как и чем производили предки

Определяется планом

Определяют сами произво­дители

Кто полу­чает това­ры и ус­луги?

Большинство людей существу­ет на грани вы­живания. Доба­вочный продукт достается вож­дям или собст­венникам земли, оставшаяся его часть распреде­ляется согласно обычаям

«Плановики», направляемые политически­ми лидерами, определяют, кто и сколько будет получать товаров и ус­луг

Потребители получают столько, сколько хо­тят, произво­дители — при­быль

3.      В реальности существует, а имеет место смешанная экономика, преимущественно командного либо преимущественно рыночного типа.

Смешанная экономика — способ организации эконо­мической жизни, при котором земля и капитал нахо­дятся в частной собственности, а распределение огра­ниченных ресурсов осуществляется как рынками, так и при значительном участии государства. Конкурентно-рыноч­ные стимулы и государственное регулирование экономики сосуществуют, взаимодействуют и влияют друг на друга.

Рыночная сфера:                                          

потребители => свободный обмен => производители

Государственная сфера:                  

производители => государственный план => потребители

4.      Социаль­ная рыночная экономика основана на сбалансированности экономиче­ской и социальной эффективности.

Социальная ориентация рынка – удов­летворение  растущих и меняющих­ся потребностей людей, развитие человеческого потенциала, сосуществование различных форм собственности

Социальная ориентация государства – гарант стабильности и защищенности людей в рыночной экономике (господдержка культуры, образования, науки, здравоохранения, социальная защита пенсионеров, инвалидов, материнства и детства, студентов)

5.      Две основные формы хозяйства: натуральное и товарное.

Натуральное хозяйство – хозяйство, в котором люди производят продукты лишь для удовлетворения своих собственных потребнос­тей, не прибегая к обмену, к рынку (характерно для традиционного типа экономики).

Товарное хозяйство – хозяйство, при котором про­дукты производятся для прода­жи, а связь производителей и потребителей осуществляется посредством рынка (характерно для централизованного (командного), рыночного и сме­шанного типов экономических систем).

6. Собственность (от древнерусск. «собность» — вла­дение вещью или кем-либо) — принадлежность вещей, материальных и духовных ценностей определенным лицам, юридическое право на такую принадлежность и экономические отношения между людьми по поводу при­надлежности, раздела, передела объектов собственности.

  • Собственность – отношения людей по поводу вещей.
  • Суть собственности – присвоение экономических (платных) благ.
  • Быть собственником – значит относиться к вещам как к своим.

 

7. Структура собственности:

  • объект присвоения – вещь, деньги; субъект присвоения – собственник;
  • отношения присвоения – форма реализации отношений собственности;
  • формы присвоения – частная и общественная.

8.    Собственность единство юридического и экономического содержания. Юридическое содержание собст­венности получает экономическую форму реализации.

Юридическое содержание собственности

Экономическое содержание собственности

Собственность – система ограничения доступа к ограниченным ресурсам. Отсюда – пучок прав на собственность (полная собственность). Права на собственность (римское право):

  • Право владения – физическое обладание вещью, полный контроль
  • Право пользования – извлечение полезных свойств вещи. Виды: аренда – право поль­зоваться имущест­вом, не имея права распо­ряжаться

траст (от англ. trust — доверие) – право собственника передавать право уп­равления своим иму­ществом другому ли­цу, без права вмеша­тельства в его действия

  • Право распоряжения – определение «судьбы» вещи, (продажа, дарение, передача по наследству и т.д.)

Права на собственность (сегодня): право управления, право на доход, право на безопасность и др.

Два условия:

  • Кодификация отношений собственности
  • Закрепление отношений в правовых нормах

 

Юридическая классификация собственности (по Конституции РФ):

  • Государственная: федеральная и региональная
  • Муниципальная
  • Частная: индивидуальная и коллективная
  • Функции собственности: владение, распоряжение, контроль.
  • Отношение человека к природе (присвоение, потребление и др.)
  • Отношение человека к себе (неотчуждаемое право на собственный труд и способности)

Экономическая классификация собственности:

•  Общая: первобытно­общинная, семейная, государственная, коллективная;

•  Частная:

  Трудовая: семей­ная, фермерское

хозяйство, инди­видуальная трудо­вая деятельность

  Нетрудовая: ра­бовладельческая, 

  феодальная, бур­жуазно-индивиду­альная

  • Смешанная: акционерная, кооперативная, совместная

9. В современной рыночной экономике различные формы собственности, в том числе множество смешанных форм, таких как, напри­мер, коллективно-частная или государственно-коллек­тивная и др.

10. Государство проводит:

Национализацию  собственности – передача собственнос­ти из частных рук в ру­ки государства.

Приватизацию собственности – передача госсобственности отдельным граж­данам или  юридическим лицам


Таблицы сравнения продуктов, услуг и функций

Сравнение — одно из наиболее важных действий, выполняемых пользователями в Интернете. Во многих случаях это необходимый шаг, прежде чем посетители вашего сайта совершат желаемое действие, например купят ваш продукт, подпишутся на членство, свяжутся с вами или запросят расценки.

Первым шагом к возможности сравнения является предоставление согласованной информации для всех сопоставимых продуктов или услуг. Однако, когда эта информация распределяется по страницам с подробностями, стоимость взаимодействия и когнитивная нагрузка возрастают: пользователи вынуждены запоминать информацию, делать заметки, переключаться между вкладками или открывать несколько окон браузера.

Вот здесь-то и появляется сравнительная таблица — хорошо известный, но часто игнорируемый или неправильно используемый шаблон. В базовой таблице сравнения используются столбцы для продуктов или услуг и строки для атрибутов. Он позволяет быстро и легко сравнивать функции и характеристики каждого предложения.

keurig.com: Типичная сравнительная таблица продуктов

Если вам нужна сравнительная таблица

Таблицы сравнения часто неправильно понимают как инструменты только для электронной коммерции.Это правда, что наиболее распространенные примеры сравнительных таблиц относятся к средним и дорогим потребительским товарам, особенно электронике (например, микроволновые печи, фитнес-трекеры, пылесосы или автомобили). Но сравнительные таблицы одинаково хорошо подходят для услуг, уровней членства, ценовых пакетов, функций программного обеспечения, стоимости обучения , или местоположения . Их можно использовать для сравнения аналогичных товаров от той же организации или для сравнения продуктов одной организации с продуктами конкурента .Таблица сравнения — гораздо более универсальный инструмент, чем можно себе представить.

Чтобы понять, когда вам следует использовать сравнительную таблицу, вы должны сначала подумать, как люди принимают решения.

Когда людям приходится выбирать среди множества альтернатив, трудно сравнивать плюсы и минусы каждой отдельной альтернативы, и в результате они участвуют в принятии решений без компенсации. Чтобы сузить количество альтернатив до управляемой, они обычно используют один жесткий критерий, который перевешивает любые другие соображения.Например, пользователь, желающий купить новый автомобиль, может отфильтровать все автомобили, которые дороже этих 20 000 долларов, даже если некоторые из них могут превосходить бюджет на очень небольшую сумму. Этот нерегулируемый фильтр помогает пользователю ограничить набор результатов до разумного размера.

Когда людям приходится выбирать среди небольшого набора альтернатив (обычно менее 5–7), они обычно принимают компенсационное решение принимая : они смотрят на индивидуальные достоинства каждого и сравнивают их преимущества и недостатки в соответствии с ряд критериев.Люди могут принять отрицательный атрибут в обмен на положительный. Например, пользователь, исследующий новый ноутбук, может захотеть рассмотреть более тяжелый компьютер, если у него лучшее время автономной работы и вычислительная мощность.

Фильтры и фасеты поддерживают принятие решений без компенсации. Напротив, для принятия компенсационных решений лучше всего подходят сравнительные таблицы. Они позволяют пользователям легко видеть и сравнивать несколько важных атрибутов одним взглядом.

Конечно, бывают случаи, когда в сравнительной таблице нет необходимости.В дополнение к ситуации с необязательным принятием решения, описанной выше, вам, вероятно, не понадобится сравнительная таблица, если:

  • Подобные товары не обязательно являются взаимоисключающими. Например, в отличие от микроволновой печи или ноутбука, потребители вряд ли купят только одну рубашку, поэтому Zara не нужно составлять сравнительную таблицу, чтобы пользователи могли видеть несколько рубашек рядом.
  • Товар или услуга просты, и пользователям неинтересно анализировать характеристики.Например, у кофейной кружки не так много значимых, сопоставимых атрибутов. Кто-то, покупающий кофейную кружку в Интернете, может заинтересоваться стилем (и, возможно, размером), но, вероятно, не захочет сравнивать многие атрибуты нескольких кофейных кружек.
  • Товар или услуга дешевы или легко заменяются (например, ручка, бумажные полотенца), и пользователи, скорее всего, будут вести себя удовлетворительно и не будут тратить много времени на анализ альтернатив.
  • Товар или услуга уникальны, и их трудно сравнить с другими.Например, было бы сложно придумать набор атрибутов для сравнения произведений искусства.

За исключением этих исключений, возможности сравнительной таблицы ограничены только вашим воображением. Практически в любое время, когда ваши пользователи захотят выбрать одно из похожих предложений, особенно если на решение влияет несколько факторов, это возможность для сравнительной таблицы.

Типы сравнительных таблиц

Некоторые сравнительные таблицы статические — они содержат предварительно выбранные продукты; другие — , динамический и позволяют пользователям решать, какие элементы они хотят сравнить.Тип, который вам нужен, во многом будет зависеть от размера вашей юниверса продуктов: статические таблицы используются для небольших (до 5 элементов) юниверсов продуктов, а динамические таблицы подходят, когда юниверс продуктов содержит много элементов.

Статический

Если у вас небольшое количество продуктов, которые нужно будет сравнить пользователям, вы можете создать предварительно построенные статические таблицы сравнения . Например, Apple в настоящее время продает только 5 различных моделей Apple Watch, поэтому она предоставляет готовую сравнительную таблицу для пользователей, пытающихся определиться.

apple.com: поскольку доступно всего пять моделей Apple Watch, Apple может предоставить сравнительную таблицу, в которой они все.

Хорошее практическое правило — использовать этот подход, если у вас 5 предложений или меньше, но мы поговорим об ограничении количества сравниваемых элементов позже в этой статье. Статические сравнительные таблицы обычно хорошо подходят для уровней членства или ценовых пакетов.

С такой реализацией сравнительной таблицы вы сможете контролировать, как информация будет отображаться на странице.Например, вы можете изменить копию, чтобы она соответствовала пространственным ограничениям одной ячейки. Однако обратите внимание, что эта реализация не так легко масштабируется, как таблицы динамического сравнения: вам придется обновить таблицу сравнения, если вы предлагаете новый продукт или услугу.

apple.com: убедитесь, что пользователи могут найти статическую сравнительную таблицу, включив ссылку на таблицу в вашу информационную архитектуру рядом с меню продукта. Apple включает ссылку на свою статическую сравнительную таблицу во вторичном меню навигации часов, наряду со ссылками на различные модели Apple Watch.

динамический

Динамические таблицы позволяют пользователям выбирать, какие элементы они хотят видеть в сравнительной таблице. Они подходят для ситуаций, когда ваша продуктовая линейка превышает 5 наименований.

Несмотря на то, что таблицы динамического сравнения хорошо масштабируются по мере увеличения или изменения вашего набора предложений, они обычно реализуются с использованием гибкого макета, и их внешний вид нельзя контролировать так же тщательно, как внешний вид статических таблиц.

Выбор элементов в таблице динамического сравнения. Два популярных способа разрешить пользователям выбирать, какие элементы добавлять в таблицу:

  1. Сравните кнопок или флажков прямо на страницах списков. С помощью этого метода пользователи могут выбрать интересующие их элементы, а затем перейти на динамически созданную страницу сравнения.
Галочки (слева, homedepot.com) и кнопки (справа, lowes.com) — два наиболее распространенных способа, позволяющих пользователям выбирать элементы для интерактивной сравнительной таблицы. Страницы со списком продуктов

имеют тенденцию быть переполненными, поэтому одна из основных проблем для этой реализации — сделать кнопки Сравнить обнаруживаемыми, не оставляя им слишком много места на странице. Самый безопасный вариант — включить кнопки Compare в качестве дополнительных кнопок действий либо вверху и внизу страницы, либо под всеми описаниями продуктов.

delta.com: интерактивный инструмент сравнения Delta открывается только при наведении указателя мыши на продукты. Не скрывайте инструмент сравнения за эффектами наведения.
  1. Прямое манипулирование интересующими объектами . С помощью этого метода пользователи могут щелкнуть или перетащить продукты, которые они хотят добавить в таблицу сравнения. Обычно это действие возможно либо потому, что, как в приведенном ниже примере Garmin, специальный режим Compare отключает обычное значение щелчка по продукту (который обычно переводит пользователей на страницу сведений о продукте), либо потому, что, как в примере Fitbit, На сайте есть специальная страница Сравните .
garmin.com: Garmin имеет кнопку СРАВНИТЬ в верхней части страницы со списком продуктов. Когда эта кнопка нажата, нажатие на продукт добавляет его в сравнительную таблицу, а не на страницу с подробными сведениями о продукте. К сожалению, эта серая призрачная кнопка исчезает в пользовательском интерфейсе и не так легко заметна. fitbit.com: FitBit предлагает 7 моделей фитнес-трекеров. Специальная страница сравнения позволяет пользователям выбирать продукты для сравнения. Обратите внимание, что это решение непрактично, когда ассортимент продуктов большой, и может быть ненужным, если у вас уже есть страницы со списком.

Одним из преимуществ такого подхода к выбору, основанного на прямом манипулировании, является возможность отделить деятельность по сравнению от страницы со списком продуктов, делая это представление визуально более чистым.

Отдельная страница сравнения (например, Fitbit) — хороший вариант, когда у вас недостаточно продуктов или предложений, чтобы оправдать традиционную страницу со списком.

Лучшие практики для сравнительных таблиц

Независимо от того, какой тип сравнительной таблицы вы выберете, следуйте этим рекомендациям , чтобы помочь пользователям принимать решения.

Используйте таблицы сравнения (до 5 позиций)

Таблицы сравнения поддерживают принятие компенсационных решений, в которых люди участвуют только тогда, когда у них есть относительно мало альтернатив, которые следует рассмотреть. Когда необходимо сравнить более 5 элементов, добавьте другие механизмы, такие как фильтры, чтобы помочь пользователям сузить больший набор возможностей до 5 или меньше.

Для статических сравнительных таблиц сделайте ошибку в пользу простоты. Если в статической таблице не может быть не более 5 сопоставимых вариантов, подумайте, должна ли она вообще быть статической сравнительной таблицей.В зависимости от сложности информации, которую вы представляете, даже 5 вариантов может быть слишком много.

Для динамических таблиц особое внимание уделяется тому, будет ли макет изящно масштабироваться до 5 элементов, если у пользователей есть свобода выбора, какими будут эти 5 элементов. Большинство таблиц динамического сравнения допускают только 3–4 элемента. Подумайте, сколько текста необходимо включить в атрибуты и как это повлияет на макет и удобочитаемость.

Также учитывайте размер устройства или браузера пользователя.Возможно, вам придется сократить количество элементов до двух для презентации на мобильном устройстве. С другой стороны, не заставляйте пользователей сравнивать только два элемента за раз, если у вас есть место, чтобы показать больше.

Таблица динамического сравнения Apple для компьютеров Mac излишне ограничивает пользователей возможностью сравнивать два элемента даже при очень большом размере экрана (показанном здесь на мониторе с разрешением 3008×1692).

Каким бы ни был ваш лимит, убедитесь, что вы четко сообщаете его своим пользователям, чтобы избежать путаницы и ошибок.И не забудьте разрешить пользователям удалять элементы из сравнения, поскольку они сужают выбор.

Будьте последовательны

Самая большая проблема с большинством сравнительных таблиц — это не проблема дизайна, а проблема содержания. Когда информация об атрибутах отсутствует, является неполной или несовместимой в аналогичных предложениях, удобные сравнительные таблицы быстро становятся бесполезными. Это особенно проблематично для таблиц динамического сравнения, когда вы имеете дело со многими предложениями с немного разными доступными метаданными.

bestbuy.com: В этой сравнительной таблице показаны атрибуты 4 различных беззеркальных камер, продаваемых Best Buy (две камеры Sony, одна камера Canon и одна камера Panasonic). Метаданные для камеры Panasonic намного богаче, чем для других. Поддерживать единообразие и актуальность метаданных может быть непросто, особенно когда компании продают много продуктов от разных производителей. Однако, если информация не является полной по всем сравниваемым продуктам, ее может вообще не быть в сравнительной таблице. smugmug.com: В этой сравнительной таблице, подробно описывающей особенности четырех уровней членства SmugMug, каждый столбец имеет разные значения для атрибута Реклама и спам: Zip, Zero, Zilch и Nada. Значения в таблице сравнения — не лучшее место для демонстрации индивидуальности вашего сайта — лучше оставить эти значения эквивалентными и не отвлекать пользователей, пока они ищут отличия.

Поддержка сканирования

Сравнение минусов и плюсов различных продуктов — это сложный процесс.Вы хотите, чтобы ваши пользователи могли сосредоточиться на самом главном. Эффективный способ сделать это — упростить поиск в таблице различий, сходств и ключевых слов.

Придерживайтесь стандартной компоновки таблицы: параметры — столбцы, атрибуты — строки, с метками строк слева и метками столбцов сверху. Используйте последовательное выравнивание текста в каждом столбце.

williams-sonoma.com: Уильямс Сонома хорошо классифицирует сковороды для этой статической сравнительной таблицы. К сожалению, горизонтальные заголовки строк нестандартны и затрудняют сканирование.Узкие абзацы под ОТЛИЧИТЕЛЬНОЙ ФУНКЦИЕЙ не поддаются сканированию и не читаются.

При использовании текста в сравнительных таблицах делайте его кратким. По возможности избегайте полных предложений.

Цветовое кодирование также может помочь — либо слегка закрашивая фон каждого столбца, либо раскрашивая текст ячеек. Просто убедитесь, что вы поддерживаете достаточный контраст и не жертвуете удобочитаемостью.

FitBit.com использует разные цвета для отметок в каждом столбце, чтобы помочь пользователям четко различать функции каждого продукта.Такой подход к цветовому кодированию не будет работать так же хорошо для более сложных значений атрибутов, которые нельзя выразить галочками. techsmith.com использует столбцы с цветовой кодировкой, чтобы показать различные функции, доступные в его предложениях программного обеспечения, а также на каких платформах они могут использоваться.

Также важно четко обозначать строки, чтобы пользователи могли легко определить, к какому атрибуту относится ячейка, особенно при использовании символов, таких как галочки, которые не могут быть изолированы друг от друга. Границы строк, затенение строк или дополнительный интервал могут помочь сохранить четкость и разделенность строк.

Заголовки липких столбцов

Особенно при работе с длинными списками атрибутов, занимающими несколько экранов, сохраняйте заголовки столбцов фиксированными по мере прокрутки пользователей. Кратковременная память человека ограничена, и пользователи легко забудут, какая колонка предназначена для какого продукта.

disneyworld.disney.go.com: Disney предлагает динамическую сравнительную таблицу, чтобы помочь своим клиентам сравнивать разные годовые билеты. К сожалению, у него нет фиксированных заголовков столбцов, поэтому пользователи вынуждены запоминать названия столбцов или прокручивать страницу назад, чтобы проверить, какой столбец предназначен для Disney Platinum Plus Pass, а какой — для Disney Platinum Pass.”

Значимые атрибуты

Ваша сравнительная таблица должна включать атрибуты, которые действительно интересуют ваших пользователей. Не следует просто бросать все имеющиеся у вас метаданные в таблицу, потому что это усложнит работу для пользователей.

По возможности старайтесь определять незнакомые термины в контексте и связывать неопределенные атрибуты с чем-то конкретным. Пример этого находится на странице Amazon портативного блока питания Anker.

amazon.com: Таблица сравнения продуктов производителя переводит технические характеристики на язык, понятный среднему потребителю. В сравнительной таблице

Anker есть атрибуты, которые полезны в контексте сравнения портативных аккумуляторов: емкость аккумулятора в мАч, скорость зарядки и вес. Что на самом деле делает эту таблицу для сравнения , так это тот факт, что она преобразует эти атрибуты в вещи, которые будут значимы для среднего потребителя. Емкость аккумулятора составляет «3350 мАч», что примерно соответствует 1,2 «зарядке iPhone 6». Размер «3,5 х 0,9 х 0,9 дюйма» — размер тюбика с помадой.Вес составляет 2,7 унции, что соответствует весу яйца. Среднестатистическому потребителю может быть трудно представить себе, что такое 2,7 унции, но он, вероятно, может представить себе вес яйца.

Еще один эффективный способ сделать неясные атрибуты значимыми — это включить ссылки на дополнительную информацию или контекстные всплывающие подсказки с определениями или уточняющей информацией.

shopify.com: всплывающая подсказка, активируемая при наведении курсора, разъясняет значение атрибутов без добавления дополнительного текста на страницу.

Предоставить пользователям контроль

Даже если вы хорошо сделаете записи для сканирования или закрепите заголовки, пользователям может быть сложно сравнивать продукты со многими атрибутами, особенно когда эти атрибуты охватывают несколько экранов.В таких ситуациях пользователям, возможно, придется прокручивать назад и вперед между разными строками, когда они сравнивают плюсы и минусы разных продуктов.

Чтобы сделать задачу управляемой, рассмотрите возможность разрешить пользователям выбирать, какие атрибуты они хотят отображать в таблице. Сворачиваемые строки — простая реализация этой функции. Кроме того, разрешите пользователям скрывать строки, для которых все предложения похожи, и отображать только различия.

samsung.com: Samsung предлагает широкие возможности настройки в своей динамической таблице сравнения продуктов.Пользователи могут сворачивать или разворачивать категории атрибутов, а также могут выбирать определенные атрибуты, чтобы отображать только те строки, которые им интересны. Однако эта таблица страдает от несовершенного выравнивания столбцов, что затрудняет сканирование. Эта реализация также заходит слишком далеко в настройке и, похоже, является жертвой раздуваемых функций. Непонятно, почему пользователю нужно видеть только сходства при выборе продуктов. crutchfield.com: Crutchfield позволяет пользователям удалять атрибуты, одинаковые для всех сравниваемых параметров, путем нажатия кнопки «Скрыть похожие функции».Если все три динамика имеют одинаковый срок гарантии, это, вероятно, не является полезной информацией для выбора между ними.

Для простых статических сравнительных таблиц рассмотрите возможность представления упрощенной таблицы с теми атрибутами, которые, как вы ожидаете, будут наиболее важны для пользователей, но также обеспечат доступ к более подробной таблице.

smugmug.com: SmugMug представляет для 4 вариантов тарифных планов очень упрощенную таблицу сравнения «с первого взгляда». smugmug.com: гораздо более подробная полная сравнительная таблица доступна на другой странице.

Упростите сравнение для мобильных устройств

Некоторые веб-сайты просто полностью удаляют свои функции сравнения для небольших устройств. Если это вообще возможно, вам следует попытаться поддерживать некоторый уровень сравнения на мобильных устройствах, но маловероятно, что вы сможете отображать более двух элементов одновременно в сравнительной таблице. Помните, что на экранах меньшего размера одновременно будет отображаться меньше строк, и на кратковременную память пользователя будет ложиться большая нагрузка. Поэтому следование предыдущим рекомендациям (особенно обеспечение возможности сканирования записей и предоставление пользователям возможности выбирать, что они хотят отображать) будет еще более важным для мобильных устройств.

Если истинная сравнительная таблица на мобильных устройствах непрактична для ваших предложений, вы можете в качестве альтернативы рассмотреть возможность преобразования таблицы во вкладки или списки для маленьких экранов. Просто помните, что эти форматы также не поддерживают принятие компенсационных решений, потому что пользователи должны помнить атрибуты для каждого продукта, чтобы взвесить за и против.

shopify.com: одна из стратегий, позволяющих заставить сравнительные таблицы работать на мобильных устройствах, — это преобразование столбцов во вкладки. Это означает, что пользователи не могут проводить настоящие параллельные сравнения, как на полной таблице, но, по крайней мере, они смогут переключаться между продуктами более легко, чем если бы им приходилось прокручивать или переключать вкладки мобильного браузера.

Золотое правило сравнительных таблиц

Подводя итог многим рекомендациям, которые мы перечислили здесь: Прежде всего, выполняйте работу для потребителя. Не замедляйте их нестандартными или слишком длинными таблицами с повторяющейся информацией; не просите их держать что-то в памяти; и не заставляйте их использовать термины Google, с которыми они не знакомы.

Думайте о сравнительной таблице как об инструменте, который поможет каждому пользователю найти вариант, который ему подходит, а не как о способе перепродать их.Может возникнуть соблазн манипулировать пользователями, чтобы они купили самый дорогой вариант, но честная презентация будет более прибыльной для вашей компании в долгосрочной перспективе.

Помощь пользователям в выборе решения, которое лучше всего соответствует их потребностям, помогает вам несколькими способами:

  • Не пытайтесь манипулировать своими пользователями, и вы не потеряете их доверие. Многие пользователи обнаруживают манипуляции, которые резко снижают доверие (и, следовательно, убедительность) к вашему сайту.
  • Когда люди покупают то, что им лучше всего, они с большей вероятностью станут довольными покупателями и будут продвигать ваш бренд среди других (также улучшая ваш NPS).
  • Помимо оценки следующего клика, вы должны ценить следующий год: чем больше кто-то ценит свое текущее взаимодействие с вашим сайтом, тем больше вероятность, что он превратится в лояльных пользователей, которые вернутся.

Сделайте решения пользователей максимально простыми : вы будете счастливы, и они будут счастливы.

Для получения дополнительных советов по поддержке когнитивных процессов ваших пользователей, таких как принятие решений, посетите наш однодневный обучающий семинар «Человеческий разум и удобство использования».

Общие сведения о широте и долготе

1. Обсудите со студентами, что они уже знают о картах.
Разделите учащихся на пары. Раздайте каждой паре контурную карту мира и контурную карту Соединенных Штатов. Попросите учащихся обвести знакомые характеристики и подчеркнуть или перечислить незнакомые характеристики. Обсудите с классом, что они уже знают или заметили о картах. Учащиеся могут узнавать очертания стран, указывать на свой штат или регион или определять знакомые водоемы.

2. Познакомьтесь с понятиями широты и долготы.
Попросите учащихся взглянуть на карту США и найти линии, проходящие поперек, вверх и вниз по странице. Скажите учащимся, что линии, проходящие через страницу, — это линии широты, а линии, бегущие вверх и вниз по странице, — это линии долготы. Широта проходит от 0 до 90 ° северной и южной широты. Долгота составляет 0–180 ° восточной и западной долготы. Попросите учащихся написать эти надписи на картах. Спросите студентов, почему они думают, что эти линии могли быть нарисованы на карте.Убедитесь, что они понимают, что это не настоящие линии на земле; они были добавлены на карту, чтобы людям было легче находить места на карте. Укажите градусы широты и долготы, а также схемы чисел по мере удаления от 0 °.

3. Предложите учащимся попрактиковаться в определении широты и долготы.
Попросите учащихся найти примерное местоположение своего города и отметить его точкой. Попросите учащихся подумать, что делать, если место находится не на линии, а между линиями.Модель для студентов, как определить широту и долготу города. Затем нарисуйте еще две точки в других районах страны и попросите учащихся поработать самостоятельно или в парах, чтобы определить приблизительную широту и долготу этих мест. Наконец, попросите учащихся выяснить, какой город находится примерно на 30 ° с.ш., 90 ° з.д. (Новый Орлеан, Луизиана) и какой город находится примерно на 40 ° с.ш., 105 ° з.д. (Денвер, Колорадо).

4. Предложите учащимся найти ориентиры той же широты и долготы, что и их местоположение.
Назначьте каждому учащемуся или паре одно из трех мест: дом, Новый Орлеан или Денвер. Попросите каждую пару найти два ориентира, например города или физические объекты, с той же широтой, что и их местоположение. Затем попросите пары найти два ориентира с той же долготой, что и их местоположение.

5. Обсудите со студентами, почему и когда широта и долгота являются полезными инструментами карты.
Предложите учащимся рассказать, почему широта и долгота являются полезными инструментами карты.Предложите им объяснить, как широта и долгота могут помочь им определить конкретные места. Спросите: Насколько легко или сложно определить местоположение на земном шаре без использования системы координат? Объяснять.

Сравнение Xpert MTB / RIF с анализом линейного зонда для обнаружения монорезистентных к рифампину микобактерий туберкулеза

J Clin Microbiol. 2014 июн; 52 (6): 1846–1852.

Б.А. Форбс, редактор

Отдел клинической микробиологии и молекулярной медицины, Отдел лабораторной медицины, Всеиндийский институт медицинских наук, Нью-Дели, Индия

Автор, отвечающий за переписку.

S.B.R. и П.К. внес равный вклад в эту статью.

Поступило 27.10.2013 г .; Изменения запрошены 26 ноября 2013 г .; Принято 8 марта 2014 г.

Copyright © 2014, Американское общество микробиологов. Все права защищены. Эту статью цитировали в других статьях в PMC.

Abstract

Линейный зондовый анализ (LPA) MTBDR plus и Xpert MTB / RIF были одобрены Всемирной организацией здравоохранения для быстрой диагностики лекарственно-устойчивого туберкулеза. Однако нет ясности относительно превосходства одного над другим.В двойном слепом проспективном исследовании мы оценили эффективность Xpert MTB / RIF на образцах, которые были впервые протестированы LPA в рамках пересмотренной национальной программы борьбы с туберкулезом Индии. Всего было включено 405 образцов мокроты от пациентов с подозрением на лекарственно-устойчивый туберкулез. Из них 285 образцов с положительным мазком были подвергнуты LPA. Семьдесят два (25,8%) образца показали множественную лекарственную устойчивость, 62 (22,2%) показали монорезистентность к рифампину, 29 (10,3%) показали монорезистентность к изониазиду и 116 (41.5%) были панчувствительными. Шесть (2,1%) образцов дали неверные результаты. Из 62 образцов с монорезистентностью к рифампину, полученной с помощью LPA, 38 (61,4%) показали устойчивость к рифампину, а 21 (33,8%) были обнаружены чувствительными к рифампину с помощью Xpert MTB / RIF с использованием версии картриджа G4. Три (4,8%) образца дали ошибку. Из 116 пан-чувствительных образцов только 83 были доступны для тестирования Xpert MTB / RIF; 4 (5,1%) были устойчивыми к рифампину, 74 (94,8%) — чувствительными и 5 (6,0%) показали ошибку. 25 несоответствующих образцов были дополнительно подвергнуты тестированию на лекарственную чувствительность MGIT960.Результаты MGIT960 показали 100% совпадение с результатами LPA, но только 64,4% совпадение с результатами Xpert MTB / RIF. Анализ секвенирования несовпадающих образцов показал соответствие на 91,3% с LPA, но только на 8,7% с анализом Xpert MTB / RIF. Эти результаты показывают, что, используя тестирование Xpert MTB / RIF, мы можем недооценивать бремя лекарственно-устойчивого туберкулеза и указывать на необходимость разработки зондов для конкретной страны, чтобы повысить чувствительность Xpert MTB / RIF.

ВВЕДЕНИЕ

Глобальное бремя туберкулеза (ТБ), особенно с множественной лекарственной устойчивостью (МЛУ), растет и стало серьезной проблемой для здоровья (1).Заболевание, вызываемое Mycobacterium tuberculosis , устойчивым к двум основным противотуберкулезным препаратам, рифампицину (RIF) и изониазиду (INH), известно как МЛУ-ТБ. Такие случаи чаще встречаются среди клинических рецидивов (2). Сообщалось, что M. tuberculosis , устойчивый к RIF, с большей вероятностью будет иметь сопутствующую устойчивость к INH, что делает устойчивость RIF суррогатным маркером МЛУ-ТБ (3). Ранняя диагностика ТБ и быстрое выявление устойчивости к RIF важны для правильного ведения лекарственно-устойчивого ТБ (ЛУ-ТБ) (4).Но, несмотря на значительные усилия, предпринимаемые для увеличения выявления случаев, одна треть новых случаев ТБ по-прежнему не учитывается из-за отсутствия средств быстрой, недорогой и точной диагностики в странах с высоким бременем ТБ (5).

За последние 6 лет были предприняты усилия по совершенствованию и развитию инструментов быстрой диагностики и тестов на лекарственную чувствительность (ТЛЧ) к туберкулезу. В течение этого периода Всемирная организация здравоохранения (ВОЗ) опубликовала 10 программных заявлений по улучшению диагностики туберкулеза, включая использование коммерческих и некоммерческих методов ТЛЧ и внедрение молекулярных методов, таких как линейный зондовый анализ (LPA) и Xpert MTB / RIF. (или GeneXpert) анализ (5).Эти молекулярные методы разработаны для нацеливания на ген rpoB , который состоит из горячей точки длиной 81 п.н. от кодонов с 507 до 533, называемой областью, определяющей устойчивость к рифампину (RRDR) (6). К настоящему времени с помощью секвенирования ДНК в этой области было охарактеризовано более 50 мутаций, но известно, что только точечные мутации в кодонах 526 или 531 вызывают высокий уровень устойчивости к RIF (7). Напротив, мутации в кодонах 511, 516, 518, 522 и 533 вызывают низкий уровень устойчивости к RIF. Мутации, придающие устойчивость к RIF, редко встречаются в других участках гена rpoB (8).

Из двух недавно представленных методов молекулярной диагностики для определения устойчивости к RIF технология LPA основана на обратной гибридизации ДНК на полоске, а анализ Xpert MTB / RIF основан на ПЦР в реальном времени. Гибридизация ДНК на основе полос включает два коммерческих анализа: INNO-LiPA RIF TB (Innogenetics, Гент, Бельгия) и генотип MTBDR plus (Hain Life-Science, Нерен, Германия) (здесь именуется LPA). Оба анализа LPA и Xpert MTB / RIF показали хорошие результаты (чувствительность 98%) для определения устойчивости к RIF по сравнению с золотым стандартом фенотипического ТЛЧ (4).Стандартное время обработки (TAT) для сообщения результатов LPA составляет от 2 до 3 дней в соответствии с руководящими принципами ВОЗ. Анализ Xpert MTB / RIF еще больше улучшил ТАТ, и результаты могут быть получены в течение 3 часов, в зависимости от времени получения образца и отчета о результате. Считается, что эта технология меняет правила игры. Он основан на полувложенной ПЦР в реальном времени и технологии молекулярных маяков, которая выявляет мутаций M. tuberculosis и RIF, вызывающих устойчивость, непосредственно в клинических образцах.Он рекомендуется в основном для использования с образцами с положительным мазком, где, как сообщается, его чувствительность составляет 98%. В образцах с отрицательным мазком / положительным посевом уровень его обнаружения низкий (от 72,5% до 76,9%) (9), хотя его точность может варьироваться от региона к региону из-за различий в циркулирующих штаммах M. tuberculosis (10).

Обе эти технологии хорошо зарекомендовали себя для быстрой диагностики и выявления устойчивости к RIF у M. tuberculosis , но систематическое сравнение этих двух методов с ТЛЧ на основе стандартной жидкой культуры (MGIT960) проводится редко.Насколько нам известно, таких данных по странам с высоким бременем ТБ не публиковалось. Только в одном исследовании эти технологии сравнивались друг с другом по их диагностическим характеристикам, подчеркивая важность положительного и отрицательного мазка образцов (11). Однако до сих пор не было опубликовано ни одного крупного исследования, в котором сравнивались бы эти два анализа с другими золотыми стандартными методами, такими как ТЛЧ культуры MGIT960 и секвенирование ДНК. Вероятно, это связано с тем, что не многие лаборатории имеют все эти возможности одновременно.Сравнение этих двух технологий с золотым стандартом имеет решающее значение для проверки точности каждого теста в местных лабораторных условиях, особенно перед внедрением того или иного метода в программу борьбы с туберкулезом. Здесь мы сообщаем об эффективности и точности Xpert MTB / RIF и LPA в случаях монорезистентности к RIF по сравнению с золотым стандартом ТЛЧ на основе культуры MGIT960 с дальнейшим подтверждением этих результатов с помощью секвенирования гена rpoB .

МАТЕРИАЛЫ И МЕТОДЫ

Клинические образцы.

Всего 405 образцов мокроты (по одному образцу на каждый) от пациентов с подозрением на ЛУ-ТБ в штате Пенджаб, Индия, были получены в лабораторию ТБ Отделения клинической микробиологии и молекулярной медицины Всеиндийского института медицинских наук, Нью-Дели, США. Индия, для тестирования LPA в соответствии с планом программного управления лекарственно-устойчивым туберкулезом (PMDT) пересмотренной национальной программы по борьбе с туберкулезом (RNTCP) (12). Лаборатория аккредитована в качестве промежуточной референс-лаборатории (IRL) для тестирования LPA RNTCP, Индия, и сертифицирована Фондом инновационных новых диагностических средств (FIND) / Stop TB для фенотипического ТЛЧ.Поскольку наблюдения проводились в рамках национальной программы борьбы с туберкулезом, отдельного этического разрешения не требовалось (13).

Обработка проб.

Все образцы мокроты были получены курьерской службой в холодовой цепи и были обработаны с использованием метода N -ацетил-1-цистеин-цитрат натрия-NaOH (NALC-NaOH) (14). После центрифугирования образцы декантировали, а осадки ресуспендировали в 3 мл фосфатного буферного раствора. Из обработанного образца было приготовлено несколько аликвот из расчета на количество исходного образца.Обработанные образцы использовали для окрашивания по Цилю-Нильсену (ZN), культивирования MGIT960 и LPA в соответствии с инструкциями производителей. Оставшиеся аликвоты образцов хранили при -80 ° C для дальнейшего использования и контроля качества.

Анализ линейного зонда.

LPA выполняли согласно протоколу производителя (15). Тест основан на технологии полосок ДНК и состоит из трех этапов: экстракции ДНК, мультиплексной ПЦР-амплификации и обратной гибридизации. Все три этапа были выполнены в соответствии с рекомендациями ВОЗ (16).

Тест Xpert MTB / RIF.

Это исследование было выполнено двойным слепым методом. После получения результатов LPA по монорезистентности к RIF один из нас попросил лиц, ответственных за Xpert MTB / RIF, запустить эти образцы в Xpert MTB / RIF, не раскрывая цели исследования и результатов LPA. Тест Xpert MTB / RIF был проведен с использованием новой версии (G4) картриджей в соответствии с инструкциями производителя (Cepheid, Sunnyvale, CA). Повторному тестированию Xpert MTB / RIF было подвергнуто 145 образцов; из которых 62 были монорезистентными к RIF и 83 были пан-чувствительными к LPA (см. блок-схему).Аликвоты этих деконтаминированных образцов были взяты из хранилища -80 ° C и разморожены, и буфер с реагентами для образцов, содержащий NaOH и изопропанол, был добавлен в соотношении 3: 1 с последующей инкубацией при комнатной температуре в течение 15 минут. Затем два миллилитра образцов были перенесены в картридж Xpert MTB / RIF, и после надлежащего перемешивания картридж был загружен в прибор GeneXpert. Результаты, полученные через 2 часа, были записаны с использованием программного обеспечения версии 4.3. Сообщенные результаты составили M.tuberculosis отрицательный или положительный, с полуколичественной бактериальной нагрузкой, такой как высокая, средняя, ​​промежуточная, низкая или очень низкая, и является ли M. tuberculosis , присутствующий в образце, чувствительным или устойчивым к RIF (17).

Алгоритм и протокол исследования с обобщением результатов LPA, Xpert MTB / RIF, MGIT 960 и секвенирования области гена rpo B.

Культура MGIT960 и ТЛЧ (SIRE MGIT-DST).

SB провела фенотипическое ТЛЧ на несовпадающих образцах.Образец объемом 500 мкл был взят из другой аликвоты очищенного образца и внесен в Bactec-MGIT960. После получения положительного результата в культуре был проведен MGIT-DST на стрептомицин, изониазид, рифампин и этамбутол (SIRE) в соответствии с протоколом производителя (18).

Секвенирование ДНК.

Для дальнейшего подтверждения результатов ТЛЧ MGIT960 ДНК из дискордантных образцов LPA и Xpert MTB / RIF подвергали секвенированию гена rpoB длиной 81 п.н., как описано Campbell et al.(19). Данные последовательности были выровнены и сравнены со штаммом h47Rv0667 M. tuberculosis .

Анализ данных.

Все данные LPA, Xpert MTB / RIF и MGIT 960-DST поддерживались в MS Excel 2007. Согласование результатов LPA и Xpert MTB / RIF было статистически рассчитано, а общая точность результатов для LPA и Xpert MTB / RIF сравнивали с золотым стандартом SIRE MGIT-DST и результатами секвенирования.

РЕЗУЛЬТАТЫ

Анализ линейного зонда.

Из 285 образцов с положительным мазком 6 (2,1%) дали неверные результаты LPA. Из оставшихся 279 образцов 116 (41,5%) были чувствительны как к RIF, так и к INH, 72 (25,8%) имели МЛУ, 29 (10,4%) показали монорезистентность к INH и 62 (22,2%) показали монорезистентность RIF. Таким образом, из 134 образцов, которые имели устойчивость к RIF либо как монорезистентность ( n = 62), либо как часть MDR ( n = 72), только образцы RIF-монорезистентности ( n = 62) были дополнительно проанализированы с помощью Xpert MTB / RIF (и).Картина полос гибридизации зонда дикого типа (WT) rpoB показала, что полоса 8 (WT8) отсутствовала в 37,1% (23/62) RIF-монорезистентных образцах (). Тридцать три (53,2%) образца дали положительные результаты гибридизации с мутационно-специфическими зондами, в которых мутация S531L была наиболее частой (27/33 [81,8%]). Также наблюдались другие мутации, но на низком уровне (D516V [6,06%], H526Y [9,09%] и H526D [3,03%] соответственно).

ТАБЛИЦА 1

Сравнение результатов LPA, Xpert MTB / RIF и MGIT-DST в образцах мокроты

903 LP .4)
Результаты LPA ( n = 145) (№образцов) Количество (%) образцов с указанным результатом в:
Xpert MTB / RIF ( n = 145)
MGIT-DST ( n = 25) a
Устойчивый Восприимчивый Ошибка b Устойчивый Восприимчивый Загрязненный Загрязненный
21 a (35,5) 3 20 (100) 0 1
LPA RIF s (83) 3 (5,4) 74 (94,5) 5 0 3 (100) 1

ТАБЛИЦА 2

Обнаружение мутаций с помощью LPA и Xpert MTB / RIF в рифампин-устойчивом .tuberculosis и сравнение несовпадающего образца с MGIT-DST и секвенирование

904 440 3 (S531L)
Кодоновая область, обнаруженная LPA No.образцов с областью кодона, обнаруженной с помощью LPA ( n = 62) Область кодона, обнаруженная с помощью Xpert MTB / RIF Количество образцов, обнаруженных с помощью Xpert MTB / RIF ( n = 62), составляет a :
Количество образцов, обнаруженных с помощью MGIT-DST ( n = 21), составляет b :
Результаты секвенирования ( n = 20)

8
5

8 Устойчивый
Чувствительный Устойчивый Чувствительный No.(мутация) Нет мутации
W1, 2 (507–513) 1 Зонд A (507–511) 2 0 4 W2 (509–513) 1
W3 (513–517) 1 0
W3,4 (513–519) 1 1
MUT 1 (D516V) 2
W 5,6 (520–525) 1 Зонд C (518–523) 1 0 2 3 Зонд D (523–529) 4 0
MUT 2b (H526D) 1 1
W8 (531–533) 23 Зонд E (529–533) 6 17 16 0 14 (L533P) 27 20 4 4 4 (S531L) 0
Всего 62 21 20 b 18 2

Xpert MTB / RIF.

Из 62 RIF-монорезистентных образцов по LPA 3 (4,83%) образца показали ошибки (2 образца показали ошибки зонда и 1 образец показал неверные результаты). Таким образом, оставшиеся 59 образцов были использованы для дальнейшего анализа. Из этих 59 образцов 38 (64,4%) имели устойчивый к RIF M. tuberculosis , а 21 (35,5%) — чувствительный к RIF M. tuberculosis (и). При сравнительном анализе мутации, обнаруженные четырьмя зондами (A, B, C и D) Xpert MTB / RIF, совпали (100%) с мутациями, обнаруженными LPA в аналогичных областях кодонов.Однако зонд E не гибридизировался в 52% случаев, которые были обнаружены LPA в той же области кодона (с 531 до 533). Это важное наблюдение, которое может указывать на то, что в данном географическом регионе у этого зонда нет никакой пользы или она минимальна.

Из 116 образцов, чувствительных к LPA, 83 образца были доступны для анализа Xpert MTB / RIF, так как другие образцы имели недостаточный объем, необходимый для тестирования. Из них 5 (6,02%) образцов показали ошибки (3 образца показали ошибки зонда и 2 образца показали недопустимые результаты), 74 (94.87%) были восприимчивы, а 4 (5,12%) были устойчивы к RIF (). Таким образом, общее соответствие между LPA и Xpert MTB / RIF составило 64,4% и 94,5% для обнаружения RIF-устойчивых и чувствительных к RIF штаммов, соответственно. 25 (21 + 4) несоответствующих образцов имели скудные оценки мазка ( n = 1), 1+ ( n = 7), 2+ ( n = 10) и 3+ ( n ). = 7) по классификации ВОЗ. В Xpert MTB / RIF 10 образцов показали бактериальную нагрузку как высокую, 9 — как среднюю и 6 — как низкую.

MGIT960 Результаты летнего времени.

M. tuberculosis культур, полученных из 25 несовпадающих образцов LPA и Xpert MTB / RIF, были протестированы методом ТЛЧ культур MGIT960 в качестве золотого стандарта. Из них 21 были LPA RIF r и Xpert MTB / RIF s и 4 были LPA RIF s и Xpert MTB / RIF r . В MGIT960 была заражена одна культура из каждой группы. Из оставшихся 23 изолятов M. tuberculosis все показали соответствие результатам LPA, но значительное несоответствие результатам Xpert MTB / RIF (и).

Результаты секвенирования ДНК.

Для дальнейшего подтверждения результатов ТЛЧ культуры MGIT960 область 81 п.н. гена rpoB была секвенирована в 20 LPA RIF r и Xpert MTB / RIF s и 3 LPA RIF s и Xpert MTB / РИФ р пробы. Для результатов LPA RIF r и Xpert MTB / RIF s секвенирование гена rpoB показало мутации в 18 образцах, но не было обнаружено мутаций в 2 образцах. Интересно, что в 14 образцах была обнаружена редкая точечная мутация в кодоне 533 (CTG на CCG), а в 4 образцах была обнаружена мутация S531L (и).В 3 образцах, которые представляли собой LPA RIF s и Xpert MTB / RIF r , секвенирование гена rpoB не выявило каких-либо мутаций ().

ТАБЛИЦА 3

Анализ секвенирования 23 дискордантных образцов для области 81-bp rpoB a

GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG 9043 7 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
Идентификационный номер образца. Унифицированные последовательности
Н 37 Rv0667 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
27 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
82 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTG ТТГ GCGCTG
121 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG
129 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG
130
144
145 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG
149 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG
171 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG
176
180 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG
209 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTG ТТ G GCGCTG
227 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG
232 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG
233 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTG ТТГ GCGCTG
244 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG
251 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG
252 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG
255 GGC ACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTG TTG GCGCTG
285 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG
293 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
335 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
339 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCG CCG

ОБСУЖДЕНИЕ

Исследования показали, что в странах с высоким бременем ТБ устойчивость к INH очень распространена, а изолят может не быть устойчивым к RIF (13).И наоборот, если изолят устойчив к RIF, более вероятно, что он также устойчив к INH, что делает устойчивость RIF суррогатным маркером для идентификации МЛУ-ТБ (3). Также хорошо известно, что изоляты, несущие мутации между кодонами 526 и 531, демонстрируют высокий уровень устойчивости к RIF и что эти генетические маркеры обладают очень высокой точностью определения устойчивости к RIF (13, 20, 21). Молекулярные технологии, такие как LPA и Xpert MTB / RIF, являются наиболее многообещающими технологиями для обнаружения этих мутаций.Тест LPA выявляет устойчивость к RIF, а также к INH из-за мутаций в генах inhA и katG , тогда как Xpert MTB / RIF может обнаруживать только устойчивость к RIF.

Из 405 проб только 285 (70,3%) были положительными по мазку. Следовательно, наш уровень обнаружения под микроскопом в случаях с подозрением на лекарственно-устойчивый туберкулез заслуживает похвалы. Из 285 образцов с положительным мазком, которые были подвергнуты тесту LPA, 41,5% оказались чувствительными к INH и RIF, в то время как 22,2% образцов показали монорезистентность к RIF, что можно ожидать в такой стране с высоким бременем ТБ, как Индия (8, 13).Значительно более низкие уровни монорезистентности к рифу были зарегистрированы в другой стране с высоким бременем ТБ (Южная Африка [13,5%]) и стране с низким бременем ТБ (США [13%]) (22, 23). В настоящем исследовании высокая устойчивость к RIF могла быть связана с тем, что большинство образцов было получено от пациентов с рецидивом, которые лечились по категории II более 2 месяцев. Это показывает, что эти пациенты не принимали предписанную дозу или лекарство не абсорбировалось оптимально, и это могло привести к положительному отбору устойчивых штаммов M.tuberculosis (13, 24). Как и ожидалось, мутация S531L оказалась наиболее частой (81,8%) мутацией у RIF-монорезистентных штаммов (8). Несколько других исследователей из-за пределов Индии также сообщили о подобных паттернах мутаций (25, 26). Интересно, что редкая мутация в кодоне 533 (CTG в CCG) также была обнаружена в RIF-устойчивых несоответствующих образцах с помощью анализа секвенирования, как сообщалось ранее в нескольких исследованиях (27, –29).

Одной из наиболее важных и очевидных причин использования Xpert MTB / RIF является значительное сокращение времени обработки для обнаружения.Мало того, что ТАТ снижается до 2–3 часов, этот тест также может одновременно определять устойчивость к рифампину (30). Однако после его широкого использования и анализа нескольких сотен тысяч образцов стали появляться сообщения о том, что он может давать ложноотрицательные и ложноположительные результаты устойчивости к RIF (31, –33). Анализатор Xpert MTB / RIF версии G4 был разработан производителями для повышения надежности анализа и снижения вероятности ложных результатов, устойчивых к RIF, а также для улучшения обнаружения мутантов зонда E, которые было трудно обнаружить с помощью версии G3 (34).Аналитическое исследование, проведенное в Южной Африке, показало, что анализ G4 снизил ложные результаты, связанные с устойчивостью к RIF (35). Однако в настоящем исследовании мы не обнаружили, что новая версия настолько улучшена, особенно для Индии. Наше исследование показывает, что только 64,4% случаев RIF-монорезистентного ТБ были правильно диагностированы с помощью Xpert MTB / RIF. Остальные 35,6% случаев были определены как ложно восприимчивые к RIF. В нашем исследовании картриджи новой версии G4 не выявляли мутаций в P533L в области зонда E, что указывает на то, что могут потребоваться дальнейшие улучшения, такие как добавление другого зонда для обнаружения мутаций в кодоне L533P.Кроме того, рекомендуется стандартизация порогового значения цикла отсечки ( C T ) нового зонда и его более широкая валидация, особенно на индийских изолятах.

Анализ секвенирования 23 несоответствующих образцов показал соответствие на 91,3% с LPA, но только на 8,7% с анализом Xpert MTB / RIF. В 2 образцах с помощью секвенирования по Сэнгеру не было обнаружено мутаций. Это можно объяснить тем фактом, что около 5% мутаций устойчивости могут быть пропущены анализом последовательности Сэнгера, но обнаружены LPA, а также фенотипическими методами, такими как MGIT960 DST (36, 37).Тем не менее 94,5% RIF-чувствительных изолятов были правильно обнаружены Xpert MTB / RIF. В Xpert MTB / RIF зонд E (529–533) идентичен области W8 (531–533) LPA. Действительно, он покрывает два дополнительных кодона, но не распознал мутацию в большом количестве (52%) образцов ДНК. Это требует дальнейшего изучения на уровне производителя, сравнивая его с другими конкурирующими, но стандартными методами.

Эти результаты чрезвычайно важны для руководителей национальных программ по борьбе с ТБ, которым необходимо оценить эффективность Xpert MTB / RIF, прежде чем внедрять его в программы борьбы с лекарственно-устойчивым туберкулезом.Мы предлагаем каждой стране провести такую ​​оценочную работу, чтобы подготовить руководство по использованию Xpert MTB / RIF на национальном уровне. Также потребуются исследования, чтобы выяснить причины, по которым Xpert MTB / RIF дает такие высокие ложноположительные результаты по чувствительности к RIF. Эти наблюдения также показывают, что полагаться только на результаты Xpert MTB / RIF может быть катастрофическим шагом для программ борьбы с туберкулезом, поскольку этот тест дает тревожно высокие ложноотрицательные результаты, а устойчивые изоляты M. tuberculosis ошибочно помечаются как чувствительные, поэтому сделать руководителей программ самодовольными и недооценить угрозу МЛУ-ТБ.Ложноотрицательные сообщения об устойчивости к RIF могут заставлять пациентов без надобности принимать препараты первого ряда в течение длительного времени, в результате чего пациенты получают ненадлежащее лечение. Это может привести к усилению и распространению МЛУ и ШЛУ ТБ.

БЛАГОДАРНОСТИ

Мы благодарим Brijesh Kumar, Virendra Kapil и Vinod Kumar (все из Департамента лабораторной медицины AIIMS, Нью-Дели) за их техническую помощь. Мы также благодарим государственного специалиста по борьбе с туберкулезом, Пенджаб, консультанта ВОЗ Приянку Аггарвал и персонал DMC из 9 районов Пенджаба за набор больных туберкулезом и отправку их образцов в хорошем состоянии.Мы благодарим CN Parmasivan, B. Vellopore и Rahul Thakur из FIND (Фонд инновационных новых диагностических средств) за предоставление наборов LPA и принадлежностей в рамках программы PMDT RNTCP и KS Sachdeva из Центрального противотуберкулезного отделения правительства Индии за координацию с Офицер по борьбе с туберкулезом штата Пенджаб.

Мы заявляем, что у нас нет конфликта интересов.

Сноски

Опубликованы досрочно 19 марта 2014 г.

ССЫЛКИ

1. Чианг С.Й., Ван Визенбек К., Мори Т., Энарсон Д.А.2013. Вызовы глобальной борьбе с туберкулезом. Респирология 18: 596–604. 10.1111 / resp.12067 [PubMed] [CrossRef] [Google Scholar] 2. Гобл М., Иземан, доктор медицины, Мэдсен Л.А., Уэйт Д., Акерсон Л., Хобсбург С.Р., мл. 1991 г. Лечение 171 пациента с туберкулезом легких, устойчивым к изониазиду и рифампицину. N. Engl. J. Med. 328: 527–532 [PubMed] [Google Scholar] 3. Сомоскови А., Парсонс Л.М., Салфингер М. 2001 г. Молекулярные основы устойчивости Mycobacterium tuberculosis к изониазиду, рифампицину и пиразинамиду.Респир. Res. 2: 164–168. 10.1186 / rr54 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 4. Бросье Ф., Везирис Н., Трюффо-Перно С., Ярлье В., Сугакофф В. 2006 г. Проведение зондового анализа генотипа линии MTBDR для определения устойчивости к рифампицину и изониазиду у штаммов Mycobacterium tuberculosis с низким и высоким уровнем устойчивости. J. Clin. Microbiol. 44: 3659–3664. 10.1128 / JCM.01054-06 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 5. Lawn SD, Mwaba P, Bates M, Piatek A, Alexander H, Marais BJ, Cuevas LE, McHugh TD, Zijenah L, Kapata N, Abubakar I, McNerney R, Hoelscher M, Memish ZA, Migliori GB, Kim P, Maeurer M , Schito M, Zumla 2013.Достижения в диагностике туберкулеза: анализ Xpert MTB / RIF и будущие перспективы тестирования в местах оказания медицинской помощи. Lancet Infect. Дис. 13: 349–361. 10.1016 / S1473-3099 (13) 70008-2 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 6. Ли Дж., Синь Дж., Чжан Л., Цзян Л., Цао Х., Ли Л. 2012 г. Быстрое обнаружение мутаций rpo B в устойчивых к рифампину M. tuberculosis в образцах мокроты с помощью денатурирующего градиентного гель-электрофореза. Int. J. Med. Sci. 9: 148–156. 10.7150 / ijms.3605 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 7.Ахмад С., Мокаддас Э., Фарес Э. 2002 г. Характеристика мутаций rpo B в устойчивых к рифампину клинических изолятах Mycobacterium tuberculosis из Кувейта и Дубая. Диаг. Microbiol. Заразить. Дис. 44: 245–252. 10.1016 / S0732-8893 (02) 00457-1 [PubMed] [CrossRef] [Google Scholar] 8. Мани С., Селвакумар Н., Нараянан С., Нараянан ПР. 2001 г. Мутации в гене rpoB клинических изолятов Mycobacterium tuberculosis из Индии с множественной лекарственной устойчивостью. J. Clin. Microbiol. 39: 2987–2990. 10.1128 / JCM.39.8.2987-2990.2001 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Беме С.К., Николь М.П., ​​Набета П., Майкл Дж. С., Готуццо Э, Тахирли Р., Глер М. Т., Блейкмор Р., Вородриа В., Грей С., Хуанг Л., Касерес Т., Мехтиев Р., Раймонд Л., Уайтлоу А., Сагадеван К., Александр Х. , Альберт Х., Кобеленс Ф., Кокс Х., Алланд Д., Перкинс, доктор медицины. 2011 г. Осуществимость, диагностическая точность и эффективность децентрализованного использования теста Xpert MTB / RIF для диагностики туберкулеза и множественной лекарственной устойчивости: многоцентровое исследование внедрения.Ланцет 377: 1495–1505. 10.1016 / S0140-6736 (11) 60438-8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 10. Макинен Дж., Марттила Х. Дж., Марьямаки М., Вильянен М.К., Сойни Х. 2006 г. Сравнение двух коммерчески доступных анализов зондов линии ДНК для обнаружения микобактерий туберкулеза с множественной лекарственной устойчивостью. J. Clin. Microbiol. 44: 350–352. 10.1128 / JCM.44.2.350-352.2006 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 11. Барнард М., Гей ван Питтиус, NC, ван Хелден, полицейский, Босман, М., Кутзи, Г., Уоррен, Р.М.2012 г. Диагностические характеристики линейного зондового анализа GenoType MTBDRplus версии 2 эквивалентны анализу Xpert MTB / RIF. J. Clin. Microbiol. 50: 3712–3716. 10.1128 / JCM.01958-12 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 13. Кумар П., Балуни В., Шарма Б.К., Капил В., Сачдева К.С., Сингх С. 2014 г. Высокая степень множественной лекарственной устойчивости и гетерорезистентности у больных легочным туберкулезом из штата Пенджаб в Индии. Туберкулез 94: 73–80. 10.1016 / j.tube.2013.10.001 [PubMed] [CrossRef] [Google Scholar] 14.Kent PT, Kubica GP. 1985 г. Микобактериология общественного здравоохранения: руководство для лаборатории уровня III. Центры по контролю и профилактике заболеваний, Атланта, Джорджия [Google Scholar] 17. Беме СС, Набета П., Хиллеманн Д. 2010 г. Быстрое молекулярное определение туберкулеза и устойчивости к рифампицину. N. Engl. J. Med. 363: 1005–1015. 10.1056 / NEJMoa07 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 19. Кэмпбелл П.Дж., Морлок Г.П., Сайкс Р.Д., Далтон Т.Л., Метчок Б., Старкс А.М., Хукс Д.П., Коуэн Л.С., Пликайтис Б.Б., Поузи Дж.2011 г. Молекулярное обнаружение мутаций, связанных с лекарственной устойчивостью первого и второго ряда, по сравнению с обычным тестированием на лекарственную чувствительность Mycobacterium tuberculosis. Противомикробный. Агенты Chemother. 55: 2032–2041. 10.1128 / AAC.01550-10 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 20. Уильямс Д.Л., Спринг Л., Коллинз Л., Миллер Л.П., Хейфетс Л.Б., Гангадхарам ПР, Гиллис Т.П. 1998 г. Вклад мутаций rpoB в развитие перекрестной устойчивости Mycobacterium tuberculosis к рифамицину.Противомикробный. Агенты Chemother. 42: 1853–1857 [Бесплатная статья PMC] [PubMed] [Google Scholar] 21. Ян Б., Кога Х, Оно Х, Огава К., Фукуда М, Хираката Й, Маэсаки С., Томоно К., Таширо Т., Коно С. 1998 г. Связь между антимикобактериальной активностью рифампицина, рифабутина и мутаций KRM-1648 и rpoB Mycobacterium tuberculosis. J. Antimicrob. Chemother. 42: 621–628. 10.1093 / jac / 42.5.621 [PubMed] [CrossRef] [Google Scholar] 22. Мукинда Ф.К., Терон Д., ван дер Спуй Г.Д., Якобсон К.Р., Рошер М., Штрейхер Е.М., Мусекива А., Кутзи Г.Дж., Виктор Т.К., Марэ Б.Дж., Начега Дж.Б., Уоррен Р.М., Шааф Х.С.2012 г. Рост заболеваемости монорезистентным к рифампицину туберкулезом в Западной Капской провинции, Южная Африка. Int. J. Tuberc. Lung Dis. 16: 196–202. 10.5588 / ijtld.11.0116 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 23. Ридзон Р., Уитни Г.К., Маккенна М.Т., Тейлор Дж. П., Ашкар С.Х., Нитта А.Т., Харви С.М., Валуэй С., Вудли С., Кукси Р., Онорато И.М. 1998 г. Факторы риска монорезистентного к рифампину туберкулеза. Являюсь. J. Respir. Крит. Care Med. 157: 1881–1884. 10.1164 / ajrccm.157.6.9712009 [PubMed] [CrossRef] [Google Scholar] 25. де Оливейра М.М., да Силва Роша А., Кардосо Олеманн М., Гомес Х.М., Фонсека Л., Вернек-Баррето А.М., Валим А.М., Россетти М.Л., Россау Р., Мийс В., Вандерборгт Б., Суффис П.2003 г. Быстрое обнаружение устойчивости к рифампицину у изолятов Mycobacterium tuberculosis от бразильских пациентов с использованием анализа с обращенной фазой гибридизации. J. Microbiol. Методы 53: 335–342. 10.1016 / S0167-7012 (02) 00253-1 [PubMed] [CrossRef] [Google Scholar] 26. Хиллеманн Д., Вайценеггер М., Кубица Т., Рихтер Э., Ниманн С. 2005 г. Использование анализа генотипа MTBDR для быстрого выявления устойчивости к рифампицину и изониазиду в изолятах Mycobacterium tuberculosis complex. J. Clin. Microbiol. 43: 3699–3703.10.1128 / JCM.43.8.3699-3703.2005 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 27. Сингх А., Гопинатх К., Сингх Н., Сингх С. 15 Ноябрь 2013. Расшифровка последовательных событий во время приобретения inivo устойчивых к лекарствам микобактерий туберкулеза. Int. J. Mycobacteriol. 10.1016 / j.ijmyco.2013.10.006 [PubMed] [CrossRef] [Google Scholar] 28. Ма Х, Ван Х, Дэн И, Лю З, Сюй И, Пэн Х, Мюссер Дж. М., Грависс Э. А. 2006 г. мутации гена rpoB и молекулярная характеристика устойчивых к рифампину изолятов Mycobacterium tuberculosis из провинции Шаньдун, Китай.J Clin Microbiol. 44: 3409–3412. 10.1128 / JCM.00515-06 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 29. Чавушоглу С., Хилмиоглу С., Гунери С., Билгич А. 2002 г. Характеристика мутаций rpoB в устойчивых к рифампину клинических изолятах Mycobacterium tuberculosis из Турции с помощью секвенирования ДНК и анализа линейных зондов. J. Clin. Microbiol. 40: 4435–4438. 10.1128 / JCM.40.12.4435-4438.2002 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 30. Miotto P, Piana F, Penati V, Canducci F, Migliori GB, Cirillo DM.2006 г. Использование анализа генотипа MTBDR для молекулярного определения устойчивости к рифампицину и изониазиду в клинических штаммах Mycobacterium tuberculosis, выделенных в Италии. J. Clin. Microbiol. 44: 2485–2491. 10.1128 / JCM.00083-06 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 31. Хиллеман Д., Руш-Гердес С., Беме С., Ритчтер Э. 2011 г. Быстрое молекулярное обнаружение внелегочного туберкулеза с помощью автоматизированной системы GeneXpert MTB / RIF. J. Clin. Microbiol. 49: 1202–1205. 10.1128 / JCM.02268-10 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 32.Марлоу Е.М., Новак Уикли С.М., Кумпио Дж., Шарп С.Е., Момени М.А., Бабст А., Карлсон Дж. С., Кавамура М., PandoriM 2011 г. Оценка теста Cepheid Xpert MTB / RIF для прямого обнаружения комплекса Mycobacterium tuberculosis в респираторных образцах. J. Clin. Microbiol. 49: 1621–1623. 10.1128 / JCM.02214-10 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 33. Сомоскови А., Деггим В., Чиардо Д., Блумберг Г.В. 2013. Диагностические последствия противоречивых результатов, полученных с помощью анализа Xpert MTB / RIF при обнаружении изолятов Mycobacterium tuberculosis с мутацией rpoB, связанной с низким уровнем устойчивости к рифампину.J. Clin. Microbiol. 51: 3127–3129. 10.1128 / JCM.01377-13 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 35. Стивенс В. 2012 г. Анализ необходимого интерфейса между молекулярными диагностическими тестами и традиционной микобактериологией. 43-я Всемирная конференция Союза по здоровью легких, Куала-Лумпур, Малайзия [Google Scholar] 36. Folkvardsen DB, Vibeke O, Thomsen Rigouts Leen Rasmussen EM, Bang D, Bernaerts G, Werngren J, Toro JC, Hoffner S, Hillemann D, Svensson E. 2013. Гетереорезистентность к рифампицину в культурах Mycobacterium tuberculosis, выявленная методами определения фенотипической и генотипической лекарственной чувствительности.J. Clin. Microbiol. 51: 4220–4222. 10.1128 / JCM.01602-13 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 37. Folkvardsen DB, Svensson E, Thomsen V, Rasmussen EM, Bang D, Werngren J, Hoffner S, Hillemann D, Rigoutsd L. 2013. Могут ли молекулярные методы обнаружить 1% -ную устойчивость Mycobacterium tuberculosis к изониазиду? J. Clin. Microbiol. 51: 1596–1599. 10.1128 / JCM.00472-13 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Мета-анализ стандартных методов лечения на уровне пациентов по результатам восьми клинических испытаний рака простаты

  • 1

    Jemal, А.и другие. Глобальная статистика рака. CA: онкологический журнал для врачей 61 , 69–90 (2011).

    Google Scholar

  • 2

    Хэнкс, Г. Э., Хэнлон, А. Л., Эпштейн, Б. и Хорвиц, Э. М. Дозовая реакция при раке простаты с периодом наблюдения 8–12 лет. Международный журнал радиационной онкологии, биологии, физики 54 , 427–435 (2002).

    Артикул Google Scholar

  • 3

    Freedland, S.J. et al. Риск смерти от рака простаты в результате биохимического рецидива после радикальной простатэктомии. Джама 294 , 433–439 (2005).

    CAS Статья Google Scholar

  • 4

    Bolla, M. et al. Долгосрочные результаты немедленного подавления андрогенов и внешнего облучения у пациентов с местнораспространенным раком простаты (исследование EORTC): рандомизированное исследование III фазы. Ланцет 360 , 103–106 (2002).

    CAS Статья Google Scholar

  • 5

    Пилепич М.В. и др. Адъювант супрессии андрогенов к радикальной лучевой терапии рака простаты — отдаленные результаты фазы III RTOG 85-31. Международный журнал радиационной онкологии, биологии, физики 61 , 1285–1290 (2005).

    CAS Статья Google Scholar

  • 6

    Кроуфорд, Э.D. et al. Контролируемое испытание лейпролида с флутамидом и без него при карциноме простаты. Медицинский журнал Новой Англии 321 , 419–424 (1989).

    CAS Статья Google Scholar

  • 7

    Шарифи, Н., Галли, Дж. Л. и Дахут, В. Л. Андрогенная депривационная терапия рака простаты. Джама 294 , 238–244 (2005).

    CAS Статья Google Scholar

  • 8

    Денмид, S.Р. и Исаакс, Дж. Т. История лечения рака простаты. Природные обзоры. Рак 2 , 389–396 (2002).

    CAS Статья Google Scholar

  • 9

    Eisenberger, M. A. et al. Двусторонняя орхиэктомия с флутамидом или без него при метастатическом раке простаты. Медицинский журнал Новой Англии 339 , 1036–1042 (1998).

    CAS Статья Google Scholar

  • 10

    Зеленая, А.K. et al. Инициатива Project Data Sphere: ускорение исследований рака путем обмена данными. Онколог 20 , 464 – e20 (2015).

    Артикул Google Scholar

  • 11

    Hede, K. Сфера данных проекта, чтобы сделать данные клинических испытаний рака общедоступными. Журнал Национального института рака 105 , 1159–1160 (2013).

    Артикул Google Scholar

  • 12

    Нисен, П.& Rockhold, F. Доступ к данным на уровне пациентов из клинических испытаний GlaxoSmithKline. Медицинский журнал Новой Англии 369 , 475–478 (2013).

    Артикул Google Scholar

  • 13

    Tannock, I. F. et al. Доцетаксел плюс преднизон или митоксантрон плюс преднизон при запущенном раке простаты. Медицинский журнал Новой Англии 351 , 1502–1512 (2004).

    CAS Статья Google Scholar

  • 14

    Mohler, J.и другие. Руководство NCCN по клинической практике в онкологии: рак простаты. Журнал Национальной комплексной онкологической сети: JNCCN 8 , 162–200 (2010).

    CAS Статья Google Scholar

  • 15

    Грин, А. К. и др. Сравнительная эффективность митоксантрона в сочетании с преднизоном по сравнению с одним преднизоном при метастатическом кастратрезистентном раке простаты после неэффективности применения доцетаксела. Онколог 20 , 516–522 (2015).

    CAS Статья Google Scholar

  • 16

    Tannock, I. F. et al. Химиотерапия митоксантроном в сочетании с преднизоном или только преднизоном при симптоматическом гормонорезистентном раке простаты: канадское рандомизированное исследование с паллиативными конечными точками. Журнал клинической онкологии: официальный журнал Американского общества клинической онкологии 14 , 1756–1764 (1996).

    CAS Статья Google Scholar

  • 17

    Таннок, И.и другие. Лечение метастатического рака предстательной железы низкими дозами преднизона: оценка боли и качества жизни как прагматических показателей ответа. Журнал клинической онкологии: официальный журнал Американского общества клинической онкологии 7 , 590–597 (1989).

    CAS Статья Google Scholar

  • 18

    Особа Д., Таннок И. Ф., Эрнст Д. С. и Невилл А. Дж. Качество жизни, связанное со здоровьем, у мужчин с метастатическим раком простаты, получавших только преднизон или митоксантрон и преднизон. Журнал клинической онкологии: официальный журнал Американского общества клинической онкологии 17 , 1654–1663 (1999).

    CAS Статья Google Scholar

  • 19

    Kantoff, P. W. et al. Гидрокортизон с митоксантроном или без него у мужчин с гормонорезистентным раком простаты: результаты исследования рака и лейкемии группы B 9182. Журнал клинической онкологии: официальный журнал Американского общества клинической онкологии 17 , 2506–2513 (1999).

    CAS Статья Google Scholar

  • 20

    Мур, М. Дж. И др. Использование паллиативных конечных точек для оценки эффектов митоксантрона и низких доз преднизона у пациентов с гормонально-резистентным раком простаты. Журнал клинической онкологии: официальный журнал Американского общества клинической онкологии 12 , 689–694 (1994).

    CAS Статья Google Scholar

  • 21

    Гомелла, Л.G. Эффективное подавление тестостерона при раке простаты: есть ли лучшая терапия кастрации? Обзоры по урологии 11 , 52–60 (2009).

    PubMed PubMed Central Google Scholar

  • 22

    Бьяр Д. П. Лечение рака простаты: исследования совместной урологической исследовательской группы Управления по делам ветеранов. Бюллетень Нью-Йоркской медицинской академии 48 , 751–766 (1972).

    CAS PubMed PubMed Central Google Scholar

  • 23

    Блэкард К. Э., Байар Д. П. и Джордан У. П. Младший Орхиэктомия при запущенном раке предстательной железы. Переоценка. Урология 1 , 553–560 (1973).

    CAS Статья Google Scholar

  • 24

    Hussain, M., Wolf, M., Marshall, E., Crawford, ED & Eisenberger, M. Влияние продолжающейся андрогенной депривации и других прогностических факторов на ответ и выживаемость в исследованиях химиотерапии II фазы для гормонов -рефрактерный рак простаты: отчет Юго-западной онкологической группы. Журнал клинической онкологии: официальный журнал Американского общества клинической онкологии 12 , 1868–1875 (1994).

    CAS Статья Google Scholar

  • 25

    Potosky, A. L. et al. Исходы качества жизни после первичной терапии депривацией андрогенов: результаты исследования исходов рака простаты. Журнал клинической онкологии: официальный журнал Американского общества клинической онкологии 19 , 3750–3757 (2001).

    CAS Статья Google Scholar

  • 26

    Кларк, Дж. А., Рэй, Н. П. и Эштон, К. М. Жизнь с решениями о лечении: сожаления и качество жизни среди мужчин, лечившихся от метастатического рака простаты. Журнал клинической онкологии: официальный журнал Американского общества клинической онкологии 19 , 72–80 (2001).

    CAS Статья Google Scholar

  • 27

    Самсон, Д.J. et al. Систематический обзор и метаанализ монотерапии в сравнении с комбинированной андрогенной блокадой у пациентов с запущенной карциномой простаты. Рак 95 , 361–376 (2002).

    CAS Статья Google Scholar

  • 28

    Крумхольц, Х. М. и Петерсон, Э. Д. Открытый доступ к данным клинических испытаний. Джама 312 , 1002–1003 (2014).

    CAS Статья Google Scholar

  • 29

    Ло, Б.Обмен данными клинических испытаний: максимизация преимуществ, минимизация рисков. Джама 313 ​​, 793–794 (2015).

    CAS Статья Google Scholar

  • 30

    Розенблатт, М., Джайн, С. Х. и Кэхилл, М. Обмен данными клинических испытаний: преимущества, риски и единые принципы. Анналы внутренней медицины 162 , 306–307 (2015).

    Артикул Google Scholar

  • 31

    Росс, Дж.С., Леман, Р. и Гросс, К. П. Важность обмена данными клинических испытаний: к более открытой науке. Обращение. Качество сердечно-сосудистой системы и исходы 5 , 238–240 (2012).

    Артикул Google Scholar

  • 32

    Комитет Национального исследовательского совета (США) по основам для разработки новой таксономии болезней. в На пути к точной медицине: создание сети знаний для биомедицинских исследований и новой таксономии болезней (National Academies Press, 2011).

  • 33

    Чавла, Н. В. и Дэвис, Д. А. Использование больших данных в персонализированном здравоохранении: система, ориентированная на пациента. Журнал общей внутренней медицины 28 Приложение 3, S660 – S665 (2013).

    Артикул Google Scholar

  • 34

    Shaikh, A.R. et al. Совместная биомедицина в эпоху больших данных: случай рака. Журнал медицинских интернет-исследований 16 , e101 (2014).

    Артикул Google Scholar

  • 35

    Американский объединенный комитет по раку. в Руководство по стадированию рака , 6-е изд., 309–316 (Springer, 2002).

  • 36

    Пакет для анализа выживаемости в S. v. 2.38 . http://CRAN.R-project.org/package=survival (2015).

  • Лечение гипергликемии при диабете 2 типа, 2018. Консенсусный отчет Американской диабетической ассоциации (ADA) и Европейской ассоциации по изучению диабета (EASD)

    Введение

    Цели лечения диабета 2 типа: для предотвращения или отсрочки осложнений и поддержания качества жизни (рис.1). Это требует контроля гликемии и факторов риска сердечно-сосудистых заболеваний, регулярного наблюдения и, что важно, подхода, ориентированного на пациента, для повышения вовлеченности пациента в деятельность по уходу за собой (1). Тщательное рассмотрение факторов и предпочтений пациента должно влиять на процесс индивидуализации целей и стратегий лечения (2, 3).

    Рисунок 1

    Цикл принятия решений для ориентированного на пациента управления гликемией при диабете 2 типа.

    В этом консенсусном отчете рассматриваются подходы к управлению гликемией у взрослых с диабетом 2 типа с целью уменьшения осложнений и поддержания качества жизни в контексте комплексного управления рисками сердечно-сосудистых заболеваний и ухода, ориентированного на пациента.Принципы того, как этого можно достичь, кратко изложены на рис. 1 и лежат в основе подхода к лечению и уходу. Эти рекомендации обычно не применимы к пациентам с моногенным диабетом, вторичным диабетом или диабетом 1 типа, а также к детям.

    Источники данных, поиск и выбор исследований

    Авторская группа приняла за отправную точку издания 2012 г. (4) и 2015 г. (5) этого заявления. Для выявления новых доказательств в PubMed был проведен поиск рандомизированных клинических испытаний (РКИ), систематических обзоров и метаанализов, опубликованных на английском языке в период с 1 января 2014 года по 28 февраля 2018 года; соответствующие публикации изучали эффективность или безопасность фармакологических или нефармакологических вмешательств у взрослых с сахарным диабетом 2 типа.Списки литературы были отсканированы в соответствующих отчетах, чтобы определить дополнительные статьи, относящиеся к предмету. Подробная информация о ключевых словах и стратегии поиска доступна на https://doi.org/10.17632/h5rcnxpk8w.1. Статьи были сгруппированы по тематике, и авторы рассмотрели эти новые доказательства, чтобы сформировать согласованные рекомендации. Проект согласованных рекомендаций был рассмотрен коллегами (см. «Выражение признательности»), и предложения были включены авторами, как сочтут целесообразными. Тем не менее, хотя и основанные на доказательствах, представленные здесь рекомендации являются мнением авторов.

    Обоснование, важность и контекст лечения для снижения уровня глюкозы

    Управление образом жизни, включая лечебное питание (MNT), физическую активность, потерю веса, консультации по отказу от курения и психологическую поддержку, часто оказываемую в контексте самостоятельного лечения диабета — обучение и поддержка в области менеджмента (DSMES), являются фундаментальными аспектами лечения диабета. Растущее число методов лечения, снижающих уровень глюкозы, — от поведенческих вмешательств до лекарств и хирургических вмешательств — и растущая информация об их преимуществах и рисках предоставляют больше возможностей для людей с диабетом и поставщиков медицинских услуг, но могут затруднить принятие решений.В этом консенсусном заявлении мы пытаемся представить подход, который суммирует большое количество недавних доказательств для практикующих в США и Европе.

    Заметная гипергликемия связана с такими симптомами, как частое мочеиспускание, жажда, помутнение зрения, усталость и повторяющиеся инфекции. Помимо облегчения симптомов, целью снижения уровня глюкозы в крови (в дальнейшем называемого гликемическим контролем) является уменьшение долгосрочных осложнений диабета. Хорошее управление гликемией приводит к значительному и устойчивому снижению возникновения и прогрессирования микрососудистых осложнений.Это преимущество было наиболее четко продемонстрировано на ранних этапах естественного течения болезни в исследованиях с использованием метформина, сульфонилмочевины и инсулина, но подтверждается более поздними исследованиями с другими классами лекарств. Наибольшее снижение абсолютного риска (ARR) происходит за счет улучшения плохого гликемического контроля, а более умеренное снижение происходит в результате почти нормализации гликемии (6). Влияние контроля уровня глюкозы на макрососудистые осложнения менее определенно. Поскольку преимущества интенсивного контроля уровня глюкозы проявляются медленно, а вред может быть немедленным, люди с большей продолжительностью жизни могут больше выиграть от интенсивного контроля уровня глюкозы.Разумный целевой уровень HbA 1c для большинства небеременных взрослых с достаточной продолжительностью жизни, чтобы увидеть положительные эффекты для микрососудов (обычно ~ 10 лет), составляет около 53 ммоль / моль (7%) или меньше (6). Цели лечения гликемии должны быть индивидуализированы на основе предпочтений и целей пациента, риска побочных эффектов терапии (например, гипогликемии и увеличения веса) и характеристик пациента, включая слабость и сопутствующие заболевания (2).

    Атеросклеротическое сердечно-сосудистое заболевание (ASCVD) — основная причина смерти людей с диабетом 2 типа (7).Диабет сопряжен со значительным независимым риском развития ССЗС, и у большинства людей с диабетом 2 типа есть дополнительные факторы риска, такие как гипертония, дислипидемия, ожирение, отсутствие физической активности, хроническая болезнь почек (ХБП) и курение. Многочисленные исследования продемонстрировали преимущества контроля изменяемых факторов риска ASCVD у людей с диабетом. Существенное сокращение случаев ССЗСС и смерти наблюдается при одновременном обращении с несколькими факторами риска ССЗС с долгосрочными преимуществами (8,9).Всестороннее внедрение научно-обоснованных вмешательств, вероятно, способствовало значительному сокращению случаев ASCVD и смертности у людей с диабетом в последние десятилетия (10). Управление рисками ASCVD во многих его формах является важной частью лечения диабета, что выходит за рамки этого заявления, но врачи должны осознавать важность многофакторного лечения диабета 2 типа (7).

    Управление глюкозой: мониторинг

    Управление гликемией в первую очередь оценивается с помощью теста HbA 1c , который был мерой, изучаемой в исследованиях, демонстрирующих преимущества снижения уровня глюкозы (2).Результаты теста в целом превосходны для анализов и лабораторий, сертифицированных NGSP (www.ngsp.org) (11). Как и любой лабораторный тест, HbA 1c имеет ограничения (2). Поскольку существует вариабельность измерения HbA 1c , клиницисты должны действовать рассудительно, особенно когда результат близок к пороговому значению, которое может вызвать изменение терапии. Результаты HbA 1c могут отличаться от истинной средней гликемии пациента в определенных расовых и этнических группах, а также в условиях, которые изменяют обмен эритроцитов, таких как анемия, терминальная стадия почечной недостаточности (ESRD) (особенно при терапии эритропоэтином). и беременность, или если тест HbA 1c , чувствительный к вариантам гемоглобина, используется у кого-то с серповидно-клеточными признаками или другой гемоглобинопатией.Расхождения между измеренным уровнем HbA 1c и измеренными или зарегистрированными уровнями глюкозы должны побудить задуматься о том, что один из них может быть ненадежным (12).

    Регулярный самоконтроль уровня глюкозы в крови (SMBG) может помочь в самоуправлении и корректировке лекарств, особенно у людей, принимающих инсулин. Планы SMBG должны быть индивидуальными. Люди с диабетом и медицинские работники должны использовать данные эффективно и своевременно. У людей с диабетом 2 типа, не использующих инсулин, рутинный мониторинг глюкозы имеет ограниченную дополнительную клиническую пользу, но при этом увеличивает нагрузку и затраты (13,14).Однако для некоторых людей мониторинг уровня глюкозы может дать представление о влиянии образа жизни и приема лекарств на уровень глюкозы в крови и симптомы, особенно в сочетании с обучением и поддержкой. Новые технологии, такие как непрерывный или мгновенный мониторинг глюкозы, предоставляют больше информации. Однако при диабете 2 типа они были связаны только с умеренными преимуществами (15).

    Принципы лечения

    Консенсусная рекомендация

    Предоставление ориентированной на пациента помощи, которая признает мультиморбидность, учитывает индивидуальные предпочтения и препятствия пациента и учитывает их индивидуальные предпочтения и препятствия, включая разницу в стоимости лечения, имеет важное значение для эффективного управления диабетом (16).Совместное принятие решений, которому способствуют средства принятия решений, показывающие абсолютную пользу и риск альтернативных вариантов лечения, является полезной стратегией для выбора наилучшего курса лечения для человека (17–20). Медицинские работники должны оценивать влияние любого предлагаемого вмешательства, включая режимы самопомощи, в контексте когнитивных нарушений, ограниченной грамотности, особых культурных убеждений, а также индивидуальных страхов или проблем со здоровьем с учетом их влияния на эффективность лечения.

    DSMES

    Консенсусная рекомендация

    DSMES — это ключевая мера, позволяющая людям с диабетом принимать информированные решения и брать на себя ответственность за повседневное ведение диабета.DSMES играет центральную роль в установлении и внедрении принципов оказания медицинской помощи (рис. 1). Программы DSMES обычно включают личный контакт в групповых или индивидуальных занятиях с обученными педагогами, и ключевые компоненты показаны в Таблице 1 (21–25). Хотя DSMES должен быть доступен на постоянной основе, критические моменты, когда DSMES должны возникать, включают в себя постановку диагноза, ежегодно, при возникновении осложнений и во время изменений в жизни и уходе (22).

    Таблица 1

    Ключевые компоненты DSMES (21,23–25)

    Программы DSMES, реализуемые после диагностики, могут способствовать соблюдению режима лечения, здоровому питанию и физической активности, а также повысить самоэффективность.В отношении диабета 2 типа высококачественные доказательства неизменно показывают, что DSMES является экономически эффективным вмешательством в изучаемые системы здравоохранения. DSMES значительно улучшает клинические и психологические результаты, улучшает гликемический контроль, снижает количество госпитализаций, улучшает знания пациентов и снижает риск смерти от всех причин (22,26–31). Наилучшие результаты достигаются в программах с теоретически обоснованным и структурированным учебным планом и продолжительностью контакта более 10 часов. Хотя онлайн-программы могут способствовать обучению, мало доказательств их эффективности при использовании в одиночку (27).

    Консенсусная рекомендация

    Недостаточная приверженность, в том числе плохая настойчивость, терапии затрагивает почти половину людей с диабетом, что приводит к неоптимальному контролю факторов риска гликемических и сердечно-сосудистых заболеваний (ССЗ), а также к повышению риска осложнений диабета, смертности, госпитализации, и расходы на здравоохранение (32–36). Хотя эта консенсусная рекомендация фокусируется на приверженности лечению (включая настойчивость), эти принципы применимы ко всем аспектам лечения диабета.Множественные факторы способствуют непоследовательному использованию лекарств и прекращению лечения, включая предполагаемую пациентом неэффективность лекарств, страх гипогликемии, отсутствие доступа к лекарствам и побочные эффекты лекарств (37). Приверженность к лечению (включая настойчивость) варьируется в зависимости от класса лекарств, и тщательное рассмотрение этих различий может помочь улучшить результаты (38). В конечном итоге предпочтение пациента является основным фактором, определяющим выбор лекарства. Даже в тех случаях, когда клинические характеристики предполагают использование определенного лекарства на основе имеющихся данных клинических испытаний, предпочтения пациентов в отношении пути введения, инъекционных устройств, побочных эффектов или стоимости могут препятствовать их использованию некоторыми людьми (39).

    Терапевтическая инерция, иногда называемая клинической инерцией, означает неспособность интенсифицировать терапию, когда цели лечения не достигаются. Причины терапевтической инерции многофакторны и возникают на уровне практикующего врача, пациента и / или системы здравоохранения (40). Вмешательства, направленные на терапевтическую инерцию, способствовали улучшению гликемического контроля и своевременной интенсификации инсулина (41,42). Например, многопрофильные бригады, в состав которых входят практикующие медсестры или фармацевты, могут помочь снизить терапевтическую инерцию (43,44).Фрагментированная система здравоохранения может способствовать терапевтической инерции и ухудшать оказание помощи, ориентированной на пациента. Модель скоординированной помощи при хронических заболеваниях, включая поддержку самоконтроля, поддержку принятия решений, проектирование системы оказания помощи, клинические информационные системы, а также ресурсы и политику сообщества, способствует взаимодействию между более наделенными полномочиями пациентами и более подготовленными и активными медицинскими бригадами (45).

    Пробелы в ключевых знаниях

    Несмотря на более чем 200-летние исследования в области управления образом жизни при диабете и более чем 50-летние исследования сравнительной эффективности при диабете, остается бесчисленное количество нерешенных вопросов относительно лечения диабета 2 типа.В контексте наших текущих консенсусных рекомендаций нижеследующее представляет собой неполное обсуждение неприятных вопросов, которые необходимо решить.

    Развивающиеся области текущих исследований улучшат лечение диабета и возлагают большие надежды на новые методы лечения.

    • Наука внедрения. Инструменты, доступные для профилактики и лечения диабета, значительно улучшены. Однако внедрение эффективных инноваций отстает.

    • Фундаментальные науки.Наше понимание основных механизмов диабета, развития осложнений и лечения обоих, хотя и постоянно улучшается, выявило, как много мы не знаем.

    • Персонализированная / точная медицина. Эти многообещающие подходы с использованием комиксов и больших данных, учитывающие как личные факторы, так и факторы окружающей среды, и их взаимодействие в значительной степени нереализованы в лечении диабета и потребуют больших инвестиций и координации, чтобы оказать влияние.

    • Информатика.Преимущества и роль усиленного мониторинга глюкозы и других переменных, усиленного с помощью подходов, основанных на информатике в реальном времени для адаптации лечения на индивидуальной основе, имеют большой потенциал, но еще не выяснены.

    • Избыточный вес / ожирение. Текущая терапия явно неадекватна. Инновации в методах и реализации преобразуют профилактику и лечение диабета. Понимание биологии, психологии и социологии ожирения для определения фармакологических, поведенческих и политических подходов к профилактике и лечению этой основной причины диабета 2 типа имеет важное значение.

    • Управление стилем жизни и DSMES. Хотя преимущества этих подходов очевидны, необходимы более совершенные парадигмы того, как нацеливать, индивидуализировать и поддерживать эффекты.

    • Функция β-клеток. Сохранение и усиление функции β-клеток воспринимается как святой Грааль диабета, но эффективные методы еще не разработаны.

    • Трансляционные исследования. Существует огромный разрыв между знаниями, полученными в ходе клинических испытаний, и применением этой информации в клинической практике.Этот пробел следует заполнить прагматическими исследованиями и другими проектами, которые включают затраты, меры предпочтений пациентов и другие показатели результатов, регистрируемые пациентами. Пациенты и другие заинтересованные стороны должны вносить больший вклад в дизайн и результаты исследований. Прагматический дизайн повысит обобщаемость результатов и снизит стоимость. Более эффективное применение «реальных доказательств» дополнит доказательства рандомизированных исследований.

    • Разработка лекарств. Новые лекарства потребуют демонстрации широкой эффективности в отношении глюкозы, сопутствующих заболеваний и / или осложнений, а также безопасности и переносимости для конкуренции на рынке.

    • Осложнения. Стеатогепатит, сердечная недостаточность, неальбуминурическая ХБП, хронические психические заболевания и другие возникающие проблемы являются осложнениями диабета, которые могут вытеснить классические микрососудистые и макрососудистые заболевания по важности и влиянию. Срочно необходимо понимание оптимальных стратегий диагностики, скрининга и лечения.

    Другие важные области включают лучшую сегментацию «диабета 2 типа», а также надлежащую диагностику вторичного диабета, которая должна позволить более осознанную индивидуализацию ухода.Срочно необходимы лучшие данные об оптимальных подходах к ведению диабета у ослабленных и пожилых пациентов, учитывая разногласия по поводу целевых показателей гликемии, а также преимуществ и вреда конкретных методов лечения, от управления образом жизни до лекарств. Современные подходы к лечению диабета 2 типа у подростков и молодых людей, похоже, не влияют на потерю функции β-клеток, и большинство людей в этой возрастной группе быстро переходят на инсулинотерапию. Срочно необходимы исследования для определения оптимального лечения этой новой популяции с ужасающе высоким риском ранней инвалидности.

    Есть устойчивые вопросы, которые продолжают вызывать трудности при разработке руководств. Например, оказывает ли метформин положительный эффект на сердечно-сосудистую систему у пациентов с диабетом 2 типа на ранних этапах естественного течения диабета, как предполагает UKPDS? Действительно ли роль метформина в качестве лекарственного средства первого ряда основывается на фактических данных или является исторической особенностью? Хотя основание для ранней комбинированной терапии, направленной на нормальный уровень гликемии при раннем диабете, соблазнительно, доказательства клинических испытаний в поддержку конкретных комбинаций и целей по существу отсутствуют.Поскольку стоимость этих подходов огромна, отчаянно необходимы доказательства. Во всем мире внедряются различные модели оказания помощи. Очень важно определить оптимальные экономически эффективные подходы к лечению, особенно в ведении пациентов (мультиморбидность).

    Новые вопросы возникают в результате недавних исследований сердечно-сосудистых заболеваний. Распространяются ли преимущества ингибиторов SGLT2 и агонистов рецепторов GLP-1 на сердечно-сосудистую и почечную систему у пациентов с установленным ССЗ на пациентов с более низким риском? Есть ли дополнительная польза от использования агонистов рецепторов GLP-1 и ингибиторов SGLT2 для предотвращения сердечно-сосудистых и почечных событий? Если да, то в каких группах населения?

    Решение этих и других жизненно важных клинических вопросов потребует дополнительных инвестиций в фундаментальные, трансляционные, клинические и практические исследования.Потребуется разработать более эффективные по времени и затратам исследовательские парадигмы для достижения конечных результатов, ориентированных на пациента, посредством реформы регулирования и использования информатики и систем скоординированного обучения здравоохранения. Растущее бремя кардиоренальных метаболических заболеваний с точки зрения заболеваемости, распространенности и стоимости представляет собой серьезную угрозу для общества. Безотлагательное внимание к улучшению профилактики и лечения имеет первостепенное значение.

    Лечение гипергликемии при диабете 2 типа стало чрезвычайно сложным с появлением в настоящее время ряда препаратов, снижающих уровень глюкозы.Ориентированное на пациента принятие решений, поддержка и последовательные усилия по улучшению диеты и физических упражнений остаются основой всего управления гликемией. Рекомендуется начальное использование метформина с последующим добавлением сахароснижающих препаратов в зависимости от сопутствующих заболеваний и проблем пациента, поскольку мы ждем ответов на многие оставшиеся вопросы.

    Информация об изделии

    Благодарности. Авторы хотели бы поблагодарить Минди Сарако (заместитель директора по научным и медицинским коммуникациям), Гедеон Топачио (менеджер по финансам и проектам, исследованиям и научным программам) и Эрику Берг (директор по научным и медицинским вопросам) из Американской диабетической ассоциации как а также Мэри Хата (исполнительный помощник) и Петра Ниманн (исполнительный помощник) из EASD за их помощь в разработке консенсусного отчета и соответствующих встреч / презентаций.Авторы хотели бы также поблагодарить Майка Бонара (креативный директор) и Чарли Франклина (ассистент по дизайну) из Лестерского диабетического центра, Лестер, Великобритания, которые оказали значительную поддержку в составлении и изменении рисунков. Авторы также выражают признательность Франческо Заккарди (доктор философии, научный сотрудник по клиническим исследованиям, Университет Лестера, Лестер, Великобритания) и Дэвиду Клоекеру (студент-медик, Университет Лестера), которые помогали извлекать статьи PubMed и определять соответствующие записи по названию и аннотации; Франческо Дзаккарди помог определить начальную стратегию поиска и подготовить файл Excel.Авторы выражают признательность приглашенным рецензентам, предоставившим комментарии к предыдущему проекту этого отчета: Аманде Адлер (больница Адденброка, Кембридж, Великобритания), Коре И. Биркеланд (Университет Осло, Осло, Норвегия), Джеймсу Дж. Чемберлену (Св. Больница Марка, Солт-Лейк-Сити, Юта), Джилл П. Крэндалл (Медицинский колледж Альберта Эйнштейна, Нью-Йорк, Нью-Йорк), Ян Х. де Бур (Вашингтонский университет, Сиэтл, Вашингтон), Стефано Дель Прато (Пизанский университет , Пиза, Италия), Джордж Димитриадис (Афинский университет, Афины, Греция), Шон Диннин (Национальный университет Ирландии, Голуэй, Ирландия), Вивиан А.Фонсека (Тулейнский университет, Новый Орлеан, Луизиана), Саймон Р. Хеллер (Шеффилдский университет, Шеффилд, Великобритания), Ричард И.Г. Холт (Саутгемптонский университет, Саутгемптон, Великобритания), Сильвио Э. Инзукки (Йельский университет, Нью-Хейвен, Коннектикут), Эрик Л. Джонсон (Университет Северной Дакоты, Гранд-Форкс, Северная Дакота), Джошуа Дж. Ноймиллер (Вашингтонский университет, Спокан, Вашингтон), Камлеш Кхунти (Университет Лестера, Лестер, Великобритания), Харальд Х. Кляйн (Рурский университет Бохума, Бохум, Великобритания), Лайн Кляйнебрайл (Национальная больница Сен-Морис, Сен-Морис, Франция), Хосе Мануэль Фернандес-Реаль (Университет Жироны, Жирона, Испания), Салли М.Маршалл (Университет Ньюкасла, Ньюкасл-апон-Тайн, Великобритания), Manel Mata-Cases (Institut Universitari d’Investigació en Atenció Primària Jordi Gol [IDIAP Jordi Gol], Барселона, Испания), Дэвид Р. Мэтьюз (Оксфордский университет, Оксфорд, Великобритания ), Дэвид М. Натан (Массачусетская больница общего профиля, Бостон, Массачусетс), Майкл А. Наук (Диабетический центр Бохум-Хаттинген, больница Св. Иосифа, Рурский университет, Бохум, Германия), Франк Нобельс (больница OLV, Алст , Бельгия), Ричард Э. Пратли (Институт диабета больницы Флориды, Орландо, Флорида), Мария Хосе Редондо (Медицинский колледж Бейлора, Хьюстон, Техас), Майкл Р.Рикелс (Университет Пенсильвании, Филадельфия, Пенсильвания), Мэтью С. Риддл (Орегонский университет здоровья и науки, Портленд, штат Орегон), Хулио Розенсток (Центр диабета и эндокринной системы, Даллас, Техас), Джорджио Сести (Университет Великой Греции в Катандзаро, Катандзаро) , Италия), Нил Сколник (Abington Family Medicine, Дженкинтаун, Пенсильвания), Кшиштоф Стройек (Силезский медицинский университет, Забже, Польша), Дженнифер Трухильо (Университет Колорадо, Денвер, Колорадо), Гильермо Э. Умпьеррес (Университет Эмори, Атланта, США). Джорджия) и Дженнифер Вайкофф (Мичиганский университет, Анн-Арбор, Мичиган).

    Финансирование. Это мероприятие финансировалось Американской диабетической ассоциацией и Европейской ассоциацией изучения диабета.

    Двойственность интересов. M.J.D. сообщает о личных гонорарах и грантах от Boehringer Ingelheim, Janssen, Novo Nordisk и Sanofi, а также о личных гонорарах от AstraZeneca, Eli Lilly, Gilead Sciences Ltd., Intarcia / Servier, Merck Sharp & Dohme, Mitsubishi Tanabe Pharma Corporation и Takeda Pharmaceuticals International Inc. Д.A.D’A. сообщает о личных гонорарах от Eli Lilly, Merck, Novo Nordisk и Intarcia и грантах от Merck и Ligand во время проведения исследования; личные гонорары от Eli Lilly, Merck, Novo Nordisk и Intarcia, а также гранты от Merck и Ligand помимо представленных работ. J.F. нечего раскрывать. Вклад Дж.Ф. в этот консенсусный отчет основан на ее собственной точке зрения, и отчет не отражает точку зрения Национальных институтов здравоохранения, Министерства здравоохранения и социальных служб или правительства США.W.N.K. нечего раскрывать. СМ. сообщает о грантах и ​​личных вознаграждениях от Novo Nordisk, грантах и ​​личных вознаграждениях от Санофи, грантах и ​​личных вознаграждениях от Merck Sharp & Dohme, грантах и ​​личных вознаграждениях от Eli Lilly and Company, грантах и ​​личных вознаграждениях от Novartis, личных вознаграждениях от Bristol-Myers Squibb , личные сборы от AstraZeneca, гранты и личные сборы от Boehringer Ingelheim, личные сборы от Hanmi Pharmaceuticals, гранты и личные сборы от Roche Diagnostics, гранты и личные сборы от Medtronic, гранты и личные сборы от Intrexon, гранты и личные сборы от Abbott, а также личные гонорары от UCB, помимо представленных работ.Г. сообщает о грантах и ​​личных гонорарах от Novo Nordisk, личных гонорарах от Johnson & Johnson и личных гонорарах от Fractyl Inc. во время проведения исследования. PR сообщает о грантах, нефинансовой и другой поддержке Novo Nordisk, грантах и ​​другой поддержке со стороны AstraZeneca, другой поддержке со стороны Bayer, другой поддержке со стороны Boehringer Ingelheim, другой поддержке от Merck Sharp & Dohme и другой поддержке со стороны Eli Lilly во время проведения изучение. В. сообщает о нефинансовой поддержке Европейской ассоциации изучения диабета во время проведения исследования; гранты и другая поддержка от Boehringer Ingelheim, гранты и другая поддержка от Novo Nordisk, другая поддержка от Novartis, гранты и другая поддержка от Sanofi, гранты и другая поддержка от AstraZeneca, гранты от GSK, а также гранты и другая поддержка от Европейского фонда исследования диабета, за пределами представленной работы.D.J.W. нечего раскрывать. J.B.B. предоставила консультации компаниям Adocia, AstraZeneca, Eli Lilly, GI Dynamics, Intarcia, MannKind, NovaTarg, Novo Nordisk, Senseonics и vTv Therapeutics с оплатой взносов в Университет Северной Каролины. Он получил грантовую поддержку от компаний AstraZeneca, Johnson & Johnson, Novo Nordisk, Sanofi и vTv Therapeutics. Он является консультантом Neurimmune AG. Он владеет опционами на акции Mellitus Health, PhaseBio и Stability Health. Он поддерживается грантом Национального института здоровья (UL1TR002489).О других потенциальных конфликтах интересов, относящихся к этой статье, не сообщалось.

    Авторские взносы. Все авторы несли ответственность за подготовку статьи и ее критическую проверку на предмет важности интеллектуального содержания. Все авторы одобрили версию для публикации.

    Доступность данных. Подробная информация о стратегии поиска, результатах и ​​классификации включенных статей доступна по адресу https://dx.doi.org/10.17632/h5rcnxpk8w.1.

    COVID-19: последние данные — NYC Health

    Введите район, чтобы получить данные:

    Выберите район 101: Кингсбридж — Ривердейл (10463,10471) 102: Северо-Восточный Бронкс (10466,10469,10475) 103: Фордхэм — Бронкс Пк (10458,10467,10468,10470) 104: Пелхэм — Шея Трогса (10461,10462,10464 , 10465,10472,10473) 105: Кротона-Тремонт (10453,10457,10460) 106: Хай-Бридж — Моррисания (10451,10452,10456) 107: Хантс-Пойнт — Мотт-Хейвен (10454,10455,10459,10474) 201: Гринпойнт (11211,11222) 202: Центр города — Хайтс — Склон (11201,11205,11215,11217,11231) 203: Бедфорд Стуйвесант — Краун-Хайтс (11212,11213,11216,11233,11238) 204: Восточный Нью-Йорк (11207, 11208) 205: Сансет-Парк (11220,11232) 206: Боро-Парк (11204,11218,11219,11230) 207: Ист-Флэтбуш — Флэтбуш (11203,11210,11225,11226) 208: Канарси — Флатлендс (11234,11236,11239 ) 209: Бенсонхерст — Бэй Ридж (11209, 11214, 11228, 11425) 210: Кони-Айленд — Шипсхед-Бэй (11223, 11224, 11229, 11235) 211: Уильямсбург — Бушвик (11206, 11221, 11237) 301: Вашингтон-Хайтс (10031 , 10032,10033,10034,10039,10040) 302: Центральный Гарлем — Морнингсайд-Хайтс (10026, 10027,10030,10037,10115) 303: Восточный Гарлем (10029,10035) 304: Верхний Вест-Сайд (10023,10024,10025,10069) 305: Верхний Ист-Сайд (10021,10028,10044,10065,10075,10128,10162 ) 306: Челси — Клинтон (10001,10011,10018,10019,10020,10036,10103,10110,10111,10112,10119,10199) 307: Парк Грамерси — Мюррей Хилл (10010,10016,10017,10022,10152,10153 , 10154,10165,10167,10168,10169,10170,10171,10172,10173,10174,10177) 308: Гринвич-Виллидж — Сохо (10012,10013,10014) 309: Юнион-сквер — Нижний Ист-Сайд (10002,10003,10009 ) 310: Нижний Манхэттен (10005,10006,10007,10038,10271,10278,10279,10280,10282) 401: Лонг-Айленд-Сити — Астория (11101,11102,11103,11104,11105,11106,11109) 402: Вест-Квинс (11369,11370,11372,11373,11377,11378) 403: Промывка — Clearview (11351,11354,11355,11356,11357,11358,11359,11360,11368) 404: Bayside — Little Neck (11361,11362,11363, 11364) 405: Риджвуд — Форест-Хиллз (11374,11375,11379,11385) 406: Свежие луга (11365,11366,11367) 407: Юго-Западный Куинс (11414,11415,11416,11417,11418,11419,11420,1142 1,11424) 408: Ямайка (11412,11423,11432,11433,11434,11435,11436,11451) 409: Юго-Восточная Куинс (11004,11005,11411,11413,11422,11426,11427,11428,11429) 410: Rockaways (11691,11692,11694,11697) 501: Порт-Ричмонд (10302,10303,10310) 502: Стэплтон — Св.Джордж (10301,10304,10305) 503: Уиллоубрук (10311,10314) 504: Саут-Бич — Тоттенвилл (10306,10307,10308,10309,10312)

    Получить данные

    климатических норм США | Национальные центры экологической информации (NCEI)

    Часто задаваемые вопросы

    Почему в июле 2021 года были обновлены температурные нормы на Аляске?

    В процессе усреднения температурных данных резкие, но реальные изменения морского льда на западном и северном побережьях Аляски могут быть ошибочно приняты за искусственные изменения температуры воздуха на станциях, расположенных недалеко от побережья (к северу от 70 ° северной широты или к западу от 160 ° западной долготы). ).Чтобы решить эту проблему, мы заменили гомогенизированные записи температуры исходными наблюдениями, которые контролировались по качеству, но не гомогенизировали, и повторно запустили процесс нормализации.

    Нормы на 18 станциях в этой зоне были немного изменены. Кроме того, нормали для 7 станций вблизи зоны находились под влиянием береговых станций для заполнения недостающих данных или оценки норм, а также изменили свои значения.

    Новые температурные нормы для затронутых станций включают годовые / сезонные, месячные и дневные температурные нормы и нормы, связанные с температурой (сезонные переменные, подсчеты превышений и т. Д.) как для 1991-2020 гг., так и для 2006-2020 гг. Инструмент быстрого доступа будет иметь изменения, доступные для средних значений температуры, в то время как инструмент полного доступа может извлекать все температурные переменные. Новые версии файлов, содержащих температурные нормы Аляски, были загружены в наши веб-доступные папки, которые содержат весь набор данных, включая объемные файлы как по переменным, так и по станциям.

    AK Измененный список станций

    Были ли климатические нормы 1991–2020 годов рассчитаны таким же образом, как и версия 1981–2010 годов?

    Да.Расчеты станционных норм на 1991–2020 гг. Следуют подходам, впервые примененным в последнем цикле. Документация по методологии расчета норм 2020 включает ссылки на все подробные публикации по методологии расчета норм. Некоторые технические изменения в способах округления значений норм, вычисления процентилей и форматирования данных были приняты в соответствии с Руководящими принципами Всемирной метеорологической организации (ВМО) по расчету климатических норм (№ 1203).

    По каким критериям определяются станции, входящие в U.S. Продукты Climate Normals?

    Климатические нормы рассчитываются для максимально возможного количества метеорологических станций NOAA и партнеров с достаточным объемом данных за 1991–2020 гг., В том числе в сети программы совместных наблюдений (COOP) Национальной метеорологической службы (NWS) и в Автоматизированной системе приземных наблюдений (ASOS). ) Сеть есть во многих аэропортах. Нормы также рассчитываются для некоторых станций с идентификационным номером станции «Бюро погоды — армия — флот» (WBAN), включая станции из США.С. Справочная климатическая сеть (USCRN). Наконец, впервые рассчитываются нормы осадков для выбранных станций сети снежной телеметрии (SNOTEL) Министерства сельского хозяйства США и совместной сети сообщества ученых, работающих в области дождя, града и снега (CoCoRaHS).

    Сколько станций включено в климатические нормы США на 1991–2020 гг.?

    Климатические нормы 1991–2020 гг. Включают данные более 15 000 станций, сообщающих об осадках, и более 7 300 станций, сообщающих о температуре.Из станций, сообщающих об осадках, более 5700 имеют соответствующие наблюдения, чтобы сообщать о снегопадах и нормах высоты снежного покрова. Около 467 станций сообщают о часовых нормах.

    Климатические нормы на 2006–2020 гг. Включают данные более чем 13 000 станций, сообщающих об осадках, и более 5 500 станций, сообщающих о температуре. Из станций, сообщающих об осадках, более 1600 имеют соответствующие наблюдения, чтобы сообщать о снегопадах и нормах высоты снежного покрова. Около 1150 станций сообщают ежечасные нормы.

    Что климатические нормы говорят нам о глобальном потеплении или изменении климата?

    Климатические нормы были разработаны не для отслеживания или документирования изменения климата, а для характеристики текущего климата. Однако различия между каждой партией действительно свидетельствуют об изменении климата. Это особенно очевидно, если текущие нормы сравниваются с долгосрочными средними значениями, такими как среднее значение за 1901–2000 годы 20-го века, которое часто используется Секцией мониторинга NCEI для сравнения с долгими временными рядами климатических переменных.

    Что такое градусо-дни нагрева и охлаждения? Что такое дни повышения степени?

    Градус-дни нагрева и охлаждения — это показатели энергопотребления, связанные с изменением средней температуры в пространстве и времени. Градусо-дни — это климатические показатели, которые измеряют влияние температуры на сельскохозяйственные системы, в том числе как функцию средней температуры.

    В расчетах градусо-дня используются определенные пороговые температуры (например, 65 ° F для градусо-дней нагрева и охлаждения, 50 ° F для градусо-дней роста) в качестве базовых температур и накапливаются ежедневные градусо-дневные метрики по мере отклонения от этих базовых значений.Различные базовые уровни полезны для разных оценок, поэтому продукт Climate Normals обеспечивает доступ к многочисленным типам градусо-дневных норм с разными базовыми линиями.

    Включает ли партия 1991–2020 годов дополнительные температурные нормы?

    Дополнительные температурные нормы на 1991–2020 гг. Не разрабатывались. Вместо этого был рассчитан весь набор 15-летних норм для 2006-2020 годов для всех переменных с использованием тех же методов, что и для 30-летних норм. 15-летние нормы оптимизированы для случаев использования, которые требуют более свежей климатической информации, такой как прогнозирование нагрузок энергосистемы и другие экономические решения.

    Однако партнеры NCEI из Регионального климатического центра High Plains разработали специальный инструмент климатологии, который позволяет пользователям рассчитывать месячные температурные нормы для любого периода времени в текущем периоде для того же набора станций, что и обычные.

    Вычисляют ли свои собственные климатические нормы другие агентства и отдельные лица?

    Да.

    Author: alexxlab

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *