Заполните таблицу строение клетки органоид значение в клетке 5 класс: Заполните таблицу. Строение клетки. Органоид: Значение в…

Содержание

Строение клетки 5 класс

Урок биологии в 5 классе

Тема: «Строение клетки»

Учитель биологии: Каргапольцева Т.Ю.

Тип урока: Урок изучения нового материала.  

Главная дидактическая цель: сформировать понятия об оболочке, цитоплазме, ядре, вакуолях; продолжить формирование умения работать с микроскопом; научить учащихся готовить микропрепарат кожицы лука, находить основные части клетки на микропрепарате и таблице, схематически изображать строение клетки.

Планируемые  результаты обучения

Предметные: учащиеся имеют начальное представление о строении клетки; приобрели навык готовить микропрепарат кожицы лука, умеют рассмотреть его в микроскоп и схематически изобразить строение клетки в тетради.

Метапредметные:

— регулятивные: — самостоятельно  определять цель

 учебной деятельности, искать пути решения проблемы и средства достижения цели;

— участвовать в коллективном обсуждении проблемы, интересоваться чужим мнением, высказывать свое;

— коммуникативные: — обсуждать в рабочей группе  информацию;

— слушать товарища и обосновывать свое мнение;

— выражать свои мысли и идеи.

— познавательные: — работать  с учебником;

— находить отличия;

— составлять схемы-опоры;

— работать с информационными текстами;

— объяснять значения новых слов;

— сравнивать и выделять признаки;

— уметь использовать графические организаторы, символы, схемы для структурирования информации.

Личностные: формируется познавательный мотив на основе интереса к изучению новых для учащихся объектов.

Формирование УУД:

Познавательные УУД

  1. Продолжить формирование умения работать  с учебником.

  2. Продолжить формирование умения находить  отличия, составлять схемы-опоры,  работать с информационными текстами,    объяснять значения новых слов,  сравнивать и выделять признаки.  

  3. Продолжить формирование  навыков  использовать графические организаторы, символы, схемы для структурирования информации.       

 

Коммуникативные УУД

  1. Продолжить формирование умения самостоятельно организовывать учебное взаимодействие при работе в группе (паре).

  2. Продолжить формирование умения слушать товарища и обосновывать свое мнение.

  3. Продолжить формирование умения выражать свои мысли и идеи.

Регулятивные УУД        

  1. Продолжить формирование умения самостоятельно обнаруживать и формулировать учебную проблему, определять цель учебной деятельности (формулировка вопроса урока), выдвигать версии.

  2. Продолжить формирование умения участвовать в коллективном обсуждении проблемы, интересоваться чужим мнением, высказывать свое.

  3. Продолжить формирование умения определять критерии изучения строения клетки.

  4. Продолжить формирование навыков в диалоге с учителем совершенствовать самостоятельно выработанные критерии оценки.

  5. Продолжить формирование умения работать по плану, сверять свои действия с целью и при необходимости исправлять ошибки самостоятельно.

  6. Продолжить обучение основам самоконтроля, самооценки и взаимооценки.

Личностные УУД

  1. Создание условий (ДЗ) к саморазвитию и самообразованию на основе мотивации к обучению и самопознанию.

  2. Осознавать неполноту знаний, проявлять интерес к новому содержанию.

  3. Устанавливать связь между целью деятельности и ее результатом.

  4. Оценивать собственный вклад в работу группы.

Формы работы: фронтальная, групповая, в парах

Методы: частично – поисковый, иллюстративный.

Информационно — технологические ресурсы:  учебник, таблицы «Строение клетки», «Устройство увеличительных приборов»,   компютер, мультимедийное оборудование, (Биология. Бактерии. Грибы. Растения. 5 класс. Электронное приложение. – М.: Дрофа,2013).

Основные понятия урока: клетка, клеточная мембрана, клеточная оболочка, цитоплазма, ядро, вакуоли. 

Деятельность учащихся: схематическое изображение строения клетки в тетради, обсуждение результатов работы.

Ход урока

Мотивация

Учитель: Добрый день, ребята! Давайте посмотрим друг на друга и улыбнёмся. Говорят, «улыбка – это . Я рада, что у вас хорошее настроение, это значит, что мы с вами сегодня очень дружно и активно поработаем.

Сегодня нам предстоит изучить очень интересную тему из курса биологии. Какую? Вы позже назовете сами.

Теперь прослушайте отрывок из стихотворения. О чем говорится в нем?  


Загляните на часок 
В нашу клетку-теремок, 
В цитоплазме там и тут 
Органоиды живут. 
Там такое происходит — 
Цитоплазма кругом ходит, 
Помогает то движенье 
В клетке чудным превращеньям. 
Их не видел Левенгук, 
Удивился б Роберт Гук. 

Кто догадался , о чём мы сегодня будем говорить на уроке ?

(о клетках ,их строении )

— Так какова же тема сегодняшнего урока? (версии детей)

Учитель: Итак, тема нашего урока «Строение клетки».

(Учитель записывает проговоренную тему на доске, а дети в тетрадях)

Презентация (Слайд 1)

Учитель: А теперь давайте попробуем определить цель нашего урока

(Учитель записывает предложенные детьми версии на доске) изучить строение клетки

Проблемный вопрос : «А для чего же мы изучаем клетку ? Почему нам это важно при изучении биологии?»

На этот вопрос вы должны ответить в конце урока . Сегодня на уроке вы побываете в роли путешественников и исследователей .Путешествуя , мы сделаем несколько остановок . Первая станция «Повторяйка» Живые существа, населяющие нашу планету , очень разнообразны ,но все они имеют клеточное строение . Тело растения ,животного ,человека построено из клеток , словно дом из кирпичей

. Клетка – наименьшая единица живого , это основная единица строения и развития всех живых организмов . (Запись в тетради !) Активизация опорных знаний .

Учитель: С помощью чего мы сможем узнать строение клетки?

(с помощью микроскопа)

Давайте с вами вспомним строение микроскопа

(дети показывают на объекте)

Каковы правила работе с микроскопом? (ответы детей) Как узнать во сколько раз увеличивает школьный микроскоп ? Вторая станция «Историческая « Прослушаем сообщение Степанова Григория об изобретении первых микроскопов . Микроскоп – (гр .«микрос» — малый «скопео»-смотрю )-оптический прибор для рассматривания в увеличенном виде небольших ,не различимых простым глазом предметов

. Цитология – наука о клетке (гр. цитос –клетка, логос – учение ,наука )

Изучение нового материала

Станция третья«Научная»

  1. Строение клетки (Рассказ учителя о строении клетки кожицы лука по таблице. Отрабатываются понятия: «клеточная мембрана», «клеточная оболочка», «поры», «цитоплазма», «ядро», «ядрышко», «вакуоль», «клеточный сок», «пигменты – красящие вещества»). Каждая клетка имеет три обязательные части : 1) клеточную мембрану 2) цитоплазму 3) ядро ( генетический аппарат ) Клеточная (или плазматическая) мембрана – служит своего рода «забором», который окружает клетку снаружи , выполняя при этом важные функции . Основная функция – защитная . Мембрана защищает клетку от воздействия внешней среды . На поверхности мембраны можно увидеть различные выросты и складки , которые прочно соединяют между собой . Это помогает клеткам взаимодействовать , «общаться» с друг другом . Мельчайшие отверстия (

    поры)-пронизывают мембрану , помогают обмену веществ .Клетки бактерий , грибов и растений кроме мембраны имеют еще и клеточную стенку (оболочку ) . Клеточная стенка ( оболочка ) является наружным скелетом клетки и определяет ее форму и размеры . Она бесцветная ,прозрачная и очень прочная , состоит из целлюлозы (клетчатки ) . Под оболочкой находится цитоплазма , состоящая из вязкого полужидкого вещества .Она является внутренней средой клетки , в ней протекают различные биохимические процессы .В цитоплазме находится ядро , которое обычно расположено в самом центре клетки . Внутри ядра есть одно или несколько ядрышек . В их состав входит хромосомы которые передают наследственные признаки дочернем клеткам при делении материнской клетки . В цитоплазме клетки есть
    органоиды
    . Органоиды – мельчайшие структуры клетки , выполняющие определенные функции . Например –пластиды и вакуоли . Пластиды – особые органоиды которые встречаются в клетках растений . Они бывают : а) бесцветные (накапливают питательные вещества в запас ) б) оранжево- красные (отвечают за окраску цветов и плодов ) в) зеленые – хлоропласты (находятся в листьях , содержат пигмент хлорофилл). Вакуоль — имеет вид прозрачного пузырька , заполнено клеточным соком . Вакуоль в клетке отвечает за переваривание пищевых частиц . Есть только у растений . Запомните : наличие хлоропластов , крупной вакуоли и клеточной стенки – отличительная особенность клеток растений . Четвертая станция «Познавательная»

Работа в парах

ЗАДАНИЕ : прочитайте текст в учебнике на странице 34-36 и заполните пропуски в таблице 1 «Структуры клетки и их функции». Если урок 40 минут , то можно заполнить таблицу «Органоиды клетки и их функции»

Органоиды клетки и их функции

Станция пятая «Спортивная»

Физминутка

«Отдых наш — физкультминутка,
Занимай свои места.
Встали,встали.потянулись И друг другу улыбнулись. Руки в бок ,один прыжок , а потом присели , Встали , ручками встряхнули и за парты сели.

Станция шестая «Творческая» Изготовить модель растительной клетки из пластилина или цветной бумаги .

Систематизация и обобщение знаний. (Тест2)

Станция седьмая «Конечная»

В начале урока был задан проблемный вопрос : а для чего же мы изучаем клетку ? Почему нам это важно при изучении биологии ? (Из клеток состоят все растения и живые организмы . Клетка основная структурная единица любого живого организма . Клетка обладает всеми признаками живого организма ( питание , дыхание рост, размножение , обмен веществ .)

Рефлексия

Учитель обращает внимание учащихся на доску, где в начале урока были сформулированы цель урока:

  1. Достигли ли мы цели урока ?

  2. Все ли вам было понятно в течении урока ?

Выразите свое отношение к уроку с помощью смайликов .( светофор ) Зеленый –урок прошел хорошо , мне все понятно . Желтый –некоторые задания вызывали затруднения. Красный-урок прошел хорошо, мне все понятно .

Домашнее задание 

Всем: §7 до стр.37, вопросы 1-3 стр. 38.   Отгадать кроссворд .    

Творческий уровень: создать макет клетки или сочинить сказку про клетку (по выбору учащихся).

Подведение итогов урока

Стихотворение «Клетки»

Клетка — жизни всей основа!

Повторять мы будем снова!

Только есть одна беда:

Не удастся никогда

Нам увидеть клетку глазом.

А хотелось бы всё сразу

Рассмотреть и разобрать,

Клетку перерисовать!

Ведь из клетки состоят:

Морж, медведь, петух и кит.

Дуб, сосна, собака, кошка,

Да и гриб на тонкой ножке!

Многоклеточные мы:

И поэтому должны

Клетки мышц мы упражнять,

Клетки мозга развивать.

Обеспечат эти клетки

Нам хорошие отметки!

Ребята! Я очень довольна вашей работой на уроке. А оценки я вам поставлю после проверкии ваших тетрадей.

Урок окончен.до свидания.

Приложение 2

Приложение 3

Приложение 4

Понятия «клетка», «ткань», «орган», «система органов».

Сравнение растительной и животной клетки – методическая разработка для учителей, Мухтарова Гульдана Оразбеккызы

Задание 1

Работа в группе. 5 мин

Используя текст учебника, дайте определение терминам «клетка», «ткань», «орган» и «система органов».

Задание 2. 5 мин

Работа в группе

Установите соответствие между рисунками и понятиями, данными ниже (в группе).

 

Клетка  —————————-

Ткань ——————————

Орган ——————————

Система органов—————-

Организм ————————-

Критерии оценивания:

— дает определение терминам клетка, ткань, орган, система органов;

— устанавливает соответствие между рисунками и терминами. (клетка, ткань, органы, система органов)

 

Дополнительное задание: описать строение клетки (органоиды)

ФО: три хлопка

«Лестница успеха» – 1 мин

 

Физкультминутка: «ДЕНЬ-НОЧЬ» – 1 мин

Задание 3. 7 мин

Заполните таблицу

Виды тканей

Функции

Образовательная

 

Основная

 

Покровная

 

Проводящая

 

Выделительная

 

Опорная

 

Критерии оценивания: объясняют функции тканей.

«Лестница успеха» – 1 мин

Заполните таблицу «Строение клетки» Органоид-значение в клетке — Биология

Главные органоиды
Строение
Функции
1. Цитоплазма
Внутренняя полужидкая среда
мелкозернистой структуры. Содержит ядро и органоиды.
1. Обеспечивает взаимодействие ядра и
органоидов.
2. Выполняет транспортную функцию.
2. ЭПС
Система мембран в
цитоплазме, образующая каналы и более крупные полости.
1. Осуществляет реакции, связанные с
синтезом белков, углеводов, жиров.
2. Способствует переносу и циркуляции
питательных веществ в клетке.
3. Рибосомы
Мельчайшие клеточные
органоиды.
Осуществляет синтез
белковых молекул, их сбору из аминокислот.
4. Митохондрии
Имеют сферическую, нитевидную,
овальную и др. формы. Внутри митохондрии находятся складки (дл. от 0,8 до 7
мк) .
1. Обеспечивает клетку энергией. Энергия
освобождается при распадении АТФ.
2. Синтез АТФ осуществляется ферментами на
мембранах митохондрии.
5. Хлоропласты
Имеет форму дисков,
отграниченных от цитоплазмы двойной мембраной.
Используют световую энергию
солнца и создают органические вещества из неорганических.
6. Комплекс Гольджи
Состоит из крупных полостей
и системы, отходящих от них трубочек, образующих сеть, от которой постоянно
отделяются крупные и мелкие пузырьки.
Принимает продукты
синтетической деятельности клетки и веществ, поступивших в клетку из внешней
среды (белки, жиры, полисахариты) .
7. Лизосомы
Небольшие округлые тельца
(диам. 1 мк)
Выполняют пищеварительную функцию.
8. Клеточный центр
Состоит из двух маленьких
телец – центриолей и центросферы – уплотненного участка цитоплазмы.
1. Играет важную роль при делении клеток.
2. Участвует в образовании веретена
деления.
9. Органоиды движения
клеток
1. Реснички, жгутики имеют одинаковое
ультратонкое строение.
2. Миофибриллы состоят из чередующихся
темных и светлых участков.
3. Псевдоподии.
1. Выполняют функцию движения.
2. За счет их происходит сокращение мышц.
3. Передвижение за счет сокращения особого
сократительного белка.

Stem Cell Organoid Engineering

Органоиды были созданы как из плюрипотентных стволовых клеток (PSC), так и из взрослых стволовых клеток (ASC) путем имитации биохимических и физических признаков развития тканей и гомеостаза (Lancaster and Knoblich, 2014). В самом упрощенном виде развитие человеческого организма представляет собой точно управляемый процесс ступенчатой ​​дифференцировки из зиготы и последующей самоорганизации образующихся в этом процессе клеток (). Этот процесс может быть частично воспроизведен, когда PSCs формируют тератому, содержащую множество полуорганизованных тканей после неконтролируемой дифференцировки и самоорганизации (Przyborski, 2005).Точно так же этот процесс можно контролировать in vitro с помощью PSCs, индуцированных для дифференциации вниз по специфическим клонам. При наличии надлежащего трехмерного каркаса и биохимических факторов дифференцированные клетки из ПСК будут самоорганизоваться с образованием тканеспецифических органоидов, включая глазной бокал (Eiraku et al., 2011), мозг (Lancaster et al., 2013), кишечник (Spence et al., 2011), печени (Takebe et al., 2013) и почках (Takasato et al., 2014). Кроме того, гомеостаз многих тканей in vivo поддерживается тканеспецифичными ASC посредством самообновления и дифференцировки с последующей самоорганизацией стволовых клеток и их потомства.Этот процесс также может быть воспроизведен in vitro в определенных условиях культивирования для контроля самообновления и дифференцировки, что приводит к самоорганизации тканевых органоидов, включая кишечник (Sato et al., 2009), желудок (Barker et al., 2010), печень ( Huch et al., 2013) и поджелудочной железы (Huch et al., 2013).

В процессе формирования органоидов используется ряд общих факторов для контроля самообновления и дифференцировки стволовых клеток или содействия самоорганизации. Факторы роста или малые молекулы используются для манипулирования несколькими сигнальными путями, важными для выживания, пролиферации и самообновления клеток, часто тканеспецифическим образом.В паре с биохимическими сигналами Matrigel является общим и важным компонентом системы, которая обеспечивает каркас и дополнительное дополнение сигнальных сигналов через лиганды базальной мембраны для поддержки прикрепления и выживания клеток, а также образования органоидов (Xu et al., 2001). Часто органоидные системы регулируются микроокружением (или нишей) стволовых клеток, которое они поддерживают, что обеспечивает точку контроля. Ниша стволовых клеток содержит широкий спектр элементов, включая биохимические и биофизические сигналы, межклеточные взаимодействия и взаимодействие внеклеточного матрикса (ECM) (Li and Xie, 2005).Современные органоидные системы в основном полагаются на внутренние или внешние биохимические сигналы (например, факторы роста) и клеточно-автономные или межклеточные взаимодействия для контроля судьбы стволовых клеток. Хотя все это важные факторы для контроля дифференцировки и организации клеток, образование органоидов сильно зависит от клеточно-автономной самоорганизации (Lancaster and Knoblich, 2014), которую еще нелегко контролировать.

Во время создания систем моделей органоидов для управления поведением и организацией органоидов стало доступно несколько биоинженерных подходов, которые были разработаны в других областях, включая инженерию ниш стволовых клеток и инженерию тканей.Здесь мы обсудим эти стратегии и приведем примеры того, как биоинженерные подходы могут использоваться для усиления контроля над поведением органоидов, от инструментов на субклеточном уровне до инструментов, влияющих на физиологию систем.

Биоинженерные органоидные системы

Органоидные системы предлагают одну из наиболее многообещающих платформ для использования стволовых клеток, особенно потому, что они способны воспроизводить многие важные свойства ниши стволовых клеток и полученной из нее ткани. Однако, как и в любой модельной системе, остаются пробелы между in vitro и in vivo, которые можно частично устранить с помощью направленных усилий биоинженерии.Эти усилия могут повысить полезность органоидов при скрининге лекарств, регенеративной терапии или исследованиях физиологических и патологических процессов. Биоинженерные подходы также могут применяться для разработки восходящих синтетических органоидных конструкций или мультиплексных органоидных компонентов, что позволяет улучшить управление системой и разработать дополнительные модели для основных и трансляционных исследований ниши стволовых клеток и органоидов.

Органоидные системы используют способность стволовых клеток к самообновлению и дифференцировке, а также внутреннюю способность к самоорганизации для формирования организованных структур.В то время как стволовые клетки являются «рабочей лошадкой» органоидной системы, поведение стволовых клеток контролируется микроокружением. В органоидах нишевые компоненты образуются клетками (например, в случае аутокринных, паракринных или юкстакринных сигналов) или экзогенно добавляются в систему (например, в случае субстратов ВКМ, малых молекул и факторов роста). Их взаимодействие создает динамическую среду по структуре и функциям, которая координируется в пространстве и времени и обеспечивает самообновление/дифференциацию стволовых клеток и самосборку клеток в органоиды.Чтобы улучшить контроль над органоидами и дополнительно модулировать систему для последующих приложений, необходимы систематические инженерные подходы для манипулирования каждым структурным слоем в процессе формирования органоидов. Это может быть достигнуто за счет модуляции клеток, генерируемых за счет контроля самообновления и дифференцировки стволовых клеток, за счет прямой модификации стволовых клеток или за счет косвенного контроля за ними посредством манипулирования микроокружением, а также за счет модуляции организации клеток в системе.Недавние достижения в области биоматериалов, микро/нанотехнологий и сборки тканей, управляемой стволовыми клетками, позволили значительно продвинуться в направлении таких систем. Комбинируя новые подходы из этих областей, можно будет создавать микросреды, которые напоминают структуру и функции in vivo, создавая несколько динамичных и самособирающихся органоидных тканей.

Проектирование ниши

Поведение стволовых клеток in vivo строго регулируется посредством внешних биохимических и биофизических сигналов от специализированных микроокружений.Эти микроокружения состоят из сложного множества сигнальных механизмов от поддерживающих нишу клеток, внеклеточного матрикса и механических сил, а также системных и физико-химических условий, таких как уровни кислорода и рН. Компоненты, составляющие динамическую среду, интегрируют устойчивые и быстрые краткосрочные сигналы, чтобы либо поддерживать состояние покоя стволовых клеток, либо вместо этого индуцировать пути развития или регенеративные ответы. В дополнение к этому, ниша может реконструироваться и управляться составляющими ее стволовыми клетками.Разработка биомиметической системы, которая включает каждый из этих сигнальных путей и взаимодействий, позволит лучше контролировать рост и дифференцировку стволовых клеток in vitro и позволит манипулировать ими в соответствии с предполагаемым применением.

Индивидуальные биомиметические каркасы

ВКМ является одним из основных компонентов ниши стволовых клеток, обеспечивая структурную поддержку и опосредуя инструктивную передачу сигналов для поляризации, удержания и мобилизации клеток (Peerani and Zandstra, 2010).Компоненты ВКМ, такие как ламинин, фибронектин и коллаген, составляют физическую основу тканей и также влияют на поведение клеток, задействуя их интегриновые рецепторы (Vazin and Schaffer, 2010). Несколько подходов могут быть использованы для имитации нативного ECM ниши стволовых клеток или зрелой ткани, включая 3D-каркасы с микро- или наноразмерной топографией, для производства индивидуальных биоматериалов (Peerani and Zandstra, 2010). В качестве альтернативы каркасы ECM также могут быть получены из децеллюляризованных матриц.Напр., при достижении слияния in vitro лежащий в основе ECM матрикс стромальных клеток костного мозга может быть децеллюляризирован и использован для имитации эндостальных или сосудистых ниш вместе с соответствующими факторами роста (Tan and Barker, 2013).

Недавно введенные органоиды, полученные из стволовых клеток, использовались для имитации аспектов органогенеза человека и достигли заметного морфологического сходства с их природными аналогами (Eiraku et al., 2011; Lancaster et al., 2013; Stange et al., 2009) .Матригель часто является важным компонентом органоидной культуры. Однако при использовании Matrigel, который, как правило, не имеет четкого определения, игнорируются специфические сигналы ECM, необходимые для различных типов тканей. Кроме того, учитывая его гетерогенный состав, он не позволяет легко манипулировать морфогенетическими процессами, которые строго регулируются in vivo специфическими пространственно-временными сигналами. В качестве альтернативы, основные сигналы от природных ECM могут быть включены в синтетические полимерные матрицы для создания дизайнерских ECM со специально подобранными составами.Например, гликозаминогликаны, такие как гиалуроновая кислота (ГК), являются важными молекулами ВКМ, которые, как было показано, играют важную роль в модуляции поведения нервных стволовых клеток (НСК) и гемопоэтических стволовых клеток (ГСК) в своей нише (Vazin and Schaffer, 2010). что делает их потенциально подходящими компонентами систем на основе биоматериалов для имитации структуры ниши НСК и ГСК. Биомиметические каркасы могут быть сконструированы либо из синтетических полимеров (таких как полиакриламины и полиэтиленгликоль [ПЭГ]), либо из природных макромолекул (например, агарозы или коллагена), которые затем можно использовать, чтобы сделать их допускающими биологические процессы.Например, биомиметический гидрогелевый каркас, сконструированный из пуллулана (полисахаридного полимера) в комплексе с коллагеном для имитации ECM эпидермальной ниши, был способен усиливать васкуляризацию и заживление при доставке МСК в места ран (Rustad et al., 2012). Несмотря на этот прогресс, синтетические каркасы остаются примитивными по сравнению с такими субстратами, как Matrigel, и им не хватает критического динамического свойства клеточного ремоделирования.

Синтетическая среда может быть сконструирована таким образом, чтобы более точно воспроизвести природный внеклеточный матрикс, путем декорирования биоинертных матриц сигнальными белками посредством химического/ферментативного сшивания через адгезивные или протеолитически расщепляемые участки. Высокопроизводительный скрининг таких платформ позволит анализировать несколько переменных, чтобы определить, какая комбинация сигналов наиболее подходит для модулирования активности стволовых клеток, и помочь разработать синтетические аналоги ECM для получения желаемого ответа. Клеточные микроматрицы способны выполнять такой высокопроизводительный анализ. Привязывая сигналы микросреды, такие как компоненты ECM, растворимые факторы и белки межклеточного взаимодействия, к дискретным местам, можно создать множество искусственных каркасов (Gjorevski et al., 2014; Гобаа и др., 2011). Другим методом обеспечения соответствующей поддержки ECM и сигнальных сигналов является микроконтактная печать. Этот метод непосредственно наносит белки, ECM или клетки на частично полимеризованный гидрогелевый субстрат. Это делается с помощью штампа, часто состоящего из поли(диметилсилоксана) (PDMS) с использованием техники мягкой литографии (Perl et al., 2009). Однако морфогенез и органогенез по своей сути являются трехмерными процессами, и, таким образом, их внешняя регуляция не может быть полностью понята при двумерном анализе. Недавно эта технология была распространена на платформу 3D-микрочипов (Ranga et al., 2014), обеспечивая высокопроизводительный метод выявления влияния сигнальных белков, а также эластичности и способности к деградации матрикса на регуляцию стволовых клеток в пространственно значимом контексте. . Достижение конструкции ECM, которая имеет физиологически значимую топографию, также важно. Стратегии нанолитографии, такие как электроспиннинг, электронно-лучевая литография, наноимпринтная литография и селективное травление, использовались для формирования нановолокнистых подложек, наноямок, наностолбиков или наноканалов на различных материалах.Электронно-лучевая литография использует управляемую компьютером электронную пушку для сканирования поверхности подложек, создавая узоры с наноразмерным разрешением, в то время как электропрядение используется для производства сверхтонких волокон, которые могут образовывать произвольно ориентированные волокнистые сетки, подходящие для каркаса тканевой инженерии. Другие методы включают литографию с наноотпечатком (вдавливание жесткой формы в слой нагретого полимера) и селективное травление (с использованием химического травителя для придания шероховатости поверхности). Эти стратегии использовались для создания поверхностных элементов, которые приближаются к естественной форме и размерам волокна базальной мембраны и размерам пор, а также имитируют пористость природного ECM.Было показано, что эти механизмы поддерживают самообновление эмбриональных стволовых клеток человека и контролируют дифференцировку MSC человека, основываясь на различных конфигурациях этих поверхностей (Murphy et al., 2014).

Механическая передача сигналов окружающими тканями также играет важную роль в модуляции клеточного поведения in vivo. Отсутствие таких сил in vitro может объяснить важные морфологические различия, такие как отсутствие образования ворсинок в кишечных органоидах (Gjorevski et al., 2014; Шайер и др., 2013). Для динамической настройки механических свойств микроокружения можно использовать светоопосредованную технологию формирования паттернов. Гидрогель ПЭГ, содержащий фотолабильные поперечные связи, может подвергаться локальной деградации под воздействием света, что приводит к размягчению геля. В качестве альтернативы, при включении в гель фотоинициаторов, попадание света на определенные области вызовет дополнительное сшивание и локальное повышение жесткости (Guvendiren and Burdick, 2012). Эти светозависимые стратегии также могут быть реализованы для создания градиентов жесткости с микромасштабным разрешением.Путем фотомаскирования сшитых УФ-материалов количество света можно использовать для воссоздания естественных изменений жесткости в искусственной матрице (Vincent et al., 2013).

Приспособляемость к клеточным модификациям

Важным шагом на пути к созданию материалов, которые могут взаимодействовать с клетками, является разработка биоактивных интерфейсов, которые обеспечивают как специфичность, так и гибкость. Для этого материалы и поверхности должны быть рационально спроектированы, чтобы придать им определенные биофункциональные свойства. Например, для конструирования стимулирующих рост поверхностей можно использовать общие мотивы клеточной адгезии, такие как RGD (аргинин-глицин-аспарагиновая кислота), или более специфичные для клеток белки, способствующие адгезии, и комплементарные рецепторы для взаимодействия с клеточными интегринами и стимулирования адгезии и распространение. Однако такие материалы также должны быть способны приспосабливаться к изменениям, вызванным клеточной активностью, которую они содержат.

Клетки могут активно модифицировать поверхность, поскольку они проходят через быстрые и динамичные процессы клеточной адгезии и роста.В рамках естественного процесса роста клетки после прилипания начинают стягиваться и перестраивать связанные с поверхностью биомолекулы. На искусственной поверхности, где лиганды ковалентно связаны, этот процесс затруднен. Чтобы решить эту проблему, мотивы адгезии, такие как RGD, могут быть связаны с материальными поверхностями с помощью длинных гибких нитей, позволяющих клетке стягивать их в кластеры (Kuhlman et al. , 2007). Искусственные системы, включающие тщательно организованные белки, также подвержены ферментативному расщеплению, поскольку клетки пытаются реконструировать окружающий их ВКМ для миграции или роста.Можно прививать более короткие полипептиды, менее подверженные протеолизу. Тем не менее, альтернативным подходом может быть разработка преднамеренно разлагаемых материалов, в которых используются секретируемые клетками протеазы. Например, сшивая полимеры, такие как ПЭГ, с синтетическими пептидами, распознаваемыми клеточными протеазами, можно контролировать точку расщепления. Деградация каркаса, опосредованная самой клеткой, может использоваться для стимуляции миграции клеток в заранее заданной ориентации (Raeber et al., 2005).

Пространственно-временной контроль

В дополнение к созданию трехмерного культурального каркаса, который может вместить синтетические аналоги взаимодействий клеток и ВКМ, крайне важно интегрировать другие нишевые компоненты для культивирования стволовых клеток in vitro для стимулирования образования органоидов. Основная проблема при создании искусственного каркаса in vitro заключается в том, чтобы точно воспроизвести пространственное представление сигналов клеткам. В традиционных трехмерных культурах клетки наполнены биохимическими сигналами без какого-либо пространственно-временного контроля.Это приводит к основным различиям, наблюдаемым между органогенезом in vivo и in vitro. Недавние достижения дали уникальные подходы для преодоления этого ограничения путем манипулирования ECM с использованием светоопосредованного формирования паттернов. Например, путем включения участков связывания биомолекул в гидрогель и маскирования их активных участков фоторазлагаемым фрагментом можно было контролировать миграцию МСК внутри гидрогеля ПЭГ (Gjorevski et al., 2014; Kloxin et al., 2009). . Свет высвобождает активный субстрат трансглютаминазного фактора XIII (FXIIIa), позволяя белкам внеклеточного матрикса и факторам роста быть привязанными к матриксу на основе индуцированного светом паттерна.Этот механизм предлагает мощный инструмент для управления точным шаблоном, местоположением и временем, когда сигнал может быть представлен ячейке.

Растворимые факторы роста также могут быть доставлены с помощью микрогранул или разлагаемых носителей в культуральном каркасе. Наночастицы, нагруженные факторами роста, также могут быть напрямую конъюгированы на поверхности клетки, медленно высвобождая молекулы, которые в первую очередь будут повторно захвачены клетками, несущими частицы, в аутокринной сигнальной петле (Stephan and Irvine, 2011).Эти методы позволяют в некоторой степени контролировать кинетику высвобождения сигнальных сигналов в зависимости от конструкции материала. Также могут быть созданы биочувствительные биоматериалы, в которых факторы роста высвобождаются на основе высвобождения матриксных металлопротеиназ из клеток. Гидрогели на основе ПЭГ были изготовлены с пептидными последовательностями, чувствительными к протеолитической деградации, и их успешно использовали для доставки в клетки фибробластов человека биоактивных молекул, помогающих регенерировать кость in vivo (Vazin and Schaffer, 2010).Микрожидкостные устройства также могут доставлять лиганды, формируя градиенты лигандов посредством манипулирования скоростью потока и профилем потока. Хотя этот метод может не позволить макромасштабную архитектуру, он требует небольшого размера выборки, что делает его многообещающим инструментом для высокопроизводительного скрининга и анализа клеточных культур.

Биопечать и восходящие подходы к конструированию органоидов

Для конструирования органоидов с контролируемыми взаимодействиями между клетками и клетками и матриксом клетки и материалы могут быть непосредственно нанесены на поверхность для получения трехмерных совместных культур двух или более типов клеток с настраиваемой геометрией, которая может быть предварительно определена с помощью данных визуализации с помощью КТ или МРТ желаемых тканей или органов.Биопечать произошла от двухмерной струйной печати; вместо того, чтобы наносить капли черных чернил на подложку, чернила содержат биоматериал с живыми клетками, которые точно позиционируются в аддитивном послойном подходе для создания трехмерных биологических структур, имитирующих структуру и функцию нативных тканей и органов (Atala и Ю, 2015 г. ; Мерфи и Атала, 2014 г.). Современные принтеры можно использовать для создания сложных компонентов ECM из нескольких материалов, содержащих несколько типов клеток (Atala and Yoo, 2015; Murphy and Atala, 2014).Биочернила на основе гидрогеля, содержащие питательные вещества для поддержки выживания и функционирования клеток, например, используются для размещения клеток в 3D-принтерах, в результате чего получаются 3D-тканеподобные массы, которые пытаются походить на нативные ткани (Atala and Yoo, 2015). Например, недавно был создан органоид бьющегося сердца, способный реагировать на электрические и химические сигналы, изменяя характер своего биения. Другими примерами органоидов, созданных с помощью биопечати, являются органоиды печени, мышц и микрососудов крови человека (Atala and Yoo, 2015).Несмотря на большой прогресс, остается несколько проблем, в том числе возможность печати с высоким разрешением, достижение соответствующей и контролируемой плотности клеток и достижение долгосрочной функциональности клеток биочернил. Было продемонстрировано, что в дополнение к биопечати восходящие подходы обеспечивают микромасштабный пространственный контроль межклеточного взаимодействия. Путем сначала индивидуальной сборки микромасштабных клеточных конструкций, а затем вызывая контролируемую организацию множества конструкций, можно собирать пространственно контролируемые клеточные агрегаты (Du et al., 2008). Восходящие подходы представляют интересную возможность для построения контролируемых ниш стволовых клеток или построения мультитканевых органоидных систем.

Васкуляризация

Обеспечение достаточного снабжения питательными веществами и кислородом является дополнительным важным фактором при разработке функциональных тканевых структур и органоидов in vitro. In vivo органы состоят из иерархически разветвленных сосудистых сетей, и почти все клетки находятся в пределах нескольких сотен микрон от капилляра, чтобы обеспечить достаточное снабжение посредством диффузии.Интеграция сосудистой структуры, которая обеспечивает адекватную доставку кислорода и питательных веществ, является необходимым шагом в полной рекапитуляции более крупных органоидов с ограниченной диффузией. Одна из стратегий для достижения этого состоит в клеточном подходе, при котором эндотелиальные клетки засевают внутри системы для формирования новых кровеносных сосудов в процессе, известном как неоангиогенез. Другая стратегия основана на использовании каркасов, когда синтетические каркасы используются для создания микроинженерных трехмерных структур с настраиваемыми геометрическими, механическими и биологическими свойствами.Многие попытки создать васкуляризацию in vitro объединяли эти подходы. Микрожидкостные устройства, обеспечивающие равномерное распределение потока и массопереноса, могут быть изготовлены с использованием процессов мягкой литографии и микроформования с использованием таких полимеров, как PDMS, полимолочная кислота (согликолевая кислота) (PLGA) и полиглицеринсебацинат (PGS). . Затем можно использовать методы биопечати для заполнения каналов несколькими типами сосудистых клеток (Golden and Tien, 2007; King et al., 2004; Visconti et al., 2010). Дополнительная стратегия включает в себя процесс модульной сборки, при котором клетки высевают в коллагеновые конструкции, достаточно маленькие, чтобы избежать ограничений диффузии, которые затем покрываются эндотелиальными клетками и объединяются для создания более крупных перфузионно-способных структур (McGuigan and Sefton, 2006). Следует отметить, что для органоидных систем эти стратегии необходимо будет изменить, чтобы они могли интегрироваться в трехмерные макромасштабные структуры ткани и обеспечивать перфузию и специализированные физиологические функции этой ткани.

Каркасы также могут быть функционализированы комбинацией проангиогенных биомолекул, таких как факторы роста эндотелия сосудов (VEGF), факторы роста тромбоцитов (PDGGF) и основные факторы роста фибробластов (BFGF) для быстрого формирования зрелых сосудистых сетей (Richardson и другие., 2001; Зиш и др., 2003). Эти ангиогенные факторы роста могут не только запускать неоваскуляризацию, но они также могут направлять миграцию эндотелиальных клеток-предшественников через градиенты и способствовать сборке клеток. Используя зависящее от времени высвобождение из биоразлагаемых пористых каркасов или микрочастиц, эти иммобилизованные белки могут быть доставлены контролируемым в пространстве и времени устойчивым образом (Karal-Yilmaz et al., 2011; Layman et al. , 2012).

Извлечение клеток

Появилось несколько стратегий освобождения клеток от поверхностей с минимальным воздействием на фенотип клеток.Например, термочувствительные полимеры, такие как поли(N-изопропилакриламид) и сополимеры, такие как ди(этиленгликоль)метакрилат и 9-мерный олиго(этиленгликоль)метакрилат, могут переходить из коллапсного состояния в гидратированное, расширенное состояние (Lutz и др., 2006; Wischerhoff и др., 2008). В расправленном состоянии материал становится устойчивым к белкам, образуя слой, который допускает лишь слабое притяжение между клеткой и поверхностью, мягко высвобождая клетки без использования агрессивных химических обработок или протеолитического расщепления.

Действительно, существует значительная потребность в новых подходах, позволяющих эффективно извлекать клетки. Например, для получения достаточного количества PSC человека (hPSC) для лечения на основе стволовых клеток, hPSC необходимо быстро и надежно размножить в культуре, а затем собрать. Как и в приведенном выше примере, для достижения этой производственной цели разрабатываются другие синтетические полимерные гидрогелевые системы. Поли(N-изопропилакриламид)-со-поли(этиленгликоль) (PNIPAAm-PEG) представляет собой еще один гидрогель, обладающий термочувствительными свойствами.Этот гидрогель обеспечивает простую инкапсуляцию и извлечение hPSC путем перехода от жидкого к твердому гелю с переключением температуры от 4°C до 37°C. Этот специфический гидрогелевый матрикс также демонстрирует значительно увеличенное размножение клеток из 2D-адгезивных форматов, а также более гомогенную популяцию, которая сохраняет свой плюрипотентный фенотип (McDevitt, 2013), что делает его масштабируемой и совместимой платформой для производственных практик.

Мониторинг компонентов ниши in vitro

Некоторые компоненты ниши стволовых клеток, такие как межклеточные взаимодействия, распределение кислорода, локальные уровни pH и транспорт питательных веществ, трудно исследовать in vivo, хотя в последнее время достигнут значительный прогресс. Сенсоры и устройства, которые могут быть включены в нишу in vitro с минимальным вмешательством в естественные процессы, могут обеспечить точный мониторинг условий культивирования и помочь нам лучше понять такие параметры. Некоторые из этих возможностей уже были продемонстрированы in vivo. Например, с помощью двухфотонной фосфоресценции прижизненной микроскопии были измерены локальные уровни кислорода в костном мозге живых мышей с микрометровым пространственным разрешением (Spencer et al., 2014). Влияние передачи сигналов, опосредованной клеточным контактом, в нише стволовых клеток может быть дополнительно проанализировано с использованием микромасштабных устройств.Например, микроструктуры можно использовать для точного контроля пространственного позиционирования клеток и изучения их взаимодействий (Hui and Bhatia, 2007).

Кроме того, трехмерные микрофлюидные устройства, которые можно легко контролировать с помощью нескольких методов визуализации, способны точно имитировать ключевые физиологические и структурные особенности небольших функциональных единиц органов и обеспечивают платформу для более подробного изучения таких биологических систем. Например, микрожидкостные особенности, такие как микроканалы, могут обеспечить поток жидкости со скоростью, наблюдаемой в естественных условиях.Микрожидкостные устройства, такие как технология «орган на чипе», также могут имитировать перистальтические сокращения и основную функцию кровеносных сосудов по доставке кислорода и питательных веществ при одновременном удалении отходов (Bhatia and Ingber, 2014; Huh et al., 2010). На чипе уже созданы миниатюрные модели функциональных биологических единиц, в том числе модели легких, печени, почек, кишечника, сердца, жира, костного мозга, роговицы, кожи и гематоэнцефалического барьера (см. Bhatia and Ingber, 2014). рассмотрение). Системы «орган-на-чипе» можно использовать для визуализации в реальном времени с высоким разрешением, а также для анализа биохимических, генетических и метаболических процессов в условиях, очень похожих на условия in vivo.

Хотя микрожидкостные системы «орган-на-чипе» могут объединять ключевые компоненты вместе и по-прежнему обеспечивать точный контроль и измерения, некоторые функции традиционных систем 3D-культивирования органоидов могут быть более выгодными. Например, традиционные системы трехмерного культивирования органоидов могут генерировать большую массу ткани, что позволяет ученым проводить аналитические эксперименты, для которых обычно требуются большие образцы. Трехмерные культуры также позволяют выращивать макромасштабную архитектуру и очень сложные и пространственно неоднородные ткани, которые не могут поддерживаться на микроуровне.Кроме того, использование технологии микрофлюидных чипов сопряжено с некоторыми экспериментальными нюансами. Изготовление чипа требует микроинженерных возможностей, и этот процесс подвержен бактериальному загрязнению и образованию пузырьков, которые будут мешать здоровью клеток, функционированию и производству чипа. Тем не менее, несмотря на эти неудачи, микрожидкостные чипы по-прежнему предлагают беспрецедентную гибкость в независимом управлении и мониторинге таких функций, как положение клеток и тканей, поток жидкости и механические сигналы, помогая анализировать их вклад в работу тканей и органов.Что наиболее важно, эта технология устраняет главный недостаток макромасштабного 3D-культивирования. По мере увеличения функциональности и сложности систем 3D-культивирования некоторые ткани становятся более недоступными. Следовательно, становится все труднее выполнять визуализацию с высоким разрешением и отслеживать активность клеток. Орган-на-чипе позволяет легко интегрировать клетки с флуоресцентной конфокальной микроскопией, микрофлуориметрией, измерениями трансэпителиального электрического сопротивления, множественными электродными массивами и другими аналитическими системами (Bhatia and Ingber, 2014; Huh et al., 2010).

Биообработка и масштабирование

Одной из основных проблем при внедрении тканевой инженерии в клинику является существующий пробел в биотехнологии, включая вопросы масштабируемости и стандартизации. Масштабирование органоидной платформы до производственных масштабов сталкивается с аналогичным препятствием, и будущие конструкции нишево-миметической органоидной системы должны приспособиться к некоторой степени масштабирования. Биореакторы с перемешиванием суспензии на основе агрегатов ранее продемонстрировали способность контролировать размножение и дифференцировку стволовых клеток (Fluri et al. , 2012; Кинг и Миллер, 2007 г.; Унгрин и др., 2008). Однако для дальнейшего расширения нашего контроля над поведением стволовых клеток могут быть реализованы биореакторы, которые могут лучше воссоздать нишу стволовых клеток с использованием двухфазной системы (Kirouac and Zandstra, 2008). Он состоит из предоставления как объемных сигналов, таких как физиологические условия рН, напряжения кислорода, уровней глюкозы и температуры, так и сигналов клеточного уровня, таких как сигналы взаимодействия клетка-клетка и клетка-ВКМ. Массовые сигналы могут быть обеспечены с помощью обмена культуральными средами и контролироваться с помощью датчиков и контуров управления процессом, в то время как сигналы микросреды можно контролировать с помощью конструкции каркаса и тех же методов формирования белкового паттерна, которые используются в лабораторных культурах.Для таких трехмерных систем, которые требуют как непрерывного потока, так и взаимодействия с субстратом, пористость и проницаемость каркаса будут важными свойствами, которые следует учитывать. Другие характеристики системы, такие как простота извлечения клеток и строгие методы мониторинга процесса для контроля качества продукции, также должны быть включены. В конечном счете, прежде чем органоиды смогут перейти в клинику и производиться в больших масштабах, необходимо сначала понять их динамическую реакцию на системные параметры. Это включает в себя создание математических моделей, которые могут точно предсказать поведение системы, а также идентификацию регулируемых входных параметров и надежных маркеров ячеек для подтверждения качества выходных данных.

Историческая перспектива трехмерного мышления

Как мы определяем органоиды и трехмерные культуры?

То, что функциональная дифференциация зависит от трехмерной архитектуры, недавно стало общепризнанным. Многие работы за последние 50 лет показали, что клетки, культивируемые в 2D, не являются репрезентативными для ситуации in vivo. Структурно 2D-культуры не обеспечивают условий для организации и клеточных взаимоотношений, наблюдаемых in vivo. Более того, клеточные сигнальные сети изменяются в 2D по сравнению с 3D, и это, вероятно, объясняет, почему результаты скрининга лекарств часто не воспроизводят условия in vivo (Wang et al., 1998; Уивер и др., 2002). Обнадеживает признание важности трехмерных культур для моделирования передачи сигналов, дифференцировки и разработки лекарств. Во многих исследованиях используются элегантные изображения и сложная анимация, которые приятно видеть и слышать, и которые ясно показывают сходство между органоидами и тканями и органами, из которых клетки были получены in vivo. Мы приветствуем волнение и приветствуем общий энтузиазм, который заслуженно вызвала эта работа. Что самое интересное, так это то, что объединенные усилия, наконец, достигли критической массы и в результате привлекли внимание многих новых ученых, которые подчеркивают важность 3D-культуры, указывая на актуальность и значимость этой работы для клинических исследований.Однако термин «органоид» трактуется или стал подразумевать, что это совершенно новая область, отдельная от того, чем в течение многих лет занимались несколько ученых еще на рубеже прошлого века, по существу изолированно. , вводя термин 3D-культуры, начиная с области микроокружения и указывая на важность тканевой архитектуры.

Первое использование слов «трехмерные модели культуры», как мы полагаем, началось с анализов, разработанных Barcellos-Hoff et al.(1989) и Petersen et al. (1992), хотя плавающие коллагеновые гели были описаны в 1970-х годах и, безусловно, были трехмерными (см. ). До 2005 года слово «органоид» было расширением трехмерных культур. Как правило, это относилось к небольшим фрагментам ткани, взятым из органов, в основном эпителиальных тканей, отделенным от стромы механическим и ферментативным расщеплением и выращенным в различных типах 3D-гелей для создания органоподобной структуры. В качестве примера см. Simian et al. (2001), в которых фрагменты молочных желез грызунов выращивали в коллагеновых гелях для получения ветвящейся структуры, напоминающей ветвление в молочной железе девственных мышей, или Fata et al.(2007), в которых фрагменты молочных желез грызунов выращивали в гелях, богатых ламинином, что приводило к альвеогенезу. Однако в последнее десятилетие значение «органоида» утратило точность и стало охватывать ряд методов культивирования клеток, которые не обязательно являются одним методом. Ниже приведены примеры определений органоидов, взятые из некоторых недавних статей в соответствующих журналах в этой области. Мы сталкиваемся со следующими определениями:

Хронология методов и экспериментов, ведущих к текущему органоидному полю. Изображения, показанные в рамке 1975–1977 гг., взяты из Lyon et al. (2015 г.) и отображаются в соответствии с условиями лицензии Creative Commons. Рисунок предоставлен Нилом Смитом.

(1) «В различных подполях эти термины используются взаимозаменяемо или по отдельности; например, в области биологии молочных желез термин органоиды относится к первичным эксплантатам эпителиальных протоков в гели трехмерного внеклеточного матрикса (ECM). И наоборот, в исследованиях биологии кишечника органоиды могут относиться к клональным производным первичных эпителиальных стволовых клеток, выращенных без мезенхимы, или могут относиться к эпителиально-мезенхимальным совместным культурам, происходящим из эмбриональных стволовых клеток или индуцированных плюрипотентных стволовых клеток» (Shamir and Эвальд, 2014).

(2) «Таким образом, мы хотели бы определить органоид как содержащий несколько типов клеток, которые развиваются из стволовых клеток или органов-предшественников и самоорганизуются посредством сортировки клеток и пространственно ограниченной фиксации клонов, аналогично процессу в vivo» (Ланкастер и Кноблих, 2014).

(3) «Органоид теперь определяется как трехмерная структура, выращенная из стволовых клеток и состоящая из специфических для органов типов клеток, которые самоорганизуются посредством сортировки клеток и пространственно ограниченной детерминации клонов…» (Clevers, 2016) .

(4) «Здесь мы определяем органоид как трехмерный клеточный кластер in vitro, полученный исключительно из первичной ткани, эмбриональных стволовых клеток или индуцированных плюрипотентных стволовых клеток, способный к самообновлению и самоорганизации и обладающий функциональностью органа, сходной с ткань происхождения» (Fatehullah et al., 2016).

«Характер и организация тканей определяются пространственным расположением, взаимными отношениями и типичными группировками клеток, которые вместе с межклеточным материалом объединяются в закономерности развития и функционирования.Со структурой и целостностью этих клеточных паттернов связан ход предполагаемого развития…» Moscona and Moscona, 1952

На наш взгляд, первое определение, данное Shamir and Ewald (2014), является наиболее исчерпывающим и точным, учитывая, что он включает в себя различные определения, с которыми ассоциируется слово «органоид». Он позволяет избежать конкретных ограничений, налагаемых другими определениями, и включает органоиды, полученные из индуцированных или эмбриональных стволовых клеток. Исследователи действительно способны генерировать органоиды в богатых ламинином гелях из одиночных клеток нормальных тканей или злокачественных опухолей или даже клеточных линий, не обязательно начиная с клеток, которые экспрессируют маркеры стволовых клеток (Weaver and Bissell, 1999). Это особенно актуально, учитывая, что мы до сих пор не понимаем, можно ли определить стволовую клетку независимо от ее ниши (Schofield, 1978; Mesa et al., 2015). Ниши — это специализированные микроокружения, расположенные внутри каждой ткани, где находятся стволовые клетки. Ниши оказывают ключевое влияние на функцию стволовых клеток и определяются как сумма взаимодействий клетка-клетка, клетка-ВКМ и клетка-растворимый фактор в контексте физических и геометрических ограничений, которые клетка может испытывать в данный момент времени. (Каплан и др., 2007). Способность ниши определять функциональный спектр активностей стволовых клеток приводит к гипотезе, что микроокружение ниш стволовых клеток является критическим в определении функций стволовых клеток (Kaplan et al., 2007; LaBarge et al., 2007).

Следует признать, что разработка условий культивирования, которые были установлены учеными, работающими над органоидами (как первоначально определено), способствовала значительным успехам, о которых сообщалось в области стволовых клеток за последние 10 лет. Независимо от методов, используемых для создания органоидов и их содержания в культуре, эти достижения представляют собой выдающиеся модельные системы для изучения развития и болезней человека. Для многих органов, таких как мозг, развитие мыши и человека неодинаково (Lancaster et al., 2013). Более того, индуцированные плюрипотентные стволовые клетки, полученные из фибробластов кожи, а также 3D-культуры нормальных и больных органов человека предлагают модели болезней человека, которые нелегко изучать на животных моделях (Lancaster et al., 2013). Кроме того, разработка скрининговых платформ, основанных на органоидах человека, может обеспечить более экономичные и точные доклинические условия для открытия новых лекарств в долгосрочной перспективе.

Интересно, что слово органоид изначально имело значение, отличное от всего вышеперечисленного. В 1950-х и 1960-х годах статьи, посвященные органоидам, часто были сосредоточены на внутриклеточных структурах (органеллах) с такими заголовками, как «Количественный киноанализ активности клеточных органоидов» (Pomerat et al. , 1954) или «Ядерные и цитоплазматические органоиды в живой клетке». (Дьюри и Доэрти, 1954).Слово органоид употреблялось также для обозначения опухолей (Гордиенко, 1964) или аномальных клеточных разрастаний (Wolter, 1967). Во многих работах описаны случаи «органоидного невуса», порока развития кожи, чаще всего на волосистой части головы (Pinkus, 1976). Другие исследователи, по-видимому, использовали органоиды для клеточных кластеров, которые сохраняли структурные характеристики исходной ткани. Например, Шнайдер и др. (1963) в статье под названием «Некоторые необычные наблюдения за органоидными тканями и элементами крови в монослойных культурах» наблюдали органоиды в виде узелков диаметром 1 мм, прикрепленных к колбе или всплывающих после механического и ферментативного переваривания тканей млекопитающих.Однако с 1980 года в работах, посвященных трехмерным культурам, использовалось слово «органоиды».

Вышеупомянутое использование и неправильное использование слова «органоиды», по-видимому, способствовало значительным расхождениям в отношении того, когда поле органоидов начало развиваться. В недавнем обзоре Clevers (2016) говорится, что в период с 1965 по 1985 год наблюдался первоначальный рост исследований органоидов (органоиды, красные квадраты), показывая поразительные 563 статьи в 1980 году. Это число и тот факт, что график показывает внезапное падение в 1985 году удивило нас и привлекло наше внимание.Внимательный взгляд на статьи, на которые ссылаются за этот период, показывает, что поиск в PubMed выявил много статей, которые включали слово «орган», но не обязательно «органоиды». Другой поиск с использованием «органоида», за которым следует тег «текстовое слово», показывает статьи, в которых фактически используется слово «органоид» (синие кружки). Этот поиск в некотором роде также переоценивает количество статей об органоидах, потому что результаты охватывают исