Фипи математика: Открытый банк заданий ЕГЭ

Содержание

Опубликованы демоверсии экзаменов для выпускников, не поступающих в вузы

https://ria.ru/20210211/ekzameny-1596941836.html

Опубликованы демоверсии экзаменов для выпускников, не поступающих в вузы

Опубликованы демоверсии экзаменов для выпускников, не поступающих в вузы — РИА Новости, 11.02.2021

Опубликованы демоверсии экзаменов для выпускников, не поступающих в вузы

Федеральный институт педагогических измерений опубликовал на своем сайте проекты контрольных измерительных материалов государственного выпускного экзамена… РИА Новости, 11.02.2021

2021-02-11T10:34

2021-02-11T10:34

2021-02-11T10:38

образование — общество

елена котова

федеральная служба по надзору в сфере образования и науки (рособрнадзор)

федеральный институт педагогических измерений (фипи)

единый государственный экзамен (егэ)

россия

сн_образование

социальный навигатор

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdn23.img.ria.ru/images/07e4/05/15/1571799264_0:0:2870:1615_1920x0_80_0_0_65135f26208e7ccb373a18afbe888368.jpg

МОСКВА, 11 фев — РИА Новости. Федеральный институт педагогических измерений опубликовал на своем сайте проекты контрольных измерительных материалов государственного выпускного экзамена (ГВЭ), который будут сдавать для получения аттестата выпускники 11 классов, не планирующие поступление в вузы, сообщает пресс-служба Рособрнадзора.Как напомнили в ведомстве, в 2020-21 учебном году, с учетом эпидемической ситуации, было решено внести изменения в проведении государственной итоговой аттестации выпускников 11 классов. Одиннадцатиклассникам предоставлена возможность выбора формы итоговой аттестации – ЕГЭ или ГВЭ.Для получения аттестата выпускникам, поступающим в вузы в этом году, достаточно будет получить положительный результат ЕГЭ по русскому языку. Тем выпускникам, которые не планируют поступление в вузы, для получения аттестата нужно будет сдать ГВЭ по двум предметам: русскому языку и математике.Как отметила замдиректора ФИПИ Ольга Котова, в практике Рособрнадзора принято объявлять структуру и содержание экзаменационных моделей до начала учебного года, в августе.»Но поскольку решение о проведении ГВЭ для выпускников, не планирующих поступление в вуз, было принято позже, экзаменационные модели ГВЭ для них сформированы на основе уже хорошо известных обучающимся и учителям контрольных измерительных материалов ЕГЭ по русскому языку и базовой математике», — приводит пресс-служба Рособонадзора слова Котовой.ГВЭ по русскому языку будут содержать 24 задания с кратким ответом базового уровня из ЕГЭ по русскому языку. В совокупности с традиционной формой итогового сочинения эта модель обеспечит контроль освоения системы русского языка и практической грамотности выпускников средней школы.ГВЭ по математике будут содержать 14 заданий с кратким ответом из ЕГЭ по математике базового уровня. Задания будут представлять различные разделы курса математики и позволят оценить освоение необходимых требований к базовому уровню среднего общего образования по математике.Опубликованные документы будут определять содержание КИМ только для выпускников, выбравших форму ГВЭ, так как они не планируют поступление в вузы. Экзамены по русскому языку и математике для категорий участников, которые традиционно имеют право сдавать ГИА-11 в форме ГВЭ, например, участников с ограниченными возможностями здоровья, будут проводиться по соответствующим демонстрационным материалам для указанной категории участников экзамена, размещенным на сайте ФИПИ осенью 2020 года.Проведение основного периода ГВЭ-11 в 2021 году запланировано с 25 мая по 10 июня. Проектом расписания предусмотрены также два дополнительных периода проведения ГВЭ-11. 13 июля и 17 июля ГВЭ по русскому языку и математике смогут сдать участники, пропустившие экзамены в основной период по болезни или иной уважительной причине. Кроме того, 3-17 сентября в проекте расписания предусмотрен еще один дополнительный период, когда ГВЭ также смогут сдать участники, пропустившие экзамены по уважительной причине ранее, и участники, не преодолевшие минимальный порог на ЕГЭ по русскому языку.

https://ria.ru/20210121/ege-1593986732.html

https://ria.ru/20210125/medal-1594539592.html

россия

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2021

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

https://cdn24.img.ria.ru/images/07e4/05/15/1571799264_38:0:2769:2048_1920x0_80_0_0_914b368f63b8fff657785e9b51345b19.jpg

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

образование — общество, елена котова, федеральная служба по надзору в сфере образования и науки (рособрнадзор), федеральный институт педагогических измерений (фипи), единый государственный экзамен (егэ), россия, сн_образование, социальный навигатор

МОСКВА, 11 фев — РИА Новости. Федеральный институт педагогических измерений опубликовал на своем сайте проекты контрольных измерительных материалов государственного выпускного экзамена (ГВЭ), который будут сдавать для получения аттестата выпускники 11 классов, не планирующие поступление в вузы, сообщает пресс-служба Рособрнадзора.

Как напомнили в ведомстве, в 2020-21 учебном году, с учетом эпидемической ситуации, было решено внести изменения в проведении государственной итоговой аттестации выпускников 11 классов. Одиннадцатиклассникам предоставлена возможность выбора формы итоговой аттестации – ЕГЭ или ГВЭ.

5 февраля, 18:09ИнфографикаПредварительное расписание ЕГЭ на 2021 год

Инфографика

Посмотреть

Для получения аттестата выпускникам, поступающим в вузы в этом году, достаточно будет получить положительный результат ЕГЭ по русскому языку. Тем выпускникам, которые не планируют поступление в вузы, для получения аттестата нужно будет сдать ГВЭ по двум предметам: русскому языку и математике.

Как отметила замдиректора ФИПИ Ольга Котова, в практике Рособрнадзора принято объявлять структуру и содержание экзаменационных моделей до начала учебного года, в августе.»Но поскольку решение о проведении ГВЭ для выпускников, не планирующих поступление в вуз, было принято позже, экзаменационные модели ГВЭ для них сформированы на основе уже хорошо известных обучающимся и учителям контрольных измерительных материалов ЕГЭ по русскому языку и базовой математике», — приводит пресс-служба Рособонадзора слова Котовой.

21 января, 12:49

ЕГЭ с 2021 года станет вступительным испытанием в вузы

ГВЭ по русскому языку будут содержать 24 задания с кратким ответом базового уровня из ЕГЭ по русскому языку. В совокупности с традиционной формой итогового сочинения эта модель обеспечит контроль освоения системы русского языка и практической грамотности выпускников средней школы.

ГВЭ по математике будут содержать 14 заданий с кратким ответом из ЕГЭ по математике базового уровня. Задания будут представлять различные разделы курса математики и позволят оценить освоение необходимых требований к базовому уровню среднего общего образования по математике.

Опубликованные документы будут определять содержание КИМ только для выпускников, выбравших форму ГВЭ, так как они не планируют поступление в вузы. Экзамены по русскому языку и математике для категорий участников, которые традиционно имеют право сдавать ГИА-11 в форме ГВЭ, например, участников с ограниченными возможностями здоровья, будут проводиться по соответствующим демонстрационным материалам для указанной категории участников экзамена, размещенным на сайте ФИПИ осенью 2020 года.

25 января, 19:29

Условия получения золотой медали в 2021 году: кому вручают и что она дает

Проведение основного периода ГВЭ-11 в 2021 году запланировано с 25 мая по 10 июня. Проектом расписания предусмотрены также два дополнительных периода проведения ГВЭ-11. 13 июля и 17 июля ГВЭ по русскому языку и математике смогут сдать участники, пропустившие экзамены в основной период по болезни или иной уважительной причине. Кроме того, 3-17 сентября в проекте расписания предусмотрен еще один дополнительный период, когда ГВЭ также смогут сдать участники, пропустившие экзамены по уважительной причине ранее, и участники, не преодолевшие минимальный порог на ЕГЭ по русскому языку.

ФИПИ завершает общественно-профессиональное обсуждение опубликованных моделей ЕГЭ по математике базового и профильного уровней

Федеральный институт педагогических измерений (ФИПИ), подведомственная организация Рособрнадзора, занимающаяся разработкой контрольных измерительных материалов, разместил в открытом доступе проекты демоверсий КИМ ЕГЭ по математике базового и профильного уровня для получения обратной связи от специалистов системы образования по содержанию КИМ ЕГЭ двух уровней. Обсуждение проектов экзаменационных моделей завершится 30 сентября 2014 года. 

В соответствии с Концепцией развития математического образования в РФ, утвержденной Правительством, в 2015 году ЕГЭ по математике будет разделен на базовый и профильный уровни. 

 

Планируется, что контрольные измерительные материалы единого государственного экзамена по математике базового уровня будут состоять из одной части, включающей 20 заданий с кратким ответом. 

 

«Экзамен базового уровня не является «облегченной версией» профильного, он ориентирован на иную цель и другое направление изучения математики – математика для повседневной жизни и практической деятельности, пояснили в институте педагогических измерений», — отмечают в ФИПИ.

 

По словам разработчиков, структура и содержание КИМ базового уровня дает возможность проверить умения решать стандартные задачи практического содержания; проводить простейшие расчеты, оценку и прикидку; логически рассуждать; действовать в соответствии с несложными алгоритмами; использовать для решения задач учебную и справочную информацию; решать, в том числе, сложные задачи, требующие логических рассуждений. 

 

Результаты базового ЕГЭ по математике выдаются в отметках по пятибалльно шкале, не переводятся в стобалльную шкалу, и не дают возможности участия в конкурсе на поступление в вузы. 

 

Что касается КИМ по математике профильного уровня, то первая часть будет содержать задания с кратким ответом, вторая часть – задания с кратким и развернутым ответом.

 

КИМ ЕГЭ профильного уровня созданы на основе экзаменационной модели ЕГЭ 2014 года и проверяют умения выполнять вычисления и преобразования; решать уравнения и неравенства; выполнять действия с функциями, с геометрическими фигурами; строить и исследовать математические модели. Результаты профильного ЕГЭ по математике оцениваются в стобалльной системе, и могут быть представлены абитуриентом на конкурс для поступления в вуз. 

 

По словам специалистов ФИПИ, все замечания и предложения, высказанные экспертным сообществом в ходе обсуждения, будут учтены при подготовке контрольных измерительных материалов.

ФИПИ: модели ЕГЭ-2015 по математике базового и профильного уровней — Всё о ЕГЭ и ОГЭ (ГИА) — Новости науки

Комментариев: 11

В 2015 году ЕГЭ по математике будет разделен на два уровня: базовый и профильный. Федеральный институт педагогических измерений (ФИПИ), подведомственная организация Рособрнадзора, занимающаяся разработкой контрольных измерительных материалов, разместил в открытом доступе проекты демоверсий КИМ

ЕГЭ по математике и базового, и профильного уровня. Это было сделано для того, чтобы получить обратную связь от специалистов системы образования по содержанию КИМ ЕГЭ двух уровней. Напоминаем, что завтра, т.е. 30 сентября 2014 года, обсуждение проектов экзаменационных моделей ЕГЭ по математике завершается.

Что из себя будут представлять задания по математике базового уровня на ЕГЭ-2015? Предполагается, что контрольные измерительные материалы ЕГЭ по математике базового уровня будут состоять всего из одной части, в которую будут включены 20 заданий с кратким ответом. Задания базового уровня несложные.

Вот как об этом сказали в ФИПИ: «Экзамен базового уровня не является «облегченной версией» профильного, он ориентирован на иную цель и другое направление изучения математики – математика для повседневной жизни и практической деятельности, пояснили в институте педагогических измерений». Здесь сразу стоит отметить, что результаты базового ЕГЭ по математике будут выдаваться в отметках по пятибалльной шкале, как и в школе. Кроме этого, данные результаты не переводятся в стобалльную шкалу. И самое главное, не дают возможности участия в конкурсе на поступление в вузы. Проще говоря, те выпускники, которые будут сдавать базовый уровень по математике на ЕГЭ-2015, не будут поступать в вузы.

Теперь конкретно о заданиях по математике базового уровня. Нужно отметить, что структура и содержание КИМ базового уровня позволяет проверить умения решать стандартные задачи практического содержания; также проводить самые простые расчеты, оценку и прикидку; логически рассуждать; действовать в соответствии с несложными алгоритмами; еще использовать для решения задач учебную и справочную информацию; и в то же время решать сложные задачи, которые требуют логических рассуждений. Ожидается, что все одиннадцатиклассники, которые будут сдавать базовый уровень, получат удовлетворительные, хорошие и отличные результаты.

Теперь о КИМах по математике профильного уровня. Здесь нужно сказать о том, что задания будут состоять из двух частей: первая часть будет содержать задания с кратким ответом, вторая часть – задания с кратким и развернутым ответом. Конечно же, профильный уровень довольно-таки сложный, зато сдав его, можно получить возможность поступления в вуз (если баллов будет достаточно).

Напоминаем, что КИМы ЕГЭ профильного уровня созданы на основе экзаменационной модели ЕГЭ 2014 года и проверяют умения выполнять вычисления и преобразования; также решать уравнения и неравенства; выполнять действия с функциями, с геометрическими фигурами; а еще строить и исследовать математические модели. Обращаем Ваше внимание на то, что результаты профильного ЕГЭ по математике будут оцениваться в стобалльной системе, и могут быть представлены абитуриентом на конкурс для поступления в вуз.

Посмотрим, что же будет со всем этим в итоге. А пока, как говорят специалисты ФИПИ, все замечания и предложения, которые были высказаны экспертным сообществом в ходе обсуждения, обязательно будут учтены при подготовке контрольных измерительных материалов. Когда они полностью будут готовы, можно будет приступать уже к более тщательной подготовке к экзамену по математике.

Институт оценки качества образования Республики тыва

Результаты ЕГЭ по математике в 2019 году продемонстрировали эффективность мер, реализуемых в соответствии с Концепцией развития математического образования. Заметно снизилась доля участников ЕГЭ, не сдавших экзамен, и повысилась доля выпускников с высокими результатами. Наиболее трудными для участников экзамена как базового, так и профильного уровня остаются задания по геометрии. Обзор методических рекомендаций по математике по итогам анализа результатов ЕГЭ-2019 завершает серию публикаций от специалистов ФИПИ.

Благодаря переходу системы двухуровневого ЕГЭ по математике в штатный режим сдачи одного экзамена (базового или профильного) повысилась осмысленность выбора уровня экзамена, что улучшило качество итогового повторения.

Существенно сократился процент технических ошибок в записи ответов и решений задач. Все большее количество участников экзамена, которые находят правильный путь решения задачи, доводили ее решение до конца. Включение элементов финансовой грамотности в школьную программу не могло не сказаться на повышении процента выполнения практико-ориентированных заданий, в том числе с экономическим содержанием. Особенно высокий рост результатов показали регионы, в которых углубленное изучение математики начинается с 7–8 класса.

Участники профильного экзамена демонстрируют высокую степень овладения базовыми умениями, выполняя задания на проценты и доли, вычисления, округление, чтение информации с графиков и диаграмм, несложные уравнения. Более двух третей участников экзамена 2019 года успешно справились со стереометрической задачей 8 и текстовой задачей 11, при этом последнее задание по-прежнему вызывает сложности у слабо подготовленных участников ЕГЭ. Задания по геометрии остаются при росте результатов выполнения наиболее трудными для участников экзамена.

В экзамене базового уровня особую тревогу вызывает низкий процент выполнения практико-ориентированного стереометрического задания 13. Также хуже других были выполнены задача 14 на наглядное представление о производной и геометрические задачи 15 и 16.

Наличие открытого банка заданий позволило включать задания ЕГЭ в учебный процесс в школе, повысить эффективность итогового повторения и подготовки к экзамену с учетом индивидуальных образовательных траекторий каждого участника экзамена. Это обусловило снижение количества допущенных участниками ЕГЭ вычислительных ошибок при выполнении заданий с кратким ответом и ошибок, связанных с неправильным пониманием условия математической задачи.

Краткий обзор рекомендаций ФИПИ — Математика

Подробности
Создано: 25.12.2018 18:00

Планиметрические и стереометрические задачи вызвали значительные затруднения у участников ЕГЭ-2018 и базового, и профильного уровней, сообщили специалисты Федерального института педагогических измерений (ФИПИ) по результатам проверки и анализа работ ЕГЭ-2018 по математике. Также эксперты отмечают среди слабых звеньев подготовки выпускников – содержательную работу с формулами. Сложными для участников ЕГЭ-2018 обоих уровней признаны задания по программе средней школы.

В 2018 году изменений в структуре и содержании КИМ ЕГЭ по сравнению с предыдущим годом не было. ЕГЭ по математике проводился на двух уровнях: базовом и профильном.
Результаты как базового, так и профильного экзаменов показывают, что учителя работают над устранением пробелов в базовых знаниях учеников и отрабатывают базовые математические навыки. Важным акцентом стало умение решать практико-ориентированные задачи.

Лучше, чем в предыдущие годы, выпускники выполнили задания на вычисление вероятности наступления события в практической ситуации. Можно считать, что проявляется повышение математической и методической подготовки учителей по преподаванию вероятностно-статистической линии.

Однако далеко не все выпускники готовы к содержательной работе с формулами, и это следует обязательно учесть при планировании работы.

Растут, но пока еще остаются низкими результаты выполнения как планиметрических, так и стереометрических задач, с ними справляются только наиболее подготовленные участники экзаменов обоих уровней. Назрела необходимость в создании непрерывной линии изучения геометрии с 1 по 11 класс на основе единых дидактических подходов, с акцентом на развитие геометрической интуиции и наглядных представлений школьников.

Более сложными для участников и базового, и профильного экзаменов стали задания по программе средней школы. Так, не более половины участников экзамена могут по графику производной найти точку экстремума (профильный экзамен, задание 7), по графику функции дать характеристику ее производной (базовый экзамен, задание 14). Проблемой остается слабое владение базовыми умениями исследования функции с помощью производной (профильный экзамен, задание 12). Графические представления тесно связаны с понятийной стороной вопроса о поведении функции и ее производной. Надо понимать, что представление о производной и ее применении к исследованию функций можно получить, основываясь преимущественно на наглядных представлениях о скорости, об изменении величины и о касательной к гладкой линии. Именно поэтому нужно формировать общее понимание понятия производной функции и при переходе к алгоритмам не забывать о содержательной стороне, тем более что задачи такого рода ежегодно включаются в КИМ ЕГЭ по математике.

Причиной снижения доли участников, набравших полный балл за задание 17 профильного экзамена (экономическая задача), стало «натаскивание» на типовые задания прошлых лет вместо систематического изучения курса и грамотного итогового повторения. Многие участники не прочитали полностью и внимательно условие задачи и допустили существенные ошибки, следуя заученному «типовому» алгоритму.

На экзамен профильного уровня по-прежнему приходит доля участников, для которых в большей степени предназначен экзамен базового уровня. Следует лучше ориентировать обучающихся при выборе уровня экзамена по математике.

Еще одно наблюдение, основанное на сопоставлении результатов базового и профильного экзаменов: по своей математической подготовке группа выпускников, наиболее успешных на ЕГЭ базового уровня, имеет хорошие шансы сдать экзамен профильного уровня с результатом, достаточным для поступления в инженерно-технические вузы. В каждом конкретном случае, когда выпускник отказывается от профильного ЕГЭ по математике, учитель и родители должны убедиться, что отказ сделан им осознанно и обоснованно.

Обучающимся следует более осознанно подходить к выбору уровня экзамена по математике, а учителям при обучении активнее использовать дифференцированный подход, учитывая при этом потребности обучающихся и их приоритеты продолжения образования.

Напомним, ежегодно Федеральный институт педагогических измерений (ФИПИ) проводит анализ кампании по предметам и публикует методические рекомендации для учителей. Краткий обзор этих рекомендаций, подготовленных руководителями федеральных комиссий по разработке контрольных измерительных материалов ЕГЭ, помогут будущим выпускникам и их педагогам сориентироваться в том, какие задания и темы оказались наиболее сложными для участников ЕГЭ-2018, и на что стоит обратить внимание при подготовке к экзамену. Ранее свои рекомендации выпускникам дали разработчики КИМ ЕГЭ по обществознанию, истории, биологии и русскому языку.

Быстрый численный метод моделирования границ раздела жидкостей с частицами

К. Гу и Л. Ботто / Computer Physics Communications 256 (2020) 107447 13

Ссылки

[1] BJ Park, JP Pantina, EM Furst, M. Oettel, S. Reynaert, J. Vermant,

Langmuir 24 (5) (2008) 1686–1694.

[2] К. Стратфорд, Р. Адхикари, И. Пагонабаррага, Ж.-К. Деспла, М.Е. Кейтс, Science

309 (5744) (2005) 2198–2201.

[3] Э. Херциг, К.White, A. Schofield, W. Poon, P. Clegg, Nat. Матер. 6 (12)

(2007) 966.

[4] E. Dickinson, Curr. Opin. Коллоидный интерфейс Sci. 15 (1–2) (2010) 40–49.

[5] B.A. Сулейманов, Ф. Исмаилов, Э. Велиев, Ж. Пет. Sci. Англ. 78 (2) (2011)

431–437.

[6] A. Dinsmore, M.F. Сюй, М. Николаидес, М. Маркес, А. Бауш, Д. Вайц,

Science 298 (5595) (2002) 1006–1009.

[7] E.J. Станчик, М. Кухкан, Г.Г. Фуллер, Ленгмюр 20 (1) (2004) 90–94.

[8] A.J. Мендоса, Э. Гусман, Ф. Мартинес-Педреро, Х. Ритакко, Р.Г. Рубио,

Ф. Ортега, В. Старов, Р. Миллер, Adv. Коллоидный интерфейс Sci. 206 (2014)

303–319.

[9] F. Fenouillot, P. Cassagnau, J.-C. Majesté, Полимер 50 (6) (2009) 1333–1350.

[10] А.Б. Pawar, M. Caggioni, R. Ergun, R.W. Hartel, P.T. Spicer, Soft Matter 7

(17) (2011) 7710–7716.

[11] O. Pitois, X. Chateau, Langmuir 18 (25) (2002) 9751–9756.

[12] Д.-Г. Ли, Х.-Й. Ким, Phys. Fluids 23 (7) (2011) 072104.

[13] П. Сингх, Д. Джозеф, J. Fluid Mech. 530 (2005) 31–80.

[14] A.J. Ladd, J. Fluid Mech. 271 (1994) 285–309.

[15] X. Shan, H. Chen, Phys. Rev. E 47 (3) (1993) 1815.

[16] M.R. Swift, E. Orlandini, W. Osborn, J. Yeomans, Phys. Ред. E 54 (5) (1996)

5041.

[17] A.S. Джоши, Ю. Сан, Phys. Rev. E 82 (4) (2010) 041401.

[18] F. Jansen, J. Harting, Phys. Ред. E 83 (4) (2011) 046707.

[19] S. Aland, J. Lowengrub, A. Voigt, Phys. Жидкости 23 (6) (2011) 062103.

[20] Н. Дженссон, М. Хулсен, П. Андерсон, Comput. И жидкости 111 (2015) 1–17.

[21] P.C. Миллетт, Ю. Wang, J. Colloid Interface Sci. 353 (1) (2011) 46–51.

[22] Л. Ботто, А. Просперетти, Phys. Fluids 24 (1) (2012) 013303.

[23] D. Vella, Annu. Rev. Fluid Mech. 47 (2015) 115–135.

[24] Н. Синн, М. Алишахи, С. Хардт, J. Colloid Interface Sci. 458 (2015) 62–68.

[25] S. O’brien, J. Colloid Interface Sci. 183 (1) (1996) 51–56.

[26] D.M. Каз, Р. МакГорти, М. Мани, М.П. Бреннер, В. Manoharan, Nat. Матер.

11 (2) (2012) 138–142.

[27] Y. Sui, H. Ding, P.D. Написано, Анну. Rev. Fluid Mech. 46 (2014).

[28] Л. Ботто, E.P. Левандовски, М. Кавалларо, К.Дж. Стебе, Мягкое вещество 8 (39)

(2012) 9957–9971.

[29] Дж. Ониси, А. Кавасаки, Ю. Чен, Х. Охаши, Comput. Математика. Прил. 55 (7)

(2008) 1541–1553.

[30] G. Lecrivain, R. Yamamoto, U. Hampel, T. Taniguchi, Phys. Жидкости 28 (8)

(2016) 083301.

[31] X. Chateau, O. Pitois, J. Colloid Interface Sci. 259 (2) (2003) 346–353.

[32] R. Ettelaie, S.V. Лищук, Мягкая материя 11 (21) (2015) 4251–4265.

[33] S.E. Аначков, И. Лесов, М. Занини, П.А. Кральчевский, Н.Д. Денков, Л. Иса,

Мягкое вещество 12 (36) (2016) 7632–7643.

[34] С. Разави, К.Д. Цао, Б. Линь, K.Y.C. Ли, Р.Ту, И. Кречмар, Лангмюр 31

(28) (2015) 7764–7775.

[35] O. Pitois, M. Buisson, X. Chateau, Eur. Phys. J. E 38 (5) (2015) 48.

[36] Д. Велла, П. Ауссиллус, Л. Махадеван, Europhys. Lett. 68 (2) (2004) 212.

[37] К.Д. Данов, Р.Д.Станимирова, П.А. Кральчевский, К. Маринова, Н.А.Алексан-

дров, С.Д. Стоянов, Т. Блейденштейн, Э. Pelan, J. Colloid Interface Sci. 440

(2015) 168–178.

[38] В. Гарбин, И. Дженкинс, Т.Sinno, J.C. Crocker, K.J. Стебе, Phys. Rev. Lett. 114

(10) (2015) 108301.

[39] S. Elghobashi, G. Truesdell, J. Fluid Mech. 242 (1992) 655–700.

[40] Д. Жакмин, J. Comput. Phys. 155 (1) (1999) 96–127.

[41] П. Юэ, Дж. Дж. Feng, C. Liu, J. Shen, J. Fluid Mech. 515 (2004) 293–317.

[42] П. Юэ, К. Чжоу, Дж. Дж. Feng, J. Comput. Phys. 223 (1) (2007) 1–9.

[43] П. Юэ, К. Чжоу, Дж. Дж. Фэн, К.Ф. Оливье-Гуч, Х.Х. Ху, J. Comput. Phys.219

(1) (2006) 47–67.

[44] L.A. Lubbers, J.H. Weijs, L. Botto, S. Das, B. Andreotti, J.H. Snoeijer, J. Fluid

Mech. 747 (2014).

[45] Х. Мехрабиан, Дж. Хартинг, Дж. Х. Snoeijer, Soft Matter 12 (4) (2016)

1062–1073.

[46] J. Bławzdziewicz, V. Cristini, M. Loewenberg, Phys. Жидкости 11 (2) (1999)

251–258.

[47] Г. Ван, Р. Прабхакар, Э. М. Севик, Phys. Rev. Lett. 103 (24) (2009) 248303.

[48] A.Геллер, С. Ли, Л. Лил, J. Fluid Mech. 169 (1986) 27–69.

[49] T. Bickel, Phys. Ред. E 75 (4) (2007) 041403.

[50] S. Lee, R. Chadwick, L.G. Leal, J. Fluid Mech. 93 (4) (1979) 705–726.

[51] S. Lee, L. Leal, J. Fluid Mech. 98 (1) (1980) 193–224.

[52] J.T. Петков, Н.Д.Денков, К. Данов, О. Velev, R. Aust, F. Durst, J. Colloid

Interface Sci. 172 (1) (1995) 147–154.

[53] T.M. Fischer, P. Dhar, P. Heinig, J. Fluid Mech. 558 (2006) 451–475.

[54] К.Д. Данов, Р. Димова, Б. Пулиньи, Phys. Жидкости 12 (11) (2000) 2711–2722.

[55] C. Pozrikidis, J. Fluid Mech. 575 (2007) 333–357.

[56] Х. Бреннер, Л.Г. Leal, J. Colloid Interface Sci. 65 (2) (1978) 191–209.

[57] J.F. Brady, J. Chem. Phys. 99 (1) (1993) 567–581.

[58] J.J. Stickel, R.L. Powell, Annu. Rev. Fluid Mech. 37 (2005) 129–149.

[59] A. Vidal, L. Botto, J. Fluid Mech. 813 (2017) 152–174.

[60] Дж. Джоанни, П.-Г. De Gennes, J. Chem. Phys. 81 (1) (1984) 552–562.

[61] Р. Авеард, Б.П. Бинкс, Дж. Клинт, Adv. Коллоидный интерфейс Sci. 100 (2003)

503–546.

[62] J.N. Исраэлачвили, Межмолекулярные и поверхностные силы, Academic Press, 2011.

[63] Y. Liang, N. Hilal, P. Langston, V. Starov, Adv. Коллоидный интерфейс Sci. 134

(2007) 151–166.

[64] Y. Tsuji, T. Kawaguchi, T. Tanaka, Powder Technol. 77 (1) (1993) 79–87.

[65] Т. Миками, Х.Kamiya, M. Horio, Chem. Англ. Sci. 53 (10) (1998) 1927–1940.

[66] A. Prosperetti, G. Tryggvason, Computational Methods for Multiphase Flow,

Cambridge University Press, 2009.

[67] A. Ferrante, S. Elghobashi, Phys. Жидкости 15 (2) (2003) 315–329.

[68] M. Ekiel-Jeżewska, B. Metzger, E. Guazzelli, Phys. Fluids 18 (3) (2006)

038104.

[69] C.E. Weatherburn, Quart. Pure Appl. Математика. 50 (1925) 230–269.

[70] К. Гу, Л. Ботто, Soft Matter 12 (3) (2016) 705–716.

[71] P. Kralchevsky, J. Eriksson, S. Ljunggren, Adv. Коллоидный интерфейс Sci. 48

(1994) 19–59.

[72] П.-Г. Де Жен, Ф. Брошар-Вярт, Д. Кере, Капиллярность и смачивание

Явления: капли, пузыри, жемчуг, волны, Springer Science & Business

Media, 2013.

[73] К. Кануто, А. Куартерони , МОЙ Хуссаини, Т.А. Занг, Основы динамики жидкостей

, Springer, 2007.

[74] М. Фриго, С.Г. Джонсон, Акустика, обработка речи и сигналов, 1998.

Труды Международной конференции IEEE 1998 г., Vol. 3, IEEE,

1998, стр. 1381–1384.

[75] М.П. Аллен, Д.Дж. Тилдесли, Компьютерное моделирование жидкостей, Оксфордский университет,

Press, 2017.

[76] К.Д. Сквайрз, Дж. Eaton, Phys. Жидкости А 2 (7) (1990) 1191–1203.

[77] Э. Кальсаварини, Р. Волк, М. Бургуан, Э. Левек, Ж.-Ф. Pinton, F. Toschi, J.

Fluid Mech. 630 (2009) 179–189.

[78] Д.У. Русон, Дж.Eaton, J. Fluid Mech. 428 (2001) 149–169.

[79] С. Сундарам, Л.Р. Коллинз, J. Comput. Phys. 124 (2) (1996) 337–350.

[80] Дж. Чжу, L.-Q. Чен, Дж. Шен, В. Тикаре, Phys. Ред. E 60 (4) (1999) 3564.

[81] P.A. Кральчевский, К. Нагаяма, Adv. Коллоидный интерфейс Sci. 85 (2–3) (2000)

145–192.

[82] Ю. Ротенберг, Л. Борувка, А.В. Neumann, J. Colloid Interface Sci. 93 (1)

(1983) 169–183.

[83] F. Hansen, G. Rødsrud, J. Colloid Interface Sci.141 (1) (1991) 1–9.

[84] C.E. Stauffer, J. Phys. Chem. 69 (6) (1965) 1933–1938.

[85] S. Fordham, Proc. R. Soc. А 194 (1948) 1–16.

[86] Дж. Хорвиц, А. Мани, J. Comput. Phys. 318 (2016) 85–109.

[87] П. Саффман, Stud. Прил. Математика. 52 (2) (1973) 115–127.

[88] H. Ding, P.D. Spelled, C. Shu, J. Comput. Phys. 226 (2) (2007) 2078–2095.

Автоматическое управление — Базовый курс автоматического управления для FIPi

Этот курс запланирован на период первого весеннего квартала.Лекции читаются на шведском языке, но большая часть материалов также доступна на английском языке. Код курса раньше был FRT010.

Запись на повторные экзамены осуществляется здесь


НОВОСТИ

Решения к экзамену 180827 приведены ниже в разделе «старые экзамены». Экзамены можно будет увидеть в офисе Йохана Руусканенса на втором этаже 180912 с 12 до 12.30.

План курса

Подробную программу курса можно найти в программе курса 2018

Дополнительный курс Control Theory (3hp) рекомендуется для студентов, желающих получить больше теории.

Лабораторные занятия

Курс состоит из трех обязательных лабораторных упражнений, которые проводятся на 2-3, 4-5 и 6-7 неделях курса соответственно. На 3-й неделе курса есть добровольные компьютерные упражнения. Вам необходимо записаться на все лабораторные и компьютерные упражнения. См. Ниже информацию о системе регистрации и о том, когда регистрация открывается и закрывается для различных действий.

Система регистрации (ссылка)

По вопросам о лабораториях обращайтесь:

lab1 [email protected]

lab2: [email protected]

lab3: [email protected]

Лаборатория регистрации 1: 15 января —
Компьютерное упражнение для регистрации: 22–28 января
Лаборатория регистрации 2: 23 января —
Лаборатория регистрации 3: 12 февраля —

Руководящие принципы для лабораторий приведены в

.

Лаборатория 1 (Швеция) / (Англия)
Лаборатория 2 (Швеция) / (Англия)
Лаборатория 3 (Швеция) / (Англия)

Литература

Коллекция конспектов лекций Т. Хэгглунда , охватывающая курс, продается в KF.

Курс основан на книгах Reglerteori Карла Й. Острома
и Reglerteknik — Grundläggande teori Т. Глад и Л. Люнга.
Для дальнейшего чтения используйте, например: Системы обратной связи: Введение для ученых и инженеров К. Дж. Острома и Р. Мюррея, доступный для бесплатной полнотекстовой загрузки.

Есть буклет со сборником проблем и решений: (Swe) / (Eng).

Существует сборник общих результатов и формул (formelsamling) (Swe) / (Eng) , ​​которые также можно использовать на экзамене.

Прочие материалы

Вот некоторые материалы, которые помогут вам подготовиться к курсу.

Также доступны старые экзамены вместе с решениями. Было бы неплохо загрузить старые экзамены (иногда у нас возникали проблемы с нашим веб-сервером).

Вы можете скачать диаграммы Боде в формате pdf, чтобы распечатать и нарисовать свои собственные диаграммы Боде. При печати не забудьте установить формат страницы A4 в настройках печати Acroreads.

Вот шведско-английский контрольный словарь

Лекция 1, материал:

Некоторые бонусные материалы:

Краткое вводное видео для управления

Хорошее описание влияния технологии управления в различных областях

Вот забавный ролик про роботов-байкеров.Это еще один впечатляющий клип про робота.

TED-talk о квадрокоптерах

Летающая камера на поводке

Лекция 5: Флайбол губернатор

Лекция 7: Стабилизация велосипеда

Лекция 10: Оценщик скорости

Лекция 11: Дизайн запаздывания и примеры опережающего дизайна

Leture 13: Дизайн шарового отростка (внешний контур)

Лекция 15: Повторение, экзамен март 2008 г., решения

Компьютерные инструменты

Существует набор взаимодействующих обучающих модулей для использования в обучении автоматическому управлению.См.

Учебники по управлению

для Matlab

Вот несколько забавных задач по программированию элементов управления, которые вы можете попробовать.

Вы можете использовать бесплатный инструмент Piazza в качестве дискуссионного форума во время курса. Для начала воспользуйтесь ссылкой для подписки на этот курс.

Видео

Вот несколько коротких видео по темам курса. Эти видео на шведском языке.

Также посмотрите видеоролики Matlab на диаграммах Боде



IJMS | Бесплатный полнотекстовый | Повышенная интегриновая активация тромбоцитов с дефицитом PLD2 ускоряет воспаление после инфаркта миокарда

1.Введение

Фосфолипаза (PL) D1 и PLD2 принадлежат к семейству фосфолипаз, которые катализируют разложение фосфатидилхолина на фосфатидную кислоту (PA) и холин. Как вторичный посредник, PA играет очень важную роль во многих клеточных процессах, таких как клеточная адгезия, миграция клеток и выживание клеток [1,2]. Две изоформы имеют 50% гомологичную последовательность [3] и экспрессируются в лейкоцитах и ​​тромбоцитах, где они важны для опосредованной интегрином клеточной адгезии [4]. Активность PLD можно регулировать по-разному.PLD1 проявляет очень низкую базальную активность и активируется членами семейства Rho, такими как RhoA, Rac1 и протеинкиназа C (PKC). Напротив, PLD2 проявляет высокую базальную активность, но потенциал активации, индуцированный различными активаторами, очень низок [2]. В тромбоцитах PLD1 играет важную роль в опосредованной гликопротеином (GP) Ib активации интегрина и клеточной адгезии, а также в генетической делеции. PLD1 защищает мышей от артериального тромбоза и ишемически-зависимых заболеваний, таких как ишемический инфаркт головного мозга [4].В воспалительных условиях PLD1 поддерживает активацию интегрина α IIb β 3 и прочную адгезию тромбоцитов и иммунных клеток к поврежденному эндотелию. Потеря PLD2 не изменяет активацию интегрина у здоровых мышей, хотя активность PLD в тромбоцитах снижается в отсутствие PLD2 [5]. У мышей, лишенных обеих изоформ, дефекты активации интегрина и дегрануляции защищали этих мышей от артериального тромбоза [6] и ишемического инсульта [7]. Такие же результаты были получены при лечении тромбоцитов и мышей ингибитором PLD FIPI (5-фтор-2-индолил десхлорогалопемид), который блокирует ферментативную активность обеих изоформ PLD [7].После сердечной ишемии и реперфузионного (I / R) повреждения потеря PLD1 привела к увеличению размера инфаркта и нарушению функции левого желудочка через 28 дней после инфаркта миокарда (MI) по сравнению с контрольными мышами. Было показано, что снижение TNF-α-опосредованного воспаления в острой фазе после I / R и измененное TGF-β-опосредованное образование коллагеновых рубцов ответственны за снижение сердечной функции [8]. Фармакологическое ингибирование PLD показало, что ферментативная активность PLD не влияла на передачу сигналов TNF-α и заживление после ИМ у мышей [9].Однако ничего не известно о влиянии PLD2 на регуляцию TNF-α и заживление миокарда после I / R у мышей.

В этом исследовании мы смогли показать, что PLD-опосредованная регуляция TNF-α ограничена PLD1, потому что потеря PLD2 не препятствовала передаче сигналов TNF-α, размеру инфаркта или сердечной функции после iI / R. Однако дефицит PLD2 привел к усилению активации интегрина тромбоцитов в очень острой фазе после ИМ. Измененная активация интегрина индуцировала повышенное высвобождение IL-6 из эндотелиальных клеток in vitro и повышенные уровни IL-6 в плазме после инфаркта миокарда in vivo.Это сопровождалось усилением воспалительного ответа, включая повышенную миграцию воспалительных клеток в зону инфаркта левого желудочка через 24 часа после I / R.

3. Обсуждение

Настоящее исследование показало, что PLD2 регулирует воспаление за счет индуцированного тромбоцитами повышения высвобождения IL-6 из эндотелиальных клеток в острой фазе после I / R миокарда. Усиление воспаления привело к усилению миграции воспалительных клеток в пограничную зону инфаркта в левом желудочке.Однако измененные воспалительные реакции мышей с дефицитом PLD2 не вызывали различий в размере инфаркта, повреждении сердца, формировании рубца или функции левого желудочка через 24 часа и 21 день после инфаркта миокарда. Кроме того, PLD2 не изменяет экспрессию и высвобождение TNF-α, как недавно было показано для PLD1 [8]. Активность PLD усиливается в сердцах после I / R [15] и, как сообщалось, участвует в процессах ишемического прекондиционирования в сердцах кроликов [ 16]. Повышенные уровни белка PLD1 были обнаружены в удаленном миокарде после инфаркта миокарда, но не в рубце, который показывает экспрессию белка PLD2 [17].Более того, образование PA посредством ферментативной активности PLD важно для функции сердца из-за его способности увеличивать внутриклеточную концентрацию свободного Ca 2+ в кардиомиоцитах взрослых, чтобы увеличить сердечную сократительную активность нормального сердца. Кроме того, PA считается важным преобразователем сигналов при гипертрофии сердца [18]. В последние годы мы предоставили доказательства того, что PLD1 модулирует воспаление и образование рубцов, включая регуляцию экспрессии и высвобождения TNF-α, что приводит к увеличению размера инфаркта, снижению качества рубцовой ткани и снижению сердечной функции через 28 дней после инфаркта миокарда [8].Использование ингибитора PLD FIPI, который блокирует ферментативную активность обеих изоформ PLD1 и PLD2, показало, что PLD1-опосредованная регуляция TNF-α, сердечной функции и образования рубцов зависит от неферментативных свойств PLD, в то время как миграция воспалительных клеток в Пограничная зона инфаркта после ИМ зависит от липазной активности PLD. Это было связано с уменьшением инфильтрации лейкоцитов в поврежденную сердечную ткань как у мышей с дефицитом PLD1, так и у мышей, получавших FIPI. Однако только дефицит PLD1 привел к снижению передачи сигналов TNF-α и усилению сердечного повреждения, поскольку лечение мышей FIPI не изменило размер инфаркта или функцию сердца по сравнению с необработанными контрольными мышами [9].В отличие от мышей с дефицитом PLD1, потеря PLD2 привела к усилению воспалительной реакции через 24 часа после инфаркта миокарда. Различные отчеты в прошлом предполагали важную роль PLD2 в воспалении. В отличие от исследования Сперанца и его коллег, которые показали, что подавление PLD2 подавляет способность клеток подвергаться хемотаксису, более поздняя публикация предоставила доказательства увеличения рекрутирования нейтрофилов и макрофагов у мышей с дефицитом PLD2 и нокдауна экспрессии гена Pld2 в остром периоде. повреждение легких [19,20].Таким образом, могут играть роль различные экспериментальные подходы или сценарии воспалительного процесса. Также возможно, что тип воспаления (острое или хроническое) играет роль в PLD2-опосредованной миграции лейкоцитов или поврежденных органов, таких как легкие или сердце.Увеличение воспаления не привело к изменению размера инфаркта, образованию рубцов или сердечной функции. в ранние (24 часа) или поздние (21 день) моменты времени. Это согласуется с различными наблюдениями, демонстрирующими, что измененное воспаление, ремоделирование матрикса и формирование коллагеновой сети левого желудочка вносят вклад в дисфункцию левого желудочка [21].Таким образом, неудивительно, что усиленное воспаление у мышей с дефицитом PLD2 не привело к изменению размера инфаркта или функции сердца. Этот вывод подтверждается анализом мышей с дефицитом PLD1, у которых развиваются изменения сердечного повреждения и функции в результате различий в воспалительной реакции и ремоделировании сердца по сравнению с контрольными мышами [8]. Наши результаты свидетельствуют о том, что PLD2 является негативным регулятором воспаления. после MI. Уже было показано, что PLD2 отрицательно регулирует кровяное давление посредством ингибирования пути передачи сигнала эндотелиальной синтазы оксида азота (eNOS) [22].У животных с сепсисом потеря PLD2 сопровождается повышенной бактерицидной активностью и привлечением нейтрофилов в легкие [23]. Первые доказательства того, что PLD2 является негативным регулятором функции тромбоцитов, было показано на мышах с дефицитом PLD1, которым вводили ингибитор PLD FIPI [24]. Однако тромбоциты с дефицитом PLD2 от здоровых мышей не обнаруживают каких-либо изменений, что позволяет предположить, что эти различия являются результатом неферментативных и ферментативных свойств изоформ PLD. Здесь мы приводим прямые доказательства того, что тромбоциты мышей, перенесших инфаркт миокарда, имеют другой профиль активации, чем тромбоциты здоровых мышей (рис. 2).В то время как тромбоциты с дефицитом PLD2 от здоровых мышей-доноров не показывают значительных различий в активации интегрина или воздействии P-селектина после стимуляции различными агонистами, повышенная активация тромбоцитов в ответ на активацию рецептора, связанного с G-белком, наблюдалась у тромбоцитов с дефицитом PLD2 по сравнению с контролем. тромбоциты через 4 ч после ИМ. Эти результаты предполагают, что ИМ вызывает измененные реакции тромбоцитов, которые могут быть обнаружены в кровообращении мышей. Ингибирование тромбоцитов аспирином и ингибиторами P2Y 12 необходимо у пациентов с острым инфарктом миокарда.Помимо своей роли в тромбозе, тромбоциты, как известно, модулируют воспаление, выживание клеток и восстановление органов, но их роль после инфаркта миокарда четко не определена. Недавние публикации предполагают, что тромбоциты играют роль в острой фазе после инфаркта миокарда, поскольку антитромбоцитарные вмешательства ингибируют рекрутирование воспалительных клеток в инфаркт миокарда [25]. Блокада основного рецептора коллагена тромбоцитов GPVI уменьшала размер инфаркта через 24 ч после ИМ [26]. Кроме того, GPVI участвует в адгезии тромбоцитов к активированному эндотелию, экспрессии воспалительных цитокинов и функции миокарда после инфаркта миокарда [27,28,29].В этом исследовании мы представляем первое доказательство того, что уровни IL-6 в плазме регулируются, по крайней мере частично, тромбоцитами-опосредованной активацией эндотелиальных клеток после инфаркта миокарда. Однако наши данные не показали каких-либо прямых эффектов тромбоцитов с дефицитом PLD2 на лейкоциты, поскольку количество конъюгатов тромбоцитов и лейкоцитов и уровни воспалительных цитокинов, таких как IL-1β и TNF-α, не изменились. Таким образом, усиление миграции воспалительных клеток может быть связано с измененным ИЛ-6 эндотелиального происхождения. Однако мы не можем исключить, что разные клетки и механизмы объясняют увеличение IL-6 в плазме мышей с дефицитом PLD2.Тем не менее, наши данные in vitro ясно показали, что повышенные уровни IL-6 в плазме могут быть, по крайней мере частично, связаны с взаимодействиями тромбоцитов и эндотелиальных клеток, которые модулируются PLD2, полученным из тромбоцитов. У мышей с дефицитом PLD2 уровни TGF-β в плазме. были уменьшены в первые моменты времени после ИМ, но нормализовались через 21 день по сравнению с контрольными мышами (Рисунок 1F и Рисунок 6G). Считается, что тромбоциты могут быть основным источником TGF-β на ранней стадии заживления инфаркта [14]. Таким образом, снижение уровня TGF-β в плазме через 72 часа может быть связано с измененной активацией тромбоцитов у мышей с дефицитом PLD2, перенесших экспериментальный ИМ.Это снижение TGF-β может объяснять усиление воспаления в острой фазе после инфаркта миокарда у мышей с дефицитом PLD2, поскольку TGF-β регулирует функцию воспалительных лейкоцитов, ингибируя экспрессию провоспалительных генов макрофагов. Напротив, макрофаги и фибробласты могут нести ответственность за устойчивую активацию TGF-β во время фазы пролиферации, способствуя конверсии миофибробластов и синтезу внеклеточного матрикса при заживлении инфарктов [14,30]. В эти более поздние моменты времени не наблюдалось различий в уровнях TGF-β в плазме, что позволяет предположить, что снижение TGF-β в ранние моменты времени является результатом измененной активации тромбоцитов у мышей с дефицитом PLD2.

В совокупности это исследование добавляет новую информацию о влиянии измененной активации тромбоцитов на воспаление и раскрывает влияние PLD2 на воспаление и заживление миокарда после инфаркта миокарда, чтобы дополнить наше понимание роли изоформ PLD в процессе повреждения сердца.

4. Материалы и методы

4.1. Животные
Исследования на животных проводились в соответствии с директивами Европейского парламента по использованию живых животных в научных исследованиях и в соответствии с немецким законодательством о защите животных.Протокол был одобрен Комитетом по уходу за животными Университета Генриха Гейне и администрацией округа Северный Рейн-Вестфалия (LANUV; NRW; номер разрешения 84-02.04.2015.A558, период 2016–2021 гг.). Мыши, нацеленные на ген, лишенные PLD2 (Pld2 — / — ), были описаны ранее [31]. Соответствующие однопометники дикого типа были выведены из родительских пар и генотипированы с помощью ПЦР. Мышей анестезировали кетамином (Ketaset, Zoetis, Берлин, Германия, 100 мг / мл) и ксилазином (Wirtschaftsgenossenschaft deutscher Tierärzte eG (WDT), Garbsen, Германия, 20 мг / мл) внутрибрюшинно (т.е.п.) укол перед операцией. Эвтаназия проводилась путем смещения шейного отдела.
4.2. Ишемия и реперфузия миокарда у мышей

Для анализа инфаркта миокарда самцов мышей в возрасте от 10 до 12 недель анестезировали внутрибрюшинной инъекцией раствора с кетамином (90 мг / кг массы тела) и ксилазином (10 мг / кг массы тела). масса). ИМ индуцировали перевязкой левой передней нисходящей артерии (ПНА) на 60 мин. Затем, через 24 часа после реперфузии, определяли ишемическую область (область риска) и область инфаркта (размер инфаркта) путем окрашивания раствором TTC / Evans Blue.Соотношения различных площадей были количественно определены в цифровом виде с помощью видеопланиметрии. Для анализа размера инфаркта в хронической серии размер инфаркта определяли с помощью одноэтапного окрашивания трихромом по Гомори через 3 недели после реперфузии. После успешного прохождения анестезии сердца удаляли, фиксировали в 4% формалине, заливали парафином и делали серийные срезы для окрашивания одноэтапным раствором трихома Гомори. Размер инфаркта выражали как процент от общей площади левого желудочка (ЛЖ).Кроме того, эхокардиография выполнялась в разные моменты времени с использованием ультразвукового аппарата Vevo 2100 (VisualSonics Inc., Ботелл, Вашингтон, США) и различных параметров, например фракции выброса (%), сердечного выброса (мл / мин), фракционного укорочения (%). и ударный объем (мкл) определяли с помощью соответствующего программного обеспечения.

4.3. Коллагеновое окрашивание срезов сердца

Всего через 21 день после взятия ишемии / реперфузии сердца их заливали парафином и готовили срезы этих сердец.Образование рубцов анализировали путем окрашивания этих срезов раствором Гомори, Буэна (Sigma, Дармштадт, Германия) и раствором гематоксилина (Carl Roth, Карлсруэ, Германия). Изображения получали с помощью бинокулярного микроскопа (Nikon SMZ25, Токио, Япония), оценивали с помощью программного обеспечения Zen2 blue edition (Zeiss, Оберкохен, Германия) и определяли отношение размера инфаркта к общей площади левого желудочка. Для определения количества интерстициального коллагена срезы сердца окрашивали красителем Пикросириус красным (Morphisto, Франкфурт-на-Майне, Германия), а раствор Целестина синим (Sigma, Дармштадт, Германия) использовали для окрашивания ядер.Интерстициальный коллаген измеряли в процентах от доли площади. Кроме того, плотность коллагена анализировали с помощью микроскопии в поляризованном свете и оценивали с помощью программного обеспечения Image J.

4.4. Иммуногистохимия срезов сердца

Через 24 часа после кардиального I / R у мышей брали сердца и парафиновые срезы этих сердец окрашивали раствором гематоксилин / эозин (HE) (Carl Roth). Общее количество клеток, мигрировавших в инфарктную область сердца, было подсчитано для каждого поля зрения, и данные представлены для 10 3 / мм 2 .

Для анализа клеток, экспрессирующих PLD1 или PLD2 в левом желудочке, окрашивание стрептавидин-биотин-иммунопероксидазой срезов сердца залитых парафином сердец до и через 24 часа после ишемии / реперфузии проводили с использованием кроличьих антител против PLD1 мыши ( Cell Signaling, Дэнверс, Массачусетс, США) и кроличьего антитела против PLD2 мыши (Acris, Роквилл, Мэриленд, США) с использованием второго набора антител, меченного пероксидазой хрена (HRP) (LSAB2 System-HRP; DAKO, Санта-Клара, Калифорния, США) и реагент диаминобензидин (DAB) (DAKO) в качестве хромогена.Подсчитывали положительные клетки, и данные представляли для каждого поля зрения.

4.5. Иммуноферментный анализ (ELISA)

Для количественного определения IL-1β, IL-6, TNF-α и TGF-β в плазме через 24 часа после ишемии / реперфузии гепаринизированную кровь центрифугировали 10 минут при 650 g. Отбирали плазму и измеряли количество цитокинов с помощью иммуноферментного анализа (ELISA) в соответствии с протоколом производителя (DuoSet Mouse IL-1β / IL-1F2 / DuoSet Mouse IL-6 / DuoSet Mouse TNF-α, R&D Systems, Миннеаполис , Миннесота, США).TGF-β в плазме мышей Pld2 + / + и Pld2 — / — количественно определяли через 72 часа и 21 день после I / R (DuoSet Mouse TGF-β, R&D Systems).

Для анализа тех же уровней цитокинов в супернатанте моноцитов выделяли моноциты, стимулировали липополисахаридом (LPS) 10 мг / мкл и супернатант отбирали через 0, 6, 12 и 24 часа после стимуляции. Моноциты мышей были свежевыделены из цельной крови мышей Pld2 + / + и Pld2 — / — . 400 мл цельной крови центрифугировали 20 мин при комнатной температуре.Лимфоциты разделяли с использованием разделяющего раствора Biocoll (Biochrom) с центрифугированием в течение дополнительных 10 мин. За лизисом эритроцитов следовало мечение клеток с использованием 10 мл микрогранул CD11b (Miltenyi Biotec, Bergisch Gladbach, Германия) на 10 7 клеток. Моноциты разделяли с помощью сепаратора Vario Macs (Miltenyi Biotec).

Чтобы исследовать высвобождение цитокинов эндотелиевыми клетками, уровни IL-6 измеряли в супернатанте либо через агонисты (100 нг / мл TNF-α, 10 мкМ АДФ (Sigma, Дармштадт, Германия), 3 мкМ U46619 (Tocris, Bristol). , Великобритания), 0.005 и 0,02 Ед / мл тромбина) стимулировали клетки MHEC5-T или после совместной инкубации с тромбоцитами, предварительно активированными теми же агонистами через 3,5 часа. Поскольку использовался весь препарат тромбоцитов, проводили контрольные эксперименты для исключения эндотелиальных клеток, секретирующих IL-6 в ответ на агонисты тромбоцитов ADP / U46619 или только тромбин. Клетки MHEC5-T совместно инкубировали с ADP / U46619 или тромбином в отсутствие тромбоцитов, чтобы получить доказательства того, что эти агонисты тромбоцитов сами по себе не способны индуцировать высвобождение IL-6 из эндотелиальных клеток.

Все твердофазные иммуноферментные анализы проводили в соответствии с протоколом производителя.

4.6. Проточный цитометрический анализ формирования агрегатов тромбоцитов-иммунных клеток, нейтрофилов и активации тромбоцитов

До и через 24 и 72 ч после I / R образование агрегатов иммунных тромбоцитов клеток измеряли с помощью проточной цитометрии на основе флуоресценции. Гепаринизированная кровь мышей Pld2 + / + и Pld2 — / — до и после I / R дважды промывалась буфером Тирода, центрифугировалась 5 мин при 650 × g, супернатант удалялся, и только богатый клетками осадок был удален. используется для измерений.Образцы инкубировали с конъюгированными антителами к тромбоцитам (GPIb-PE, Emfret, Eibelstadt, Германия) и нейтрофилам (Ly6G-APC, Biolegend, Сан-Диего, Калифорния, США) или лейкоцитам (CD45-APC, BD Bioscience, Гейдельберг, Германия). и определяли MFI (среднюю интенсивность флуоресценции).

Для определения активации нейтрофилов до и через 24 часа после I / R гепаринизированную кровь мышей Pld2 + / + и Pld2 — / — дважды промывали буфером Тироде путем центрифугирования в течение 5 минут при 650 × g.Осадок инкубировали с антителом Ly-6G Dylight 488 (BD) и APC-CD11b (MAC-1) в течение 15 минут при комнатной температуре. MFI представляет воздействие активированных нейтрофилов MAC-1.

Для измерения активации тромбоцитов гепаринизированную кровь мышей Pld2 + / + и Pld2 — / — через 0, 4, 24 часа и 21 день после I / R промывали буфером Тирода и центрифугировали в течение 5 минут при 650 g. супернатант удаляли и осадок разбавляли буфером Тироде для измерений. Образцы инкубировали с FITC-конъюгированным антителом против P-селектина (Emfret), PE-конъюгированным антителом против интегрина α IIb β 3 (Emfret) и классическими агонистами для активации тромбоцитов, такими как ADP, U46619, CRP (Кембриджский университет , Великобритания) или тромбин (Roche) в течение 7 мин при 37 ° C и 7 мин при комнатной температуре.Активацию интегрина и экспозицию Р-селектина определяли с помощью проточной цитометрии на основе флуоресценции.

4.7. Количественная ПЦР в реальном времени

Для анализа эндогенно экспрессируемых уровней Pld2, TNF-α, IL-1β, Bax и Bcl-xL только выделенная общая РНК левого желудочка сердца через 24 часа после ишемии Pld2 + Использовали мышей / + и Pld2 — / — . Выделение РНК выполняли с помощью системы ReliaPrep RNA Tissue Miniprep (Promega, Mannheim, Германия) в соответствии с протоколом производителя.Количественную ПЦР в реальном времени проводили с использованием смеси Fast Sybr Green Master Mix (Thermo Fischer Scientific) в соответствии с протоколом производителя. Уровень экспрессии мишени был нормализован к уровням экспрессии РНК глицеральдегид-3-фосфатдегидрогеназы (Gapdh) в качестве контроля. После обратной транскрипции была проведена количественная ПЦР-амплификация с использованием следующих олигонуклеотидных праймеров: Pld2 для 5´GAAAGGGATAGGAAAGTCCAGG´3, rev 5´GGGTGGAAAGAGAACCCATAG´3; TNF – α для 5´GCCCCCATCTGACCCC-TTT´3; rev 5´GGGGCTGGCTCTGTGAGGAA´3; IL-1β для 5´AGCTTCCTTGTGCAAGTGTCTGAG´3, rev 5´TGTTGATGTGCTGCTGCGAGAT´3; Bax для 5´TGAAGACAGG GGCCTTTTTG´3; ред. 5´AATTCGCCGGAGACACTCG´3; Bcl – xL для 5´GACAAGGAGATGCAGGTATTGG´3; rev 5´TCCCGTAGAGACCACAAAAGT´3; GAPDH для 5´GGTGAAGGCGGTG-TGAACG´3, rev 5´CTCGCTCCTGGAAGATGGTG´3.

4.8. Статистический анализ

Все эксперименты проводили, по крайней мере, три раза с n, определенным как отдельное животное. Данные представлены как средние значения ± SEM, как указано. Статистический анализ выполняли с использованием двустороннего t-критерия Стьюдента, одностороннего дисперсионного анализа с апостериорным критерием Даннета или двустороннего дисперсионного анализа с апостериорным критерием Сидака, как указано. Значение p <0,05 было признано значимым. Для всех цифр * p <0,05, ** p <0,01 и *** p <0,001. Коэффициент корреляции Спирмена (ρ) определяли, как указано.ρ = -1 указывает на сильную отрицательную корреляцию, ρ = 0 указывает на отсутствие корреляции, а ρ = +1 указывает на сильную положительную корреляцию.

Лица: Семенов Алексей Львович

В вашем браузере отключен JavaScript. Пожалуйста, включите его, чтобы использовать полную функциональность веб-сайта


Семенов Алексей Львович

Всего публикаций: 118 (90)
в MathSciNet: 47 (37)
в zbMATH: 26 (21)
в Web of Science: 22 (15)
в Scopus: 10 (10)
Цитированные статьи: 19
Цитирование в Math-Net.Ру: 102
Цитирование в Web of Science: 195
Цитирование в Scopus: 92
Презентации: 10

905
Количество просмотров:
Эта страница: 6160
Страницы аннотации: 14810
Полные тексты: 5392
Академик РАН
Профессор
Доктор физико-математических наук
Дата рождения: 13.10.1950
Эл. Почта: электронная почта
Ключевые слова: Разрешимость логических теорий, определимость в структурах словесная комбинаторика, символическая динамика, определимость почти периодических последовательностей, редукции, теорема Свенониуса
УДК: 517.11, 519.9, 510.53, 510.6, 621.391.1, 519.2, 510.5, 519.101, 517.938, 510.635

Тема:

Математические основы компьютерных наук

Основные публикации:
  1. С.А. Поликарпов, А. Л. Семенов, «Математика для школы 21 века: российский опыт и международные перспективы», Материалы 13-го Международного конгресса по математическому образованию (ICME-13). (Гамбург, 2016), ред. Габриэле Кайзер, Springer International Publishing AG, Чам, Швейцария, 2017 г., 675–676
  2. А. Л. Семенов, “О реализации концепции математического образования”, Наука и школа, 6 (2016), 3
  3. А. Л. Семенов, С. Ф. Сопрунов, “Комбинаторный вариант теоремы Свенониуса об определимости”, Лог.J. IGPL, 23: 6 (2015), 966–975
  4. А. Л. Семенов, “О фундаментальных понятиях кибернетики и информатики”, Вестник кибернетики, 3 (19) (2015), 22–26
  5. . А. Семенов, С. Сопрунов, В. Успенский, “Решетка определимости. Истоки, недавние разработки и дальнейшие направления », Информатика — теория и приложения, Конспект лекций по вычислениям. Sci., 8476, Springer, Cham, 2014, 23–38
  6. А. Л. Семенов, С. Ф. Сопрунов, “Конечные кванторные иерархии в реляционных алгебрах”, Тр.Стеклова Матем., 274 (2011), 267–272
  7. А. Л. Семенов, С. Ф. Сопрунов, Решетка реляционных алгебр, определимых целыми числами с преемником, 2011, arXiv: 1201.4439
  8. An. А. Мучник, Ю. Л. Притыкин, А. Л. Семенов, “Последовательности, близкие к периодическим”, УМН. Обзоры, 64: 5 (2009), 805–871
  9. Алексей Семенов, Информационные и коммуникационные технологии в школах. Справочник для учителей или как ИКТ могут создавать новую открытую среду обучения, ЮНЕСКО, Париж, 2005 г., 327 стр.; Семенов А.Л. Информационные и коммуникационные технологии в общем образовании: теория и практика. Авторизованный пер. с англ., переработанный и дополненный, ЮНЕСКО, 2006, 327 с.
  10. An. А. Мучник, А. Л. Семенов, “О роли закона больших чисел в теории случайности”, Пробл. Трансмиссия, 39: 1 (2003), 119–147
  11. А. Л. Семенов, А. А. Мучник, “Улучшение оценок Колмогорова, связанных с генераторами случайных чисел, и определение случайности в терминах сложности”, Докл.Акад. Наук, 68: 1 (2003), 132–134
  12. А. Мучник, А. Семенов, М. Ушаков, “Почти периодические последовательности”, ТМФ. Comput. Sci., 304: 1-3 (2003), 1–33
  13. Алексей Семенов, Андрей Мучник, “40 лет возникновения теории случайности Колмгорова”, Матем. Колмогоров и современная математика. Тезисы докладов Международной конференции, посвященной 100-летию со дня рождения А. Н. Колмогорова (Москва, 16 21 июня 2003 г.), Издательство механико-математического факультета МГУ, 2003, 677–907. А.А. Мучник, А. Л. Семенов, В. А. Успенский, “Математическая метафизика случайности”, ТМФ. Comput. Наук, 207: 2 (1998), 263–317
  14. А. Л. Семенов, «Информатика в российской средней школе: доклад на пленарном заседании II Международного конгресса ЮНЭСКО Образование и информатика», Информатика и образование, 5 (1996), 29
  15. В. Успенский, А. Семенов, Алгоритмы: основные идеи и приложения, Математика и ее приложения, 251, Kluwer Academic Publishers Group, Dordrecht, 1993, xii + 269 pp.
  16. Успенский В. А., Семенов А. Л., «Колмогоровские алгоритмы или машины», Избранные труды А. Н. Колмогорова. Vol. III. Информация и теория алгоритмов., III, Math. Прил. Kluwer Academic Publishers, 1993, 251–260
  17. В.А. Успенский, А.Л. Семенов, А.Х. Шень, “Может ли отдельная последовательность нулей и единиц быть случайной?”, УМН. Обзоры, 45: 1 (1990), 121–189
  18. Успенский В. А., Семенов А. Л., “Алгоритмы, или машины Колмогорова”, А.Н. Колмогоров. Теория информации и теория алгоритмов. Избранные труды, ред. А. Н. Ширяев, Наука, Москва, 1987, 279–289
  19. Успенский В. А., Семенов А. Л. Теория алгоритмов: основные открытия и приложения, Библиотека программиста, Наука, 1987, 288 с.
  20. А. Л. Семенов, В. А. Успенский, “Математическая логика в вычислительных науках и вычислительной практике”, Вестник Академии наук СССР, 56: 7 (1986), 93–103
  21. . А.Л. Семенов, “Разрешимость монадических теорий”, Математические основы информатики, 1984 (Прага, 1984), Lecture Notes in Comput. Sci., 176, Springer, Berlin, 1984, 162–175
  22. А. Л. Семенов, “Логические теории одноместных функций на множестве натуральных чисел”, Матем. СССР-Изв., 22: 3 (1984), 587–618
  23. А. Л. Семенов, “О некоторых расширениях арифметики сложения натуральных чисел”, Матем. СССР-Изв., 15: 2 (1980), 401–418
  24. А.Л. Семенов, “Регулярность языков, $ k $ -линейных для различных $ k $”, Доклады Академии наук СССР, 215 (1974), 278–281
  25. . А. Л. Семенов, “Алгортмические задачи для степенных рядов и контекстно-свободных грамматик”, Советская математика, 14 (1973), 1319

http://www.mathnet.ru/rus/person19667
Список публикаций в Google Scholar
https: // zbmath.org / авторы /? q = ai: semenov.alexei-l
https://mathscinet.ams.org/mathscinet/MRAuthorID/218197
https://elibrary.ru/author_items.asp?spin=2289-1720
ИСТИНА http://istina.msu.ru/workers/85
http://orcid.org/0000-0002-1785-2387
https://publons.com/researcher/1853196
http: // www.researchcherid.com/rid/S-5268-2018
https://www.scopus.com/authid/detail.url?authorId=7402499019
https://www.researchgate.net/profile/Alexei_Semenov2
https://arxiv.org/a/Asemenov

Полный список публикаций: . ; ; ; . ; ; ; . ; . . . . . . ; . .

2021
1. А. Л. Семенов, С. Ф. Сопрунов, “Решетка определимости (редуктов) для целых чисел с преемником”, Изв. РАН. Сер. Мат., 85 (2021) (в печати)
2. В. С. Атабекян, Л. Д. Беклемишев, В. С. Губа, И. Г. Лысенок, А. А. Разборов, А. Л. Семенов, “Вопросы алгебры и математической логики. Научное наследие С. И. Адяна ”, УМН. Обзоры, 76: 1 (2021), 1-27
3. Атабекян В.С., Беклемишев Л.Д., Бухштабер В.М., Гончаров С.С., Губа В.С. Ершов, В.В. Козлов, И.Г. Лысенок, С.П. Новиков, Ю.А. Осипов, М.Р. Пентус, В.В. Подольский, А.А. Разборов, В.А. Садовничий, А.Л. Семенов, А.Л. Таламбуца, Д.В. Трещев, Л.Н. Шеврин, “Сергей Иванович Адян (некролог)”, УМН. Обзоры, 76: 1 (2021), 177–181

2020
4. An. А. Мучник, А. Л. Семенов, “Решетка определимости в порядке рациональных чисел”, Матем. Примечания, 108: 1 (2020), 94–107
5. Алексей Семенов, Сергей Поликарпов, «Цифровая трансформация школы и роль математики и информатики в ней. Проблемы и парадоксы математического образования и их цифровое решение», Материалы 4-й Международной конференции по информатизации образования и методологии электронного обучения: цифровые технологии in Education (IEELM-DTE 2020), Красноярск, Россия, 6–9 октября 2020 г., Материалы семинара CEUR, 2770, Sun SITE Central Europe, Ахен, Германия, 2020 г., 1–8;
6. В. Б. Бетелин, А. Г. Кушниренко, А. Л. Семенов, С. Ф. Сопрунов, “О цифровой грамотности и средах ее развития”, Информ. И ее примен., 14: 4 (2020), 100–107
7. А. Л. Семенов, “Отображения, сохраняющие отношения, определяемые линейным порядком”, Вестник МГУ, Вестник механики МГУ, 75: 5 (2020), 222–226

2019
8. Семенов А.Л., «В. А. Успенский как историк математики, науки и цивилизации. К чему трюк Александра Шеня с умножением Гаусса? », Математическое просвещение, 3:24 (2019), 16–18 https://www.mccme.ru/free-books/matpros-24.html
9. Адян С.И., Андреев Н.Н., Беклемишев Л.Д., Гончаров С.С. Л. Ершов, Ю. В. Матиясевич, Ю. Осипов С., Пентус М.Р., Плунгян В.А., Плунгян Э.В.Рахилина, В.А. Садовничий, А.Л. Семенов, С.Г. Татевосов, В.М. Тихомиров, А.Х. Шен, “Владимир Андреевич Успенский (27.11.1930–27.06.2018)”, УМН. Опросы, 74: 4 (2019), 735–753

2018
10. Р. Б. Куприянов, А. Л. Семенов, «Анализ динамики образовательных результатов студентов крупного педагогического университета», Вестник Московского городского педагогического университета, Информатика и информатизация образования, 2018, 66–67
11. Четверушкин Б.Н., Тыртышников Е.Е., Кудрявцев Н.Н., Дымников В.П. Журавлев И., Сон Э. Э., Рудаков К. В., Сон Ю. Евтушенко, А.Б. Жижченко, Ю. Гуляев, А.С. Бугаев, А.Н. Коновалов, В.П. Маслов, В.М. Бердышев, А.Л. Семенов, Е.И. Моисеев, И.Б. Петров, Ю.А. А.Флеров, И.Г. Поспелов, С.И. Кабанихин, М.В. Якобовский, В.Ф. Тишкин, Ю. Василевский, А.А. Шананин, В.А. Гущин, И.С. Никитин, А.И. Лобанов, В.В. Демченко, Э.Л. Ступицкий, В. Л. Якушев, А. В. Бабаков, Ю. Д. Шевелев, С. А. Ишанов, В. С. Рябенький, “Памяти Александра Сергеевича Холодова”, Матем. Моделирование, 30: 1 (2018), 135–136

2017
12. Поликарпов С.А., Семенов А.Л. «Математика для школы 21 века: российский опыт и международные перспективы», Материалы 13-го Международного конгресса по математическому образованию (ICME-13).(Гамбург, 2016), ред. Габриэле Кайзер, Springer International Publishing AG, Чам, Швейцария, 2017 г., 675–676
13. А.Л. Семенов, А.Ю. Уваров, «Обновление технологического образования и информатизация школы», Вестник Московского городского педагогического университета, Информатика и информатизация образования, 4, Москва, 2017, 17–31
14. Алексей Семенов, «Сеймур Паперт и мы.Конструкционизм как педагогическая философия XXI века », Вопросы образования, 1 (2017), 269–294
15. А.А. Аграчев, Р.В. Гамкрелидзе, Э.С. Голод, А.Б. Жижченко, Ю. И. Журавлев, В. В. Козлов, А. В. Михалев, А. В. Овчинников, Н. Х. Розов, А.Л. Семенов, В.Г. Чирский, В.А. Шамолин, “Юбилей профессора М.В. Шамолина”, Динамические системы, Итоги науки и техн. Сер. Совр.Мат. Прил. Темат. Обз., 134, ВИНИТИ, Москва, 2017, 3–5

2016
16. А. Л. Семенов, “Концептуальные проблемы информатики, алгоритмики и программирования в школе”, Вестник кибернетики, 2 (22) (2016), 11–15
17, А. Л. Семенов, “О реализации концепции математического образования”, Наука и школа, 6 (2016), 3

2015
18. А. Л. Семенов, С. Ф. Сопрунов, “Комбинаторный вариант теоремы Свенониуса об определимости”, Лог. J. IGPL, 23: 6 (2015), 966–975
19. А. Л. Семенов, «Вариативная математика», Образовательная политика, 1 (67) (2015), 95–97
20. А.Л. Семенов, А.Ю. Уваров, «Тридцать лет это все-таки мало», Информатика и образование, 7 (2015), 3
21. А. Л. Семенов, “О фундаментальных понятиях кибернетики и информатики”, Вестник кибернетики, 3 (19) (2015), 22–26

2014
22. А. Семенов, С. Сопрунов, В. Успенский, “Решетка определимости. Истоки, недавние разработки и дальнейшие направления », Информатика — теория и приложения, Конспект лекций по вычислениям.Sci., 8476, Springer, Cham, 2014, 23–38
23. Э. И. Булин-Соколова, А. С. Обухов, А. Л. Семенов, «Будущее педагогическое образование. Направление движения и первые практические шаги ”, Психологическая наука и образование, 19: 3 (2014), 207–226
24. А. Л. Семенов, С. Л. Атанасян, “Формирование математической компетенции в основной школе”, Наука и школа, 5 (2014), 7–12
25. Семенов А.Л., Атанасян С.Л., Каракозов С.Д., «Ключевые идеи концепции развития математического образования в Российской Федерации», Информатика в школе: Прошлое, настоящее и будущее: материалы по всемирно-французской медицине. в образовании (Пермь, 2014), Пермь. гос. нац. исслед. ун-т, 2014, 264–266
26. А. Л. Семенов, “Две культуры в современной школе (часть 1)”, Математика в школе, 5 (2014), 21–26
27. А. Л. Семенов, “Две культуры в современной школе (часть 2)”, Математика в школе, 6 (2014), 21–26
28. В.Л. Арлазаров, Э.А.Диниц, Ю. С. Ильяшенко, А. В. Карзанов, С. М. Карпенко, А. А. Кириллов, Н. Н. Константинов, М. А. Кронрод, О. П. Кузнецов, Л. Б. Окунь, П. А. А. Певзнер, А. Л. Семенов, И. А. Фараджев, Б. В. Черкасский, А. Г. Хованский, “Георгий Максимович Адельсон-Вельский (некролог)”, УМН, 32: 3Опросы, 69: 4 (2014), 743–751
29. Н. Н. Андреев, В. М. Бухштабер, А. И. Гарбер, В. В. Козлов, С. П. Коновалов, А. А. Мальцев, Ю. В. Нестеренко, С. П. Новиков, А. Н. Паршин, И. Х. А. Сабитов, А. Л. Семенов, А. Г. Сергеев, О. К. Шейнман, М. И. Штогрин, Е. В. Щепин, “Николай Петрович Долбилин (к 70-летию со дня рождения)”, УМН. Обзоры, 69: 1 (2014), 181–182
30. Высоцкий И.Р., Захаров П.И., Панферов В.С., Посицельский С.Е., Семенов А.В., Семенова М.А., Сергеев И.Н., Смирнов В. А. Шестаков, Д. Э. Шнол, А. Л. Семенов, И. В. Ященко, Математика. Теории вероятности и статистики. ЕГЭ 2014, Экзамен, Москва, 2014, 95 с.
31. Высоцкий И.Р., Захаров П.И., Панферов В.С., Посицельский С.Е., Семенов А.В., Семенова М.А., И.Н. Сергеев, В. А. Смирнов, С. А. Шестаков, Д. Э. Шнол, А. Л. Семенов, И. В. Ященко, Математика. Базовый и профессиональный уровень ЕГЭ 2014. Типовые тестовые задачи, Экзамен, Москва, 2014, 56 с.
32. Высоцкий И.Р., Захаров П.И., Панферов В.С., Посицельский С.Е., Семенов А.В., Семенова М.А., Сергеев И.Н., Смирнов В. Шестаков А., Шнол Д. Е., Семенов А. Л., Ященко И. В., К демонстрационной версии ЕГЭ от 31.10.13. Базовый и профессиональный уровень ЕГЭ 2014, Экзамен, Москва, 2014, 216 с.
33. А. Л. Семенов, А. С. Соколов, «Приношения музыки-педагогу», Вестник кафе ЮНЭСКО Музыкальное искусство и образование. 3 (7), 17

2013
34. А. Л. Семенов, “Концепция развития российского математического образования (ход проекта)”, Математика в школе, 9 (2013), 3–5
35. А. Л. Семенов, С. Д. Каракозов, “Московское образование в условиях вступления в силу нового закона образования”, Вестник алтайской науки, 3 (2013), 300–302
36. А. Л. Семенов, С. Л. Атанасян, «О концепции развития российского математического образования», Наука — образования, 2 (2013), 6
37. А.Л. Семенов, «Как дети учит лучше?», Альманах Высшая школа XXI века, 19 (2013), 3
38. Д.А. Архангельский, Б.С. Байжанов, О.В. Белеградек, В.Я. Беляев, Л.А. Бокут, М.К. Валиев, С.К. Водопьянов, М.Гитик, Ю. Гуревич, Д.О. Дадеркин, А.М. Дехтяр, М.И. Дехтяр, А.Я. Диковский, С.М. Дудаков, Э.И. Зельманов, Б.И. Зильбер, С.Л. Крушкал, С.С. Кутателадзе, Ю. В. Матиясевич, Г. Е. Минц, И. Х. Мусикаев, А.К. Ребров, Ю. Г. Решетняк, А. Л. Семенов, А. П. Столбушкин, И. А. Тайманов, Б. А. Трахтенброт, “Михаил Абрамович Тайцлин (1936–2013)”, Сиб.Èlektron. Мат. Изв., 10 (2013), 54–65
39. Семенов А.Л., «Кадры решают все», Всероссийская общественно-политическая газета Властная вертикаль Федерации, 5 (2013), 3
40. А. Л. Семенов, «Кому и какая примерная программа нужна, кто ее должен разрабатывать?», Учительская газета, 24 (2013), 3
41. А.Л. Семенов, «Все, что спрятал, пропало», Газета «Поиск», 12 (2013), 3
42. А. Л. Семенов, «Как сегодня повысить квалификацию директорам школы?», Учительская газета, 9 (2013), 3
43. Семенов А.Л., Две культуры сегодня. Математика и литература, Занятия литературы в гуманитарных и математических классах. Сочинения, игры, путешествия, Московский институт открытого образования, Институт новых технологий, Москва, 2013.245 с.
44. Семенов А.Л., Сергеев И.Н., Панферов В.С., Ященко И.В., Математика. 30 вариантов типовых тестовых заданий и 800 заданий части 2 (s). ЕГЭ 2013. Типовые тестовые задачи, Экзамен, Москва, 2013, 216 с.

2012
45. Семенов А. Л., Математика текстов.Учебное пособие, МЦНМО, 2012, 16 с.
46. Булин-Соколова, Т.А. Рудченко, А.Л. Семенов, Е.Н. Хохлова, Формирование ИКТ-компетенции младших школьников: пособие для учителей общеобразоват. Учреждения, Просвещение, 2012, 128 с.

2011
47. А.Л. Семенов, С. Ф. Сопрунов, “Конечные кванторные иерархии в реляционных алгебрах”, Тр. Стеклова Math., 274 (2011), 267–272 (цитируется: 1) (цитируется: 1) (цитируется: 2)
48. А. Л. Семенов, «ИКТ-компетенции учащихся. ИКТ как инструменты универсальных учебных действий: подпрограмма формирования », Труды Большого московского семинара по методике раннего обучения информатики, Москва, 2011, 149–156
49. А. Л. Семенов, С. Ф. Сопрунов, Решетка реляционных алгебр, определимых целыми числами с преемником, 2011, arXiv: 1201.4439
50. Л. Д. Беклемишев, В. М. Бухштабер, И. Г. Лысенок, А. А. Мальцев, С. П. Новиков, А. А. Разборов, А. Л. Семенов, «Сергей Иванович Адян (на его восьмидесятилетие) ”, Русская математика. Обзоры, 66: 1 (2011), 197–198

2010
51. А.Г. Асмолов, А.Л. Семенов, А.Ю. Уваров, «Мой ждем перемен. Чему и как будет учиться подрастающее поколение и XXI век », Дети в информационном обществе, 5 (2010), 20
52. Е. И. Булин-Соколова, А. Л. Семенов, “Построение программы формирования ИКТ-компетенции учащихся и информационной образовательной среды основной школы”, Информатика и образование, 8 (2010), 3–7
53. А. А. Кузнецов, А. Л. Семенов, С. А. Бешенков, А. Г. Кушниренко, “Примерная программа по информатике и ИКТ (VII IX класс)”, Информатика и образование, 8 (2010), 3–7
54. Е. И. Булин-Соколова, А. Л. Семенов, “Читаем ФГОС НО, пищем ООП, включая ИКТ в ПФУУД”, Народное образование, 7 (2010), 21–30
55. В. М.А. Кругляков, Э. Л. Рачевский, А. Л. Семенов, “За что платит школа? Заметки на полях директивных документов », Народное образование, 10 (2010), 5861
56. Ященко И.В., Высоцкий И.Р., Гущин Д.Д., Захаров П.И., Посицельский С.Е., Семенова А.В., Шестаков С.А., Шнол Д. А. Смирнов, В. С. Панферов, М. А. Семенова, А. Л. Семенов, ЕГЭ 2010. Математика. Типовые тестовые задачи, Экзамен, Москва, 2010, 64 с.
57. Панферов В. С., Сергеев И. Н., Семенов А. Л., Ященко И. В. и др., Самое полное издание типовых реальных заданий ЕГЭ Русский язык, математика, общество. ФИПИ, АСТ, 2010, 480 с.
58. А.Г. Асмолов, А.Л. Семенов, А.Ю. Уваров, Российская школа и новые информационные технологии: взгляд в следующее десятилетие, НексПринт, 2010, 95 с.

2009
59. An. А. Мучник, Ю. Л. Притыкин, А. Л. Семенов, “Последовательности, близкие к периодическим”, УМН. Surveys, 64: 5 (2009), 805–871 (цитируется: 9) (цитируется: 6) (цитируется: 6) (цитируется: 11)
60. Алексеев И.Г., Волошин М.В., Гиппиус Н.А., Данилов М.В.,Казанцев, А.Д. Миронов, А.Ю. Морозов, Л. Б. Окунь, В. А. Рубаков, Д. Н. Свирида, А. Л. Семенов, П. Г. Тиняков, «Памяти Владимира Владимировича Бронфмана», Успехи физ. наук, 179: 12 (2009), 1373–1374 (цит. по: 1)
61. Е. И. Булин-Соколова, А. Л. Семенов, “Мониторинг здоровья учащегося как элемент индивидуализации обучения”, Культура физическая и здоровье, 6 (2009), 61–64
62. Е. И. Булин-Соколова, А. Л. Семенов, “Школа информатизации: путь к обновлению образования”, Информатика и образование, 11 (2009), 3–12
63. An. А. Мучник, Ю. Притыкин Л., Семенов А.Л. Последовательности, близкие к периодическим, 2009, arXiv: abs / 0903.5316

2008
64. А. Л. Семенов, М. А. Посицельская, «О связи раннего обучения информатике и коррекционно-развивающей работы с дошкольниками и младшими школьниками: тетради Математика и информатика», Сборник Труды Большегогогораматика и информационного обмена. ред. Соколова, Ю.В. А. Первин, Москва, 2008, 164–171

2007
65. С. И. Адян, А. Л. Семенов, В. А. Успенский, “Андрей Альбертович Мучник (некролог)”, УМН. Опросы, 62: 4 (2007), 775–779 (цит. По: 1)

2006
66. А. Мучник, А. Семенов, “Эффективные оценки сходимости, описательная сложность и естественные примеры простых и гиперпростых множеств”, Анн.Pure Appl. Логика, 141: 3 (2006), 437–441
67. Л. Д. Беклемишев, И. Г. Лысенок, А. А. Мальцев, С. П. Новиков, М. Р. Пентус, А. А. Разборов, А. Л. Семенов, В. А. Успенский, «Сергей Иванович Адян (к 75-летию со дня рождения)», Русская математика. Обзоры, 61: 3 (2006), 575–588

2005
68. Кондаков А.М., Семенов А.Л., Галишникова Т.И., Фиалкова Т.А., Станченко Н.С., «Коллекции на Российском образовательном портале www.school.edu.ru: интернет-проект Культурное наследие» , Открытое образование, 3 (2005), 31–58
69. А. Л. Семенов, “Качество информатизации школьного образования”, Вопросы образования, 3 (2005), 248–270
70. Алексей Семенов, Информационные и коммуникационные технологии в школах.Справочник для учителей или «Как ИКТ могут создавать новую открытую среду обучения», ЮНЕСКО, Париж, 2005 г., 327 стр .; Семенов А.Л. Информационные и коммуникационные технологии в общем образовании: теория и практика. Авторизованный пер. с англ., переработанный и дополненный, ЮНЕСКО, 2006, 327 с.

2004
71. Семенов А. Л. Современный курс математики и информатики в школе.Часть 1 », Вопросы образования, 1 (2004), 79
72. Семенов А. Л. Современный курс математики и информатики в школе. Часть 2 », Вопросы образования, 2 (2004), 110

2003
73. An. А. Мучник, А. Л. Семенов, “О роли закона больших чисел в теории случайности”, Пробл.Трансмиссия, 39: 1 (2003), 119–147
74. А. Л. Семенов, А. А. Мучник, “Улучшение оценок Колмогорова, связанных с генераторами случайных чисел, и определение случайности в терминах сложности”, Докл. Акад. УМН, 68: 1 (2003), 132–134
75. А. Мучник, А. Семенов, М. Ушаков, “Почти периодические последовательности”, ТМФ. Comput. Sci., 304: 1-3 (2003), 1–33 (цитировано: 19) (цитировано: 25)
76. А. Л. Семенов, М. М. Горбунов-Посадов, Т. А. Полилова, «Школа на пути к новой грамотности», Препринты ИПМ им. М. В. Келдыша, 2003 г., 55–20
77. Семенов А.Л., Рудченко Т.А., «Выступают авторы учебников», Информатика и образование, 1 (2003), 10
78. Семенов А.Л., Рудченко Т.А., «Информатика 24», Информатика и образование, 1 (2003), 17
79. М. М. Горбунов-Посадов, Т. А. Полилова, А. Л. Семенов, «Школа и технологии новой грамотности», Информационные технологии и вычислительные системы, 4 (2003), 87–99
80. Алексей Семенов, Андрей Мучник, “40 лет возникновения теории случайности Колмгорова”, Матем. Колмогоров и современная математика. Тезисы докладов Международной конференции, посвященной 100-летию со дня рождения А.Н. Колмогорова (Москва, 16 21 июня 2003), Издательство механико-математического факультета МГУ, 2003, 677–678
81. А. Л. Семенов, “Условия конечности алгебр отношений”, Тр. Стеклова Матем., 242 (2003), 92–96
82. Горбунов-Посадов М.М., Полилова Т.А., Семенов А.Л. // Информационные технологии и вычислительные системы.4, 87–99

2002
83. А. Л. Семенов, “Тематическое планирование учебного материала по программе информатика”, Информатика и образование, 3 (2002), 5
84. Семенов А.Л., Математика текстов, Издательство Московского центра непрерывногоматематического образования, 2002, 16 с.

2001
85. А. Л. Семенов, “Рол информационных технологий в общем среднем образовании”, Информатика и образование, 2 (2001), 2

2000
86. А. Л. Семенов, “Информационные технологии в начальном образовании”, Школьные технологии, 6 (2000), 168

1999
87. Алексей Семенов, «Технологии в трансформации образования», Коммуникация и сети в образовании: обучение в сетевом обществе, IFIP TC3 / ​​WG3.1 Открытая конференция по коммуникации и сетям в образовании (Ауланко, Финляндия, 13–18 июня 1999 г.), IFIP Материалы конференции, 163, Kluwer, 1999, 25–38

1998
88. А.А. Мучник, А. Л. Семенов, В. А. Успенский, “Математическая метафизика случайности”, ТМФ. Comput. Sci., 207: 2 (1998), 263–317 (цитировано: 48) (цитировано: 54)
89. А. Л. Семенов, “Математическая информатика в школе”, Информатика и образование, 5 (1998), 54
90. С. К. Ландо, А. Л. Семенов, “Алгоритмика: учебная программа курса”, Информатика и образование, 3 (1998), 94

1996
91. А. Л. Семенов, “Информатика в российской средней школе: доклад на пленарном заседании II Международного конгресса ЮНЭСКО Образование и информатика”, Информатика и образование, 5 (1996), 29

1995
92. Н. Д. Угринович, А. Л. Семенов, “Программа непрерывного курса информатики для средней школы”, Информатика и образование, 4 (1995), 12
93. А. Л. Семенов, “Образование, информатика, компьютеры”, Информатика и образование, 5 (1995), 6
94. А. Л. Семенов, “Математическая информатика в школе”, Информатика и образование, 5 (1995), 6

1993
95. В. Успенский, А. Семенов, Алгоритмы: основные идеи и приложения, Математика и ее приложения, 251, Kluwer Academic Publishers Group, Dordrecht, 1993, xii + 269 pp.
96. Успенский В. А., Семенов А. Л., «Колмогоровские алгоритмы или машины», Избранные труды А. Н. Колмогорова. Vol. III. Информация и теория алгоритмов., III, Math. Прил. Kluwer Academic Publishers, 1993, 251–260

1992
97. Колмогоров А.И. Адян, А.Г. Драгалин, А.С. Кузичев, Е.Ю. Н. Ногина, А. Л. Семенов, В. А. Успенский, “Математическая логика и теория алгоритмов на механико-математическом факультете МГУ”, Математика в Московском университете, Издательство Московского университета, 1992, 128–155
98. А.В. Архангельский, Б.А. Пасынков, В.И. Пономарев, В.В. Федорчук, С.П. Гулько, В.И. Малыхин, А.Л. Семенов, Е.В. Щепин, Г.П. Амирджанов, А.П. Комбаров, Д. В. Ранчин, В. В. Успенский, Л. Б. Шапиро, А. П. Шостак, “Борис Эмильевич Шапировский (некролог)”, УМН. Обзоры, 47: 6 (1992), 199–201

1990
99. В.А. Успенский, А.Л. Семенов, А.Х. Шень, “Может ли отдельная последовательность нулей и единиц быть случайной?”, УМН. Обзоры, 45: 1 (1990), 121–189 (цит. По: 56)
100. А. К. Поливанова, А. Л. Семенов, «Я не математик», Языки логики и логика языка. Сборник статей к 60-летию профессора В. А. Успенского, Вопросы кибернетики, 166, Научный совет по комплексной проблеме Кибернетика АН СССР, Москва, 1990, 195–199

1988
101. А. Л. Семенов, “Простое подробное доказательство теоремы Гёделя о неполноте”, Кибернетика (Прага), 24: 6 (1988), 447–451
102. В. Г. Вовк, А. Л. Семенов, С. Ф. Сопрунов, “Некоторые способы проверки правильности программ на ассемблере”, Методы и алгоритмы анализа больших систем, Вопросы кибернетики, 136, ред. Карманов В.Г., Научный совет по комплексной проблеме Кибернетика АН СССР, Москва, 1988, 56–78

1987
103. В.А. Успенский, А. Л. Семенов, “Алгоритмы, или машины Колмогорова”, А. Н. Колмогоров. Теория информации и теория алгоритмов. Избранные труды, ред. А. Н. Ширяев, Наука, Москва, 1987, 279–289
104. Успенский В. А., Семенов А. Л. Теория алгоритмов: основные открытия и приложения, Библиотека программиста, Наука, 1987, 288 с.

1986
105. А. Л. Семенов, В. А. Успенский, “Математическая логика в вычислительных науках и вычислительной практике”, Вестник Академии наук СССР, 56: 7 (1986), 93–103 (цит. По: 2)
106. А. Л. Семенов, “Разрешающие процедуры для логических теорий”, Кибернетика и компьютерная технология, 2, Наука, М., 1986, 134–146

1985
107. А. Л. Семенов, С. Ф. Сопрунов, «О языке комбинаторно-логического процесса», Эффективное использование высокопроизводительных ЭВМ. Серия Вопросы кибернетики., 117, Научный совет по комплексной проблеме Кибернетика АН СССР, Москва, 1985, 182–191
108. В. А. Успенский, А. Л. Семенов, “Решимые и нерешимые алгоритмические проблемы”, Квант, 7 (1985), 9–15

1984
109. А. Л. Семенов, “Разрешимость монадических теорий”, Математические основы информатики, 1984 (Прага, 1984), Lecture Notes in Comput. Sci., 176, Springer, Berlin, 1984, 162–175
110. А. Л. Семенов, “Логические теории одноместных функций на множестве натуральных чисел”, Матем. СССР-Изв., 22: 3 (1984), 587–618

1982
111. А. Л. Семенов, “Об определении арифметики в ее фрагментах”, Докл. Академии наук СССР, 263: 1 (1982), 44–47 (цитировано: 2) (цитировано: 3)

1981
112. Успенский В. А., Семенов А. Л. Каковы достижения теории алгоритмов: основные разработки, связанные с концепцией алгоритма и его применением в математике », Алгоритмы в современной математике и информатике (Ургенч, 1979). ), Конспект лекций по вычисл.Sci., 122, Springer, Берлин-Нью-Йорк, 1981, 100–234

1980
113. А. Л. Семенов, “Интерпретация свободных алгебр в свободных группах”, Доклады Академии Наук СССР, 252: 6 (1980), 1329–1332 (цит. По: 1)
114. А. Л. Семенов, “О некоторых расширениях арифметики сложения натуральных чисел”, Матем.СССР-Изв., 15: 2 (1980), 401–418 (цит .: 16)

1978
115. А. Л. Семенов, “Некоторые алгебраические проблемы для систем алгоритмических алгебр”, Доклады Академии наук СССР, 239: 5 (1978), 1063–1066

1977
116. А. Л. Семенов, «Пресбургерность предсказанного регулярного числа в двух системах счисления», Сибирский математический журнал, 18: 2 (1977), 289 (цитировано: 1) (цитировано: 40)

1974
117. А. Л. Семенов, “Регулярность языков, $ k $ -линейных для различных $ k $”, Доклады Академии наук СССР, 215 (1974), 278–281

1973
118. А. Л. Семенов, “Алгортмические задачи для степенных рядов и контекстно-свободных грамматик”, Советская математика, 14 (1973), 1319 (цит. По: 8)

Презентации в Math-Net.Ru
1.
А.Л. Семенов
Общее собрание Отделения математических наук РАН, 2020
7 декабря 2020 г. 12:40
2. . 1986 — 2016 («XXI»)
Семенов А.Л.
Международная конференция «Стратегии достижения результатов в высшем образовании»
7 октября 2015 г. 15:00
3. Приветственное слово
Семенов А.Л.
Международная конференция «Стратегии достижения результатов в высшем образовании»
7 октября 2015 г. 10:00
4. «»
Семенов А.Л.
Конференция «Московское математическое общество и МГУ им. М.В. Ломоносова», посвященная 150-летию Московского математического общества
25 декабря 2014 г. 10:00
5. :
А.Л. Семенов
Общее собрание Отделения математических наук РАН, 2012
17 декабря 2012 г. 13:35
6. Качественная теория алгоритмов
Семенов А.Л.
Летняя школа «Современная математика», 2012
21 июля 2012 г. 12:45
7. Решетка реляционных алгебр, определимая в целых числах с наследником
Алексей Семенов, Сергей Сопрунов
Международный семинар «Логические модели рассуждений и вычислений»
3 февраля 2012 г. 12:45
8. Модальная логика
Семенов А.Л.
Летняя школа «Современная математика», 2011
23 июля 2011 г. 12:45
9. Доказательство невозможности в математической логике и теории алгоритмов
Семенов А.Л.
Летняя школа «Современная математика», 2010
23 июля 2010 г. 12:45
10.
Семенов А.Л.
Летняя школа «Современная математика», 2009 г.
22 июля 2009 г. 09:30

Организации

Бюллетень KRASEC.Phys. И математика. Sci. 2016. Т. 13. №1. 2. С. 72–81. ISSN 2313-0156

Вернуться к содержанию

DOI: 10.18454 / 2313-0156-2016-13-2-72-81

МСК 97I99

КАК НАУЧИТЬ РЕШАТЬ ЗАДАЧИ С ПАРАМЕТРАМИ?

Жданова О.К.

Камчатский государственный университет им. Витуса Беринга, 683031, г. Петропавловск-Камчатский, ул. Пограничная, 4, Россия
E-mail: [email protected]

В статье представлены материалы семинара, проведенного в Камчатском государственном университете им. Витуса Беринга для учителей математики и всех, кто интересуется подобными проблемами.Семинар был посвящен решению задач с параметрами и задачам высокого уровня ЕГЭ.

Ключевые слова: ЕГЭ, задачи с параметрами, графические методы решения.

Список литературы

  1. Александр Ларин, http://www.alexlarin.net.
    2. Дятлов В. Н. Как научить решать задачи с параметрами: лекции 1-4. Москва. Педагогический университет «Первое сентября».2014. 80 с.
    3. Дятлов В. Н. Как научить решать задачи с параметрами: лекции 5-8. Москва. Педагогический университет «Первое сентября». 2014. 80 с.
    4. Российское образование http://www.edu.ru/tests/course/testselect.php?subject=19.
    5. Ященко И.В., Высоцкий И.Р., Косухин О.Н., Семенов П.В., Семенов А.В., Трепалин А.С. Учебно-методические материалы для председателей и членов региональных предметных комиссий по проверке выполнения рекомендаций изменения положения 2015 года.
    Математика. Учебные материалы для председателей и членов областных предметных комитетов по проверке заданий с открытыми ответами ЕГЭ 2015. Математика. Три части. Математика. ФИПИ. 2015. 72 с.
    6. Федеральный институт педагогических измерений, http://fipi.ru/.
    7. Ященко И.В., Шестаков С.А., Трепалин А.С. Подготовка к ЕГЭ по математике в 2015 году. Базовый и профессиональный уровень. Подготовка к ЕГЭ по математике в 2015 году.Базовый и профильный уровни. Методические указания. Математика. МНЦМО. 2015. 288 с.

Для цитирования: Жданова О. К. Как научить решать задачи с параметрами ?. Бюллетень КРАСЕЦ. Физико-математические науки 2016, т. 13, № 2, 72-81. DOI: 10.18454 / 2313-0156-2016-13-2-72-81.

Оригинал статьи отправлен: 08.06.2016

Жданова Олеся Константиновна — старший преподаватель кафедры. кафедры математики и физики, Камчатский государственный университет им. Витуса Беринга, Петропавловск-Камчатский, Россия.

1

Скачать статью Жданова О.К.

страниц электронной книги FIPI-Flip 1-26 | AnyFlip

Федерация нефтяной промышленности Индии

Устойчивый рост
Компания года

Bharat Oman Refineries Limited

Административное здание, нефтеперерабатывающий комплекс,
Жилой комплекс Post BORL
Бина — 470124

Район — Сагар, Индия
Веб-сайт : www.borl.in

«Рост региона, рост вместе с регионом»

Федерация нефтегазовой промышленности Индии

НЕФТЕГАЗОВАЯ ПРОМЫШЛЕННОСТЬ

AWARDS 2020

Entry Form

Sustainable Growing
Компания года

Название организации: Bharat Oman Refineries Ltd.

Дата окончания подачи заявок:

30 сентября 2020 г.

Веб-сайт: www.fipi.org.in FIPI Oil & Gas Industry Awards 2020
Форма заявки
Страница 1 из 12

НЕФТЯНАЯ И ГАЗОВАЯ ПРОМЫШЛЕННОСТЬ
AWARDS 2020

Критерий приемлемости

Премия открыта для всех нефтегазовых компаний, работающих в Индии.

Цель награды
«Устойчиво развивающаяся компания года» признает
выдающихся достижений в области устойчивого развития и преимуществ
, распространяемых на общество и окружающую среду.

Пожалуйста, внимательно ознакомьтесь с Положениями и условиями Схемы награждений FIPI,
https://www.fipi.org.in/Upload/Awards_TermsConditions.pdf

Стр. 2 из 12 FIPI Oil & Gas Industry Awards 2020
Entry Form

НЕФТЕГАЗОВАЯ ПРОМЫШЛЕННОСТЬ
AWARDS 2020

Анкета Bharat Oman Refineries Limited

Название компании: Административное здание
Комплекс нефтеперерабатывающих заводов, почта BORL
Почтовый адрес: Жилой комплекс, Бина,
Район Сагар, Мадхья-Прадеш-470124

утверждающий орган:

Примечание: утверждающий орган не должен быть ниже г-на.Абхайрадж Сингх Бхандари
в ранге главы отдела / региональный
руководитель / директор / генеральный директор.

Должность: Главный операционный директор
Номер телефона: +0 226501
Адрес электронной почты: +4310160
[электронная почта защищена]

Подпись:

Пожалуйста, укажите имя и должность г-на М.Б. Пимпале
лиц, которые будет принимать награду, если
Управляющий директор (BORL)
кандидат будет выбран победителем:

Пожалуйста, напишите краткое описание в профиле вашей компании.

Описание заявителя (не более 300 слов)

Компания Bharat Oman Refineries Limited была зарегистрирована 25 февраля 1994 года в соответствии с Законом о компаниях
1956 года в результате двустороннего соглашения между правительством Индии и Султанатом Оман.
Акциями Компании в равных долях владели Bharat Petroleum Corporation Limited
(BPCL) и OQ (ранее Oman Oil Company S.A.O.C) до марта 2020 года. С 1 апреля 2020 года
Компания стала дочерней компанией BPCL. BORL специализируется на переработке нефтепродуктов
, а также на эксплуатации системы снабжения, состоящей из одноточечного причального оборудования, терминала хранения сырой нефти
и нефтепровода по пересеченной местности из Вадинара (Гуджарат) в Бина (Мадхья
Прадеш).Зарегистрированный офис компании находится по адресу Бина, район-Сагар, МП.

BORL производит широкий ассортимент высококачественных нефтепродуктов, таких как High Speed ​​Diesel
(HSD), Motor Spirit (MS), сжиженный нефтяной газ (LPG), авиационное турбинное топливо (ATF), керосин
(SKO) и т.д. стратегически расположенный в центральной части страны, обслуживающий
топливных потребностей Центральной и Северной Индии. В соответствии со строгими нормами
, предусмотренными Политикой автомобильного топлива, НПЗ с момента своего основания постоянно поставляет
экологически чистых продуктов.Для надежного обслуживания компания использовала современный диспетчерский терминал
с эффективными складскими и эвакуационными помещениями. Продукция
вывозится трубопроводным, железнодорожным и автомобильным транспортом.

Страница 3 из 12 FIPI Oil & Gas Industry Awards 2020
Форма заявки

НЕФТЕГАЗОВАЯ ПРОМЫШЛЕННОСТЬ
A W A R D S 2020

Пожалуйста, дайте обоснование для подачи заявки на эту награду, подчеркнув значительные достижения
в обеспечении устойчивого роста в 2019-2020 годах.

Наш корпоративный слоган «Рост региона, рост вместе с регионом» отражает нашу роль
в общем социально-экономическом развитии внутренних районов центральной Индии.Корпоративная ответственность и устойчивый рост
являются неотъемлемой частью ценностей BORL с самого начала. Создание
долгосрочной ценности для всех заинтересованных сторон и позитивный вклад в общество и нацию — вот
ключевых принципов политики BORL. BORL осознает свою ответственность за охрану окружающей среды и природных ресурсов
, выходя за рамки соблюдения требований в области качества воздуха
, повторного использования воды, управления отходами, развития зеленого пояса, защиты среды обитания и управления энергией
.Основные области устойчивого роста и некоторые из значительных
достижений в течение 2019-20 годов перечислены ниже:

Охрана окружающей среды и природных ресурсов
 Потребление пресной воды: BORL реализовал ряд схем по сохранению воды

и достиг 92% повторного использования в 2019-20 гг. В результате компания BORL добилась снижения потребления пресной воды на 8%
за 2018-19 гг., Несмотря на увеличение мощности НПЗ
на 130%.
 Выбросы парниковых газов: сокращение выбросов парниковых газов в тCO2 / т сырой нефти достигло 25% за последние 5
лет и 4% в 2019-2020 годах.Это было достигнуто, несмотря на повышенную сложность эксплуатации
из-за производства топлива BS VI.
 Пластиковые отходы: прекращено использование ПЭТ-бутылок в офисах, что привело к сокращению примерно на 80 000
ПЭТ-бутылок в год, что эквивалентно 900 кг и 5 400 CO2-экв. Кроме того, в рамках проекта
«Исключение одноразового пластика» в
2019-2020 гг. Было собрано около 12 тонн одноразового пластика, который был утилизирован путем одобренной совместной переработки.
 Управление твердыми отходами: BORL внедрила надежную политику управления отходами
, направленную на сокращение, повторное использование или замену твердых отходов, и добилась 96% внутренней переработки / повторного использования отходов
в 2019-2020 годах.
 Развитие зеленого пояса: BORL посадил более 3,7 тыс. Деревьев вокруг нефтеперерабатывающего завода,
поселков и близлежащих деревень, что привело к сокращению на 8 179 т CO2-экв. В 2019-2020 годах
БОРЛ посадили 10700 деревьев.

Управление энергопотреблением
 Удельное потребление энергии: НПЗ добился снижения удельной энергии (MBN) на 6%

в 2019-20 гг. В течение 2018-19 гг. В цикле BEE PAT-2 BORL добился снижения на 10,6 МБН
по сравнению с целевым показателем (13,3%), то есть на 69,2 МБН в 2018-19 гг. По сравнению с целевым показателем 79.8.
 Энергосбережение: количество инновационных проектов ENCON, реализованных в рамках проекта по устранению узких мест на НПЗ
, помогло добиться сокращения на 24860 метрических тонн нефтяного эквивалента
в год. Некоторые из проектов включают гибридную эжекторную систему с жидкостным кольцевым вакуумным насосом
, инновационную систему сбора факельного газа и турбину рекуперации энергии.
 Возобновляемая энергия: компания BORL установила две солнечные электростанции (4,4 МВт + 140 кВт) на диспетчерском терминале и НПЗ
.
 Энергоэффективное освещение: В 2019-2020 гг. 2153 шт.заменены
традиционных осветительных приборов на энергоэффективные светодиодные светильники, что дает экономию 128 млн тнэ в год.

Стр. 4 из 12 Награды FIPI Oil & Gas Industry Awards 2020
Форма заявки

НЕФТЯНАЯ И ГАЗОВАЯ ПРОМЫШЛЕННОСТЬ
AWARDS 2020

 Награды и похвалы: В качестве свидетельства своих энергетических показателей компания BORL получила награду Energy
Efficient Unit от CII во время 21-й Национальной энергетической премии 2020 года. BORL также выигрывал
наград подряд в прошлом году в 2017 и 2018 годах.

Социальная ответственность
 Для общего социально-экономического развития в регионе BORL исчерпывающе работал в четырех

тематических областях корпоративной социальной ответственности (КСО), как указано ниже:
a) Содействие образованию и развитию навыков
b) Здравоохранение, гигиена и санитария
c) Развитие сельских районов и экологическая устойчивость
d) Продвижение спорта и культуры

 Расходы BORL на корпоративную социальную ответственность увеличились на 96% в 2019-20 гг. в период 2018-19 гг., сверх обязательных требований
.
Различные мероприятия в области КСО, предпринимаемые BORL, и их влияние на общество подробно описаны в Разделе 8 заявки.

 Награды и похвалы: инициативы BORL в области корпоративной социальной ответственности одобрены различными агентствами, и компания
получила ряд наград в 2019-2020 годах в том же направлении:
a) «Национальная награда за лидерство в сфере корпоративной социальной ответственности 2020» от ET Now и Всемирного конгресса по корпоративной социальной ответственности
б) «Свидетельство о признании 2020» правительства. Мадхья-Прадеш для инициатив CSR
c) «Swachhata Puraskar» от MoPNG 16 сентября 2019 г. для гигиены и санитарии на нефтеперерабатывающем заводе и
вокруг него.

Ответ с количественной информацией

Параметр оценки SN
1 Расходы на корпоративную социальную ответственность

Фактическая сумма, потраченная на корпоративную социальную ответственность в 2019-20 годах INR Crores
Сумма, санкционированная (бюджет) для CSR в течение года 2019-20 24,26
Сумма, потраченная на CSR сверх обязательной соблюдение 24,34
Обязательные расходы на корпоративную социальную ответственность в 2019-2019 гг. 4,85
19,41

2 Охрана здоровья и окружающей среды (HSE)

Штрафы, наложенные за любое нарушение следующих законов и правил в течение 2019-20 гг.
Да / Нет

Закон об охране окружающей среды Нет

Закон о предотвращении загрязнения воды №

Закон о предотвращении загрязнения воздуха №

Закон о предприятиях №
Любые другие законы, если применимо (уровень государственных / местных органов и т. Д.) №

Страница 5 из 12 Награды FIPI Oil & Gas Industry 2020
Форма заявки

НЕФТЯНАЯ И ГАЗОВАЯ ПРОМЫШЛЕННОСТЬ
AWARDS 2020

3 Затраты на развитие навыков

Капитальные затраты на развитие навыков 2019 — 20 * кроры INR
Общий капитал Расходы на 2019-2019 гг. # 1,24
Капитальные затраты на развитие навыков 2018 — 19 *
Общие капитальные затраты на 2018-19 гг. # 53
* Общие расходы на развитие навыков, # Общие капитальные затраты на поддержание жизнедеятельности за год
1.86

101

4 Капитальные затраты на возобновляемые источники энергии / электромобили / биотопливо как направление деятельности в 2019-20 гг.

% капитальных затрат на возобновляемые / электромобили / биотопливо в общих инвестициях, сделанных компанией в 2019-20 годах

INR

крора

Общие капитальные затраты на ВИЭ / ЭМ / биотопливо в 2019-20 гг. 0,71

Общие капитальные вложения в 2019-2020 гг. * 53

Общие капитальные затраты на ВЭ / ЭЭ / биотопливо компании в 2018-19 гг. ** 0,24

Общие капитальные вложения в 2018 г. -19 * 101

* Общие капитальные затраты на поддержание жизнедеятельности в течение года

** Солнечная электростанция мощностью 4 МВт + 140 кВтч, установленная на BORL

5 Меры по экономии воды

% повторно использованной воды в общем водопотреблении в 2019-2020 годах Процент
% оборотной воды, использованной в общем водопользовании в 2019-2020 годах 92.45
% оборотной воды в общем водопользовании в 2018-19 годах
% оборотной воды, использованной в общем водопользовании в 2018-19 годах 76,21 *
* Балансовая вода, используемая в садоводстве
78,88

61,33 *

6 Снижение в процентах по энергоемкости за последние два 6,2%
лет:
МБН на 2019-20 финансовый год: 65,0
МБН на 2018-19 финансовый год: 69,3

Гкал чистого дохода от операционной деятельности за

год *
(крор индийских рупий)
Израсходовано 2668
1750
2017-18 6519079 957

2018-19 5957651

2019-20 7

1

* Показатели EBITDA представлены как чистая прибыль от операционной деятельности

Страница 6 из 12 FIPI Oil & Gas Industry Awards 2020
Entry Form

OIL & ГАЗОВАЯ ПРОМЫШЛЕННОСТЬ
AWARDS 2020

7 Увеличение углеродного следа компании

Суммарные выбросы углерода (в экв.) компании в 2019-20 гг. В млн. тонн
2,996 *

Суммарные выбросы углерода (в экв. CO2) компании в 2018-19 гг. 2,246
Общие выбросы углерода (в экв. CO2) компании в 2017-18 гг. 2.485

* Увеличение общих выбросов углерода связано с увеличением мощности НПЗ на 130% (с 6 до 7,8

млн. Тонн в год). Тем не менее, за последние 5 лет произошло сокращение выбросов углерода
на 25% за последние 5 лет и на 4% в прошлом году при переработке тCO2 / т нефти.

8 Влияние на общество
Подробная информация об инициативах в пунктах маркированного списка (с измеримыми мерами), предпринятых компанией
, которая добилась успеха в улучшении общества.

Инициативы в области КСО, предпринятые BORL, концептуализированы, разработаны и
реализованы в среде с участием многих заинтересованных сторон. BORL провел
опросов по оценке потребностей через известную НПО и определил ключевые сообщества и
тематических областей, таких как: (1) содействие образованию и развитию навыков, (2)
пропаганда здоровья, гигиены и санитарии, (3) развитие сельских районов и окружающая среда.
Устойчивое развитие и (4) Продвижение спорта и культуры.

В настоящее время целевыми бенефициарами наших мероприятий являются 23 деревни вокруг нефтеперерабатывающего завода Бина, общины вдоль VBPL и деревни
возле COT. Основные инициативы и
их влияние приведены ниже:

Содействие образованию и развитию навыков:

 Шикша Аапке Двар: Программа действует с 2014 года для всестороннего развития
студентов из соседних деревень путем регулярного наставничества. Ежегодно охвачено около 1000
детей, и результат программы очевиден из
участия и отбора учеников в известных школах и конкурентоспособных
экзаменов:

Школа / экзамен Выбрано всего
2019-20 Выбрано

Прием в Шрамодая Видялая , Бхопал (уровень штата) 03 03

Прием в Наводая Видьялая, Хурай (районный уровень) 03 15

Прием в Гьянодая Видьялая, Сагар (уровень отделения) 03 03

Прием в правительстве.Образцовая школа, Бина (уровень блока) 14 80

Получено Govt. Стипендия по заслугам и средствам (государственный уровень) 22 72
Утвержденная государственная олимпиада по хинди для юношей (1-й уровень) 18 39

Утвержденная государственная олимпиада по математике для юношей (1-й уровень) 06 38

 Медхави Видьярти Пурускар: Ежегодная стипендиальная программа реализуется с
2012 г. 13 на продвижение образования. 457 отличившихся студентов получили стипендию

Страница 7 из 12 FIPI Oil & Gas Industry Awards 2020
Форма заявки

НЕФТЕГАЗОВАЯ ПРОМЫШЛЕННОСТЬ
A W A R D S 2020

стипендия в Бине и 199 студентов в Вадинаре в 2019-20.Всего 2817 студентов
получили стипендию в Бине с 2012 года и 854 студента в COT Вадинар с 2014 года.

Медхави Видьярти Пурускар, последние 8 лет в Бине (всего 2817 студентов)

500 296 346 374 386 400 427 457
2013 2014 2015 2016 2017 2018 2019
400

300

200 131
100

0
2012

 Финансовая поддержка: финансовая помощь отличным студентам и студентам из близлежащих
деревень НПЗ в Бине для продолжения высшего образования 238 отличных студентов
получили стипендию в Бине для продолжения учебы.Всего 753 студента
получили стипендию в Бине с 2014 года.

Финансовая поддержка за последние 6 лет (всего 753 студента) 238
2019
250 198
200

150 119
94
100 57
47
50

0 2015 2016 2017 2018
2014

 Модернизация инфраструктуры школ: BORL провел реконструкцию 15
школьных зданий, построил ограждающую стену в 21 школе, построил туалетный блок
в 42 школах в районе Сагар и предоставил письменные скамейки во всех 38 близлежащих деревнях
Govt.школы. Вмешательство создало видимые изменения в школьной инфраструктуре
и способствовало созданию благоприятной среды для обучения.

 Государственная школа ДАВ-БОРЛ: Одна из самых известных школ 10 + 2
, входящих в состав CBSE, в регионе, обслуживающая 73% иностранных учащихся. До 25% приема в школу
зарезервированы для учащихся из бедных семей и зарезервированной категории.

 Школа была выбрана в «Выдающейся категории» среди всех школ DAV за последние
2 года и номинирована как «Школа ведущих сотрудников» по ​​версии CBSE, при участии около
5 школ

Страница 8 из 12 FIPI Oil & Gas Industry Awards 2020
Форма заявки

НЕФТЯНАЯ И ГАЗОВАЯ ПРОМЫШЛЕННОСТЬ
AWARDS 2020

 Научный фургон: Повышение осведомленности о науке с помощью 150 практических научных моделей для
содействия научному образованию с экспериментальным научным обучением в соседнем правительстве.
Средние и высшие школы нефтепереработки. Результат очевиден по участию
студентов в научных ярмарках.

 Проект Swavalamban: Техническая подготовка на рабочем месте и профессиональная подготовка по различным
профессиям молодежи, связанные с трудоустройством и развитием самостоятельного предпринимательства.
Прибл. На сегодняшний день обучено по различным специальностям 1000 человек, из них около
человек. 600 человек были серьезно вовлечены.

Участие студентов в Science Fair

500 420 380 410
400 355

300 220 200 180 200 195 215
205

200 150

100

0 2016-17 2017-18 2018-19
2015-16

Студенты мужского пола Студентки Всего студентов

Результат инициатив SN

1 Программа обучения и заработка — Включено  В 2019-2020 гг. Прошли обучение 88 и прошли 63
профессиональную подготовку в рамках AICTE — значимо задействовано
Схема NEEM для передачи ITI  Всего 419 слушателей прошли обучение по 10
школам M.П. 92 145 партий и 323 стажёра

осмысленно вовлечены.

2 Модель государственно-частного партнерства  В 2019-2020 годах 21 кандидат набрал
баллов, а ITI Bina
активно участвовал в процессе

 Прибл. 100 кандидатов

, занятых до настоящего времени

3 профессиональных тренинга в сфере здравоохранения, прибл. 200 человек прошли обучение
Вождение, обслуживание клиентов и розничная торговля до настоящего времени. \

Менеджер по продажам и ввод данных

Оператор и т. Д.

Продвижение здравоохранения, гигиены и санитарии:

 Больница VK-BORL: VK-BORL — это Современная больница на 30 коек с лабораторией, аптекой
, круглосуточной неотложной медицинской помощью, рентгенографическим оборудованием и т. Д.Больница предоставляет
значительную выгоду местным жителям для доступа к объектам IPD и OPD. Около 85% пациентов, прошедших лечение
, не являются персоналом и проживают в соседних районах. VK-BORL Больничные услуги
принесли огромную пользу тем, кто не может позволить себе лечение в частной больнице.

Стр. 9 из 12 Награды ФИПИ в нефтегазовой отрасли 2020
Форма заявки

НЕФТЯНАЯ И ГАЗОВАЯ ПРОМЫШЛЕННОСТЬ
А В А Р Д С 2020

 Укрепление правительства. Больница: для содействия доставке в стационар, BORL
построил новое родильное отделение «ВАТСАЛЯ» на 33 койки при правительстве.Гражданская больница,
Бина и предоставила необходимое медицинское оборудование. BORL также построил Mortuary
Room с соответствующими удобствами в Govt. Гражданская больница, Бина. BORL также предоставил финансовую помощь в размере
рупий. 110 лакхов на трансплантацию костного мозга для серповидных клеток
Пациенты с анемией и талассемией в Управление служб здравоохранения Бхопала, правительство.
Мадхья-Прадеш.

 Свастья Сева Йоджана: Бесплатное лечение и лекарства предоставляются
пожилым людям в возрасте 55 лет и старше, беременным женщинам (до 2 детей), детям
младше 10 лет и людям ниже категории BPL из 22 близлежащих деревень.Mobile

медицинских лагеря и специализированных лагерей регулярно организуются в соседних

селах.

 Наблюдение за Свачхата Пахвада: В рамках этой программы различные мероприятия по уборке
, информационная кампания, плантации и другие инициативы проводятся на нефтеперерабатывающем заводе
, городке и близлежащей общине. BORL выиграл «Swachhata Pakhwada
Puraskar», врученный почетным министром нефти и природного газа.

 Поддержка в рамках Covid-19: Помимо оказания необходимой медицинской помощи в больнице VK-
BORL, 32 000 масок были розданы жителям близлежащих деревень и воинам Короны,
80 полных костюмов предоставлены районной администрации и спортивному комплексу, построенному
BORL в г. Поселок Агасод преобразован в карантинный центр.

Сельское развитие и экологическая устойчивость

 Программа устойчивого развития средств к существованию: Проект по управлению животноводством и поддержке сельского хозяйства
, инициированный в 2015 году, повысил осведомленность в деревнях
об охране здоровья животных и увеличении производства молока благодаря высококачественной программе разведения
. Проект побудил ряд молодых фермеров принять более эффективные методы развития сельского хозяйства и животноводства
и улучшить свои средства к существованию.
Результаты представлены в таблице ниже:

Мероприятие 2019-20 Общий результат
Искусственное осеменение, ном.991 2876
Вакцинация, № 3573 19307
Ветеринарный лагерь, №№
В 26 лагерях, 3975 В 140 лагерях,
Обучение фермеров, №№ обработанный крупный рогатый скот 16167 обработанный крупный рогатый скот
38 тренингов, 1281
Разработка кормов (в акрах) 10 тренингов, 387
Овощеводство (в акрах) участников участники
165 865
102 505

Страница 10 из 12 FIPI Oil & Gas Industry Awards 2020
Форма заявки

НЕФТЯНАЯ И ГАЗОВАЯ ПРОМЫШЛЕННОСТЬ
AWARDS 2020

 Проект Урви: Водосбережение и обеспечение объектов питьевой воды, проект
, начатый в 2018 году, поддержал жителей близлежащих деревень в сельскохозяйственном производстве.Работы по сбору дождевой воды
включают строительство контрольных дамб, выкопанного пруда, насыпи поля
, углубление наллах, прудов и т.д. в близлежащих селах.

Количество единиц деятельности в 2019-2019 гг.

Строительство контрольной плотины 03
Углубление наллаха 13
Обустройство поля 51,73 га
Фермерский пруд 05
Выкопанный пруд 10

 Проект Пракаш: В рамках проекта, электрификация в каждом домохозяйстве из 19
окрестных деревень. Энергоэффективные электроприборы
предоставлены ок.1850 домашних хозяйств и все учреждения / общие помещения.
Были заменены ветхие силовые кабели в деревне и установлены уличные фонари
для повышения безопасности и мобильности.

Содействие спорту и культуре

 Программа спортивной подготовки: с 2017-18 гг. BORL проводит регулярные тренировки по борьбе, шахматам, легкой атлетике и кабадди для детей из близлежащих деревень с помощью
опытных тренеров. Менее чем за три года несколько игроков выиграли —
представили округ / дивизион на уровне штата, а 3 борца представили штат на национальном уровне
.Сводка результатов за последние 3 года представлена ​​ниже:

Турниры Участники Победитель
Национальный уровень 5 —

Государственный уровень 139 22
Дивизионный уровень 167 100
Районный уровень 276 200
392 231
Уровень блока 979 553
Всего

 Летние и зимние спортивные лагеря и межшкольные / деревенские соревнования:
Организуются ежегодно, где игрокам предоставляется специальная подготовка, и они
участвуют в соревнованиях.

 BORL построил спортивный зал и предоставил необходимые помещения в деревнях Агасод
и Дехри в 2020 году, чтобы помочь игрокам тренироваться в любых погодных условиях и улучшить
свои результаты.

Стр. 11 из 12 наград FIPI Oil & Gas Industry Awards 2020
Форма заявки

НЕФТЯНАЯ И ГАЗОВАЯ ПРОМЫШЛЕННОСТЬ
А В А Р Д С 2020

BORL Вклад в борьбу с Covid-19

Финансовые  рупий. 25,19 крор в фонд PM-CARES
Помощь  рупий. 2 крор в Фонде помощи CM
• рупий. 10 лакхов районной администрации, Сагар
Поддержка местного населения  рупий. 7 лакхов районной администрации, Ашокнагар
органов  рупий. 5 лакхов районной администрации, Джамнагар
 Необходимые химикаты предоставлены для дезинфекции в
Оборудование VK-
Больница BORL Джанпад, Бина
 32000 масок распределены среди жителей близлежащих деревень и

воинов короны
 80 номеров.комбинезонов предоставленных Dist. Администрация
 2 номера транспортных средств предоставлены администрации Бина для передвижения

Corona Warriors
 Спортзал, построенный Компанией в деревне

Агасод, используемый как карантинный центр
 Круглосуточная служба поддержки COVID-19
 Изолятор на 15 коек для Covid -19 пациентов
 Проверка персонала

Награды и награды:

Вклад BORL в деятельность в области корпоративной социальной ответственности признан и награжден
различными авторитетными организациями, такими как:

1.Национальная сеть развития человеческих ресурсов (NHRDN),
2. ET Now & World CSR Congress,
3. Эк Каам Деш Ке Наам (EKDKN) и
4. Местная администрация (3 раза).

Список приложений (необязательно), если есть

S. № Описание
1 Дополнительные сведения, касающиеся устойчивого развития
2 Награды и награды
3 Глоссарий

Стр. 12 из 12 *******

FIPI Oil & Награды в области газовой промышленности 2020
Форма заявки

BHARAT OMAN REFINERIES LIMITED

Приложение — 1
Дополнительная информация
, связанная с устойчивым развитием

BHARAT OMAN REFINERIES LIMITED

Приложение -1: Дополнительные сведения, связанные с финансовой деятельностью

Физическая и физическая

Переработка сырой нефти, а также реализация нефтепродуктов с НПЗ с годами увеличились.В период с
по 2018-19 гг. НПЗ реализовал проект по устранению узких мест с увеличением мощности с 6,0 млн. Тонн в год до 7,8
млн. Тонн в год.

Переработка сырой нефти, TMT
7,9

8,0

7,0 6,2 6,4 6,4 6,7
6,0 5,4
5,7

5,0

4,0
2013-14 2014-15 2015-16 2016-17 2017-18 2018-19 2019- 20

* Объем переработки в 2018-19 гг. Снизился из-за плановой остановки НПЗ для реализации проекта по устранению узких мест
.

Выход дистиллята и выход топлива для транспортировки (MS, HSD и ATF) с годами максимизированы:

Выход дистиллята,% Транспортное топливо,%
80 71.7 76,1 77,3 77,7
85,0 82,7 83,1 83,2 83,1 83,3 83,7 83,8 70 68,2 70,6 70,3
83,0 60
50
81,0 40

79,0

77,0

Достигнутая валовая маржа переработки (ВРМ) является одной из лучших в стране. Благодаря эффективной работе НПЗ
также смог снизить эксплуатационные расходы на протяжении многих лет.

GRM, долл. / Барр. Операционные расходы, долл. / Барр.
4 3,8 3,6 3,4
15 11,7 11,8 11,7 9,8 3 2,3 2,1 2,4 2,0 ​​
2
10 9,3 6,1 5,6
1
5
0
0

Страница 1 из 7

BHARAT OMAN REFINERIES LIMITED

Энергоэффективность

Энергоэффективность НПЗ постоянно улучшалась на протяжении многих лет, несмотря на повышенную
сложность работы нефтеперерабатывающего завода из-за внедрения автомобильных топлив классов BS IV и BS VI.Динамика потерь топлива и потерь нефтеперерабатывающего завода
, удельного потребления энергии (MBN) и EII по годам представлена ​​ниже:

Топливо и потери,% удельной энергии, MMBTU / bbl / NRGF

9,0 8,7 100 91,4 86,2 84,3
8,0 7,7 7,1 7,5 7,5 7,4 6,9 90
7,0
80 69 67,3 69 65
6,0 70

5,0 60

50

40

Индекс энергоемкости (EII) Энергоэффективное освещение (МВт)

150 134 0,400 0,366

130122 0,300 0,252
112
110101 97
0.200
90 0,100 0,126
0,000 0,016 0,013 0,001
70

50

30 22,9% Снижение MBN по сравнению с исходным уровнем 2015-16 гг. По 2019-2019 гг.

20 16,3 15,0 11,7 9,5 8,6 8,1 6,5 6,2 5,4 1,3
10

0

-10 -4,2 -6,1
-20 -13,8

Источник: отчет PPAC

BORL добился наибольшего снижения MBN по сравнению с базовым уровнем 2015-16 гг. Среди НПЗ PSU.

Солнечная электростанция 4,4 МВт на диспетчерском терминале Солнечная электростанция мощностью 140 кВт на административной стоянке

Страница 2 из 7

BHARAT OMAN REFINERIES LIMITED

Экологические показатели

С современным оборудованием, включая современные установки для очистки сточных вод и мощные системы мониторинга,
BORL может достичь экологических показателей, превышающих допустимые пределы.Благодаря мерам по сбережению воды
и внедрению схем рециркуляции и повторного использования воды НПЗ смог
последовательно снизить потребление пресной воды на протяжении многих лет (см. Тенденцию ниже). Это было достигнуто в
году, несмотря на увеличение мощности НПЗ с 6,0 до 7,8 млн тонн в год.

Расход пресной воды, кл / час Удельный расход воды, м3 / т

10000 9260 8796 8803 Европейский эталон 0,98
8000 7192 7241 7110
2 1,45

1,5 1,02 0,9 0,92 0.97 0,86 0,84
1
6000

0,5

4000 0

2000

0
2014-15 2015-16 2016-17 2017-18 2018-19 2019-20

Динамика основных параметров окружающей среды по отношению к их пределы приведены ниже:

Качество сточных вод:

Химическая потребность в кислороде Биологическая потребность в кислороде

1000 921 120 110,5
800 224
600 2019-20 Стандарт 100
кг / день 400 80 68,7
кг / день 60 60 44,9 50,8
0 172 183
2017-18 2018-19 40

20

0
2017-18 2018-19 2019-20 Стандарт

Выбросы из дымовой трубы:

Выбросы из дымовой трубы — Выбросы твердых частиц из дымовой трубы — SO2 (мг / Нм3)
( мг / Нм3)
28

73
30300116187
20 19 20
200112
20 13 11 14100

10

0 2018-19 2019-20 0
2017-18 2017-18

2018- 19 2019-20

Твердые частицы (PM) Стандартные оксиды серы (SO2) Стандартные

Stack Emissio n — NOx (мг / Нм3) Выбросы из дымовой трубы — Окись углерода
(мг / Нм3)
274 240 273
300 167 204150 111 99 109
100
182 2018-19 2019-20
200 50 13 13 17

100 0
2017-18
0
2017-18

2018-19 2019-20

Оксиды азота (NOx) Стандарт Окись углерода (CO) Стандарт

Стр. 3 из 7

BHARAT OMAN REFINERIES LIMITED

Окружающий воздух Качество:

NO2 в окружающем воздухе Качество окружающего воздуха (мкг / м3) SO2 в окружающем воздухе (мкг / м3)

40 40 40 40 50 50 50 50
40 50

30 121212 151012 13 9 9 40 12 12 8 8 10
77 87
20 151113 30
10
20 9 9 13
0 Stn # 2 Stn # 3 Stn # 4 (ETP) 10 Stn # 2 Stn # 3 Stn # 4
Stn # 1 (Столовая) (Offsite) ( ETP)
(Факел) (Столовая) (Вне площадки) 0
Stn # 1 2018-19 2019-20 Законодательный стандарт
2017-18 2018-19 2019-20 Законодательный стандарт (Факел)

2017-18

Сбор дождевой воды (Кв.м)

180000 165919 B ORL построила ряд сооружений для сбора дождевой воды
160000 внутри нефтеперерабатывающего завода, поселка и в
140000 135740 соседних деревнях.Ниже представлены участки структуры ПВО
120000 112740, разработанные за год. Кроме того,
100000 из-за различных мер, предпринятых для оптимизации энергопотребления
80000 , наблюдается последовательное сокращение выбросов парниковых газов (ПГ)
60000 как тCO2 / т
40000 46374 46374 сырой нефти, как показано ниже:
20000

0

2014 -15 2015-16 2016-17 2017-18 2018-19 2019-20

Выбросы парниковых газов TCO2 / MT Сырой зеленый пояс против секвестрации CO2

0,506 3

7891 7905 7944 7960 8180


0.392 0,371 0,393 0,379 380000 358696 359296 361096 361796 371796
370000
2015-16 2016-17 2017-18 2018-19 2019-20 360000
350000
340000

2015-16 2016-17 2017-18 2018-19 2019-20

Общее количество деревьев Тонн / год абсорбированного CO2

Управление отходами: НПЗ внимательно следит за образованием отходов и реализует стратегию сокращения,
повторного использования или замены отходов. Ниже приведены режимы утилизации различных отходов, образующихся на нефтеперерабатывающем заводе,
, что указывает на то, что более 96% от общего количества отходов, образовавшихся в 2019-2020 годах, были переработаны / повторно использованы на нефтеперерабатывающем заводе.
BORL построил специальный комплекс для опасных отходов для эффективного управления и обращения.

Управление отходами

1500 1315 20000
Для утилизации и вторичной переработки
Внутреннее использование, MT
1000 1572175000
500 12492 13703

10000

7203425 446

150162 002 141 182

50002 141 182

150162 141 182

17 2017-18 2018-19 2019-20

Переработчик / сопроцессор утилизации

Переработка / повторное использование внутри компании

Страница 4 из 7

BHARAT OMAN REFINERIES LIMITED

Социальная ответственность

Деятельность BORL в области корпоративной социальной ответственности осуществляется в состояние продвижения
Мадхья-Прадеш и Гуджарат, предпочтительно в близлежащих деревнях Education &
23 НПЗ в Бине, терминале сырой нефти в
Вадинар и близлежащих районах трубопровода Vadinar Bina Skill
.Проекты КСО направлены на укрепление
социально-экономического положения и экологической устойчивости
. Основные тематические области КСО представлены ниже. Продвижение КСО
. На протяжении многих лет текущие схемы Sports &
обеспечивали основу для доступа к базовым объектам, и
привели к положительным результатам, что также является культурным здравоохранением,
подтверждено независимым исследованием оценки воздействия на гигиену и
, проведенным Институтом Тата. Общественные науки, Мумбаи.Санитария

Сельское хозяйство
Развитие и
Окружающая среда
Устойчивое развитие

Тенденция расходов на мероприятия по КСО, проведенных в течение года, представлена ​​ниже:

Расходы на КСО, ₹ крор

24,3
25

20 10,5 10,9 12,4

15 10

5

0
2015-16 2016-17 2017-18 2018-19 2019-20

Содействие обучению и развитию навыков

Уроки наставничества, проводимые волонтерами в деревнях Стипендии и распределение финансовой помощи

Уроки на моделях in Science Van DAV-BORL Public School с 70% внешними учащимися

Страница 5 из 7

BHARAT OMAN REFINERIES LIMITED

Тренинг по развитию навыков на рабочем месте
Пропаганда здоровья, гигиены и санитарии

Многопрофильная больница VK-BORL Бесплатное медицинское учреждение для детей, беременных
женщин, пожилых людей и категории BPL

Программа повышения осведомленности в деревне Родильный дом в Civi l Больница Бина

Развитие сельских районов и экологическая устойчивость

Электрификация сельской местности — Проект Пракаш Строительство контрольных плотин

Стр. 6 из 7

BHARAT OMAN REFINERIES LIMITED

Продвижение спорта и культуры

BORL Bundelkhand Sports Cup в соседней деревне

Питьевая вода в летний сезон Водосбережение в деревнях

Спортивные тренировки и турниры BORL Run Bina Run Тема в процессе

Страница 7 из 7

BHARAT OMAN REFINERIES LIMITED

Приложение — 2
Награды
&

Награды

BHARAT OMAN REFINERIES LIMITED
Приложение — 2: Награды и награды

Компания BORL получила награду Swachhata Puraskar в рейтинге Inter-Refinery Swachhata Ranking Awards
, организованном Министерством нефти и природного газа.Награда была вручена министром
наград BORL Ranking Awards, организуемой PizeedtrobyleMuminis & tr Natural Gas, 16 сентября 19 г.

г. Нефть и природный газ. Награда была вручена министром нефти и природного газа
16 сентября 1919 года.

BORL был удостоен Национальной премии CSR
Leadership Awards 2020 за вклад
в области «Развитие спорта / продвижения
» от Economic Times Now и
World CSR Congress 18 февраля 2020 г.

BORL получил награду «Energy Efficient Unit» на CII ‘National Award for Excellence in
Energy Management’ 2020.BORL также выигрывал эту награду последовательно в течение 2017 и 2018 годов.

BORL был удостоен Национальной награды за лидерство в сфере корпоративной социальной ответственности 2020 за вклад в области «Развитие спорта / продвижения
» от Economic Times Now & World CSR

Страница 1 из 2

BHARAT OMAN REFINERIES LIMITED

Правительство. Мадхья-Прадеш наградил BORL Сертификатом признания 2020 за
работ в области продвижения спорта в рамках своих инициатив в области корпоративной социальной ответственности

«Премия Мадхья-Прадеш за лучший бренд работодателя 2019» от CHRO Asia за усилия BORL
по привлечению, удержанию и развитию талантов и политика сохранения

Национальная премия в области энергосбережения 2017: 1-я премия в нефтеперерабатывающем секторе
, присужденная достопочтенным президентом Индии Шри Рамом Натхом Ковиндом 14 декабря 2017 г.

Стр. 2 из 2

BHARAT OMAN REFINERIES LIMITED

Приложение — 3
Глоссарий

BHARAT OMAN REFINERIES LIMITED
Приложение -3: Глоссарий

AICTE: Всеиндийский совет по техническому образованию

ATF: Авиационное турбинное топливо

BEE: Бюро энергоэффективности

Oman Referies Limited: Bharat

BPCL: Bharat Petroleum Corporation Limited

BS: Bharat Stage

CII: Конфедерация Индии Отрасль

COT: Терминал сырой нефти

COVID: Вспышка коронавирусной болезни

CSR: Корпоративная социальная ответственность

DAV: Dayanand Anglo Vedic

ENCON: Энергосбережение

EV: Электромобиль

Финансовый год 2 : Gigacalories

GHG: Green House Gases

GRM: Валовая маржа нефтепереработки

HSD: High Speed ​​Diesel

IPD: В отделении пациента

ITI: Институт промышленного обучения

KL: килолитер

кВтч: килолитр

LED: жидкокристаллический дисплей

LPG: сжиженный нефтяной газ

MBN: MBTU / BBL / NRGF

MMT: миллион метрических тонн

MMTPA: миллион метрических тонн в год

MoPNG: Министерство нефти и природного газа

MS: Motor Spirit

MT: метрические тонны

MTOE: метрические тонны нефтяного эквивалента

МВт: мегаватт t

NEEM: Национальная миссия по расширению возможностей трудоустройства

NO2: двуокись азота

NOx: оксиды азота

OOC: Oman Oil Company

OPD: отделение для пациентов

PAT: прибыль после налогообложения

ПЭТ: полиэтиленэтилен

PNGRB: Совет по регулированию нефти и природного газа

PSU: Public Sector Unit

RE: Renewable

SKO: Superior Kerosene Oil

SO2: диоксид серы

VKBORL: Vivekananda Kendra 1 0003 из

из


Индекс / ege / obshee / matem

матем-Б5-Б8-теория + примэры + формулы.pdf

9 матем-Бэтэм-Бэтэм примэры + формулы.pdf matem-B14-splavy-rastvory-smesi.pdf 905 08-05 23:25 -05 23:25 905 905 9 matem-ege-trigonometricheskie-vyrajeniya.pdf 905 10М matem-maltsev-chast2.pdf 107К 6.9М : 25 matem-teoriya-koordinaty.pdf матем-теория-методы-решения-иррациональных-неравенств.pdf -иррациональных -08-05 23:25 9050mate 9050mate 9050 мате решения-показательных-уравнений.pdf мате-мате-мате-мате-мате- pdf 99 50 матем-теория-проценты.pdf матем-теория-треугольник.pdf 50 99 90c199 9050mate yakovlev.zip 50 matem2013c6-yakovlev.zip iya yakovlev.zip matem_teoriya_formuly_dvoynogo_i_troynogo_ugla_v_trigonometrii.pdf pdf 1905 7 9050m_ 9064iya_ matem_teoriya_logarifmy.pdfpdf PDF matem_teoriya_zadachi_na_procenty.pdf pdf -stereometrii.pdf
Имя Последнее изменение Размер Описание

Родительский справочник аппекьяция-высоцкий.zip 2017-08-05 23:25 5.5M
формулы / 2017-08-05 23:25
геометрия 2017-08-05 23:25
geometry-smirnov.zip 2017-08-05 23:25 3,7M
matem-3000b semenova.pdf 2017-08-05 23:25 14М
матем-Б-прототипы-ответы.pdf 2017-08-05 23:25 12M
matem-B1-algoritm.pdf 2017-08-05 23:25 521K
2017-08-05 23:25 418К
матем-Б6-теория + примэры.pdf 05.08.2017 23:25 1.2M
матем-Б7-Б12-1-теория + примеры + формулы.pdf 2017-08-05 23:25 600K
matem-B7-B12-2-teoriya + primery + formuly.pdf 2017-08-05 23:25 694K
матем-Б9-Б15-теория + примэры + формулы.pdf 2017-08-05 23:25 811К
2017-08-05 23:25 728K
матем-B11-C1-тригонометрия-теория.pdf 2017-08-05 23:25 377K
matem-B11-formuly.pdf 2017-08-05 23:25 413K
2017-08-05 23:25 487K
matem-B14-zadachi.pdf 2017-08-05 23:25 1,1M
matem-B15-smartfox.pdf 2017-08-05 23:25 197K
matem-C1-teoriya + primery + formuly.pdf 2017-08-05 23:25 646K
matem-C1-trigon-45primer.pdf 2017-08-05 23:25 6.5M
матем-C2-теория + примеры + formuly.pdf 2017 806K
матем-C3-формула.pdf 2017-08-05 23:25 162K
matem-C3-reshenie-neravenst.pdf 2017-08-05 23:25 329K matem-C3-tonkosti.jpg 2017-08-05 23:25 10K
matem-C5-bitclass.pdf 2017-08-05 23:25 588K7
матем-С5-модуль-дихтяр.pdf 2017-08-05 23:25 2.2M
matem-C5-zadach-s-parametermi-dihtyar.pdf 2017-08-05 23:25 2.1M
matem-C6-dihtyar.pdf 2017-08-05 23:25 282K
matem-b1-08-b14.pdf 11М
матем-б1-корянов.pdf 2017-08-05 23:25 793K
matem-b3-teoriya.pdf 2017-08-05 23:25 1.7M
matem-b9.pdf 2017-08-05 23:25 342K
matem-ege-fipi-algebra-fipi.pdf 2017-08-05 23:25 809K
matem-ege-fipi-funkcii.pdf 2017-08-05 23:25 732K
matem-ege-fipi-geometria.pdf 2017-08-05 23:25 831K matem-ege-fipi-komb_stat_ter_ver.pdf 2017-08-05 23:25 317K
matem-ege-fipi-nachala-08_matana.pdf 9050-08_matana.pdf 9050-08_matana.pdf 25 482K
matem-ege-fipi-uravnenia_i_neravenstva.pdf 2017-08-05 23:25 512K
matem-ege-modul.pdf 2017-08-05 23:25 844K
2017-08-05 23:25 1.5M
matem-formuly-ege.pdf 2017-08-05 23:25
матем-геометрия-планиметрия-теория.pdf 2017-08-05 23:25 707K
matem-gotovimsya-kramor.zip 2017-08-05 23:25 5.9M
matem-guseva.zip 2017-08-05 23:25 5.4M
matem-lappo-praktikum.zip 2017-08-05 23:25 2.5M
матем-ларин C1-39.pdf 2017-08-05 23:25 286K
matem-maltsev-chast1.pdf 2017-08-05 23:25 297K
2017-08-05 23:25 343K
matem-metod-rekom2013.pdf 2017-08-05 23:25 5.8M 9050
матем-параметры-задание18.pdf 2017-08-05 23:25 346K
матем-подготовка-еге-учителям.pdf 2017-08-05 23:25 133K
matem-posobie-sahobiev.zip 2017-08-05 23:25 1,3M
matem-prototip-13zadanie.pdf 2017-08-05 23:8225
матем-разбор-демо2017-база.pdf 2017-08-05 23:25 764K
matem-razbor-demo2017-profil.pdf 2017-08-05 23:25 646K 646K matem-slojnie-zadachi.zip 2017-08-05 23:25 4,9M
matem-spravochnik-ege.pdf 2017-08-05
матем-справочник-еге / 2017-08-05 23:25
матем-теория-красоченогенность-соединениеpdf 2017-08-05 23:25 1.4M
матем-теория-графики-функции.pdf 2017-08-05 23:25 663K
матем-теория-иррациональные-неравенства.pdf 2017-08-05 23:25 156K
матем-теория-комбинаторика.pdf 2017 767K
матем-теория-комбинации.pdf 2017-12-22 18:21 135K
matem-teoriya-konus.pdf 2017-12-22 18:21 113K
2017-12-22 18:21 148K
matem-teoriya-kubpiramida.pdf 2017-12-22 18:21 14499
матем-теория-логарифмические-неравенства.pdf 2017-08-05 23:25 70K
matem-teoriya-logarifmy.pdf 2017-08-05 23:25 336K
2017-08-05 23:25 290K
матем-теория-методы-решения-иррациональных 323K
матем-теория-методы-решения-логарифмических-неравенств.pdf 2017-08-05 23:25 200K
матем-теория-методы-решения-неравенства-s-modulem.pdf 2017-08-05 23:25 301K
матем-теория-методы-решения-показательно-степенных-уравнений.pdf 2017-08-05 23:25 194K
2017-08-05 23:25 189K
матем-теория-методы-решения-тригонометрических-уравнений.pdf 2017-08-05 23:25 436K
матем-теория-методы-решения-уравнивания-s-modulem.pdf 2017-08-05 23:25 9050K7
матем-теория-методы-решения-уравнений-высших-степеней.pdf 2017-08-05 23:25 367K
367K
2017-08-05 23:25 762K
матем-теория-многоугольник.pdf 2017-12-22 18:22 123K
матем-теория-мзм-для-логарифмических-неравенств.pdf 2017-08-05 23:25 579K
матем-теория-неравенства-с-модульм.pdf 2017-08-05 23:25 211К
матем-теория-с-параметром-с-неравенства 2017-08-05 23:25 89K
матем-теория-окружность-и-четырехугольник.pdf 2017-09-06 18:56 520K
матем-теория-окружность-и-треугольник.pdf 2017-09-06 18:56 37950
матем-теория-окружность-круг.pdf 2017-12-22 18:22 128K
матем-теория-окружность-вписанная-вписанная507-вписанная507 -09-06 18:56 477K
матем-теория-окружность.pdf 2017-08-05 23:25 484K
матем-теория-основные-свойства-трапеции.pdf 2017-09-06 18:56 489K
матем-теория-параллелепипед.pdf 2017-12-22 18:21 111К
матем-теория-параллелограммромбквадрат.пдф 114К
матем-теория-параметры.pdf 2017-08-05 23:25 1.1M
matem-teoriya-ploschadi.pdf 2017-12-22 18:21 154K
матем-теория-показательные-неравенства.pdf 2017-08-05 23:25 82K
матем-теория-правильнымногогранники
.pdf
97К
матем-теория-призма.pdf 2017-12-22 18:22 115K
матем-теория-производная.pdf 2017-08-05 23:25 605K
2017-08-05 23:25 750K
матем-теория-шарсфера.pdf 2017-12-22 18:21 11499K
матем-теория-степенные-и-иррациональные-функции.pdf 2017-08-05 23:25 321K
матем-теория-трапеция.pdf 2017-12-22 18:22 117K
2017-12-22 18:22 153К
матем-теория-тригонометрические-neravenstva.pdf 2017-08-05 113507
матем-теория-цилиндр.pdf 2017-12-22 18:21 89K
матем-теория-уголдугарасостояние.pdf 2017-12-22 18:21 181K
181K матем-теория-вектор.pdf 2017-12-22 18:21 155K
матем-теория-вероятности.pdf 2017-08-05 23:25 1.5M 9050
матем-теория-задачи-на-работе.pdf 2017-08-05 23:25 775K
matem-teoriya-zadanie-14.pdf 2017-08-05 23:25 157K
matem-teorver-zadaniya-fipi.pdf 2017-08-05 23:25 72K
matem-theory.rar 2017-08-05 23:25 482
матем-типовые-задачи-14-задачи.pdf 2017-08-05 23:25 1.1M
matem-top10-oshibki.pdf 2018-08-12 17:36 367K
матем-тригонометрические-формулы-ege.pdf 2017-08-05 23:25 108K
матем-уравнения-s-modulem.pdf 2017-08-05 23:25 871K
матем-все-для-текстовых-задач.pdf 2017-08-05 23:25 667K
матем-высокая-сложность-куканов-.pdf 2017-08-05 23:25 11M
matem2009-100ballov.zip 2017-08-05 23:25 4.4M
matem2013c1-yakovlev.zip 2017-08-05 23:254 196507
matem2013c2-yakovlev.почтовый индекс 2017-08-05 23:25 172K
matem2013c3-yakovlev.zip 2017-08-05 23:25 204K 2017-08-05 23:25 197K
matem2013c5-yakovlev.zip 2017-08-05 23:25 205K
2017-08-05 23:25 365K
matem2013metod-rekomendatzii.rar 2017-08-05 23:25 14M
2017-08-05 23:25 2.6M
матем2014решение-типовых-Б-ответы.pdf 2017-08-05 23:25 3.5M
матемB14Формулы-Заура-Курбанова.PDF 2017-08-05 23:25 142K
matem_teoriya_dekartovy_koordinaty.pdf 2017-08-05 23:25 751K
2017-08-05 23:25 391K
matem_teoriya_formuly_po_stereometrii.pdf 2017-08-05 23:25 519K _funkmain_ 519K _519K 2017-08-05 23:25 724K
matem_enteoriya_konus_tsilindr_piramida.pdf 2017-08-05 23:25 372K
2017-08-05 23:25 322K
matem_teoriya_logarifmy.pdf 2017-08-05 23:25 441K
2017-08-05 23:25 356K
matem_teoriya_proporcionalnye_otrezki.pdf 2017-08-05 23:25 553K 553K 2017-08-05 23:25 41K
матем_теория_задачи_на_движение_по_окружности.pdf 2017-08-05 23:25 59К 59К 59К 59К 2017-08-05 23:25 112K
matem_teoriya_zadachi_na_dvizhenie_s_dopolnitelnoy_skorostyu.pdf 2017-08-05 23:25 40К
2017-08-05 23:25 150K
matem_teoriya_zadachi_na_progressii.pdf 2017-08-05 23:25 80K 9064i_na_zadchi 9050machi_na_zadi 9050mach 9050mach 2017-08-05 23:25 50K
матем_терия_задачи_на_составление_уравнений.pdf 2017-08-05 23:25 1950 1950 2017-10-03 19:31 490K
математическая формула-obema.pdf 2017-10-03 19:31 793K математеория-скещивающиеся-прямые.pdf 2017-10-03 19:31 457K
math-algoritm-решения-задачи-на-раствора.pdf 2017-08-05 23:25 1.0M
math-ekonomicheskie-zadachi.pdf 2017-08-05 23:25 1.0M
math-razbor-zadizhen50ie.pdf -08-05 23:25 1.0M
математика-разбор-задачи-на-работе.pdf 2017-08-05 23:25 611K
praktika-new / 2018-10-10 23:12
7 904 2018-10-29 06:11
teoriya / 2020-01-07 09:51

.

Author: alexxlab

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *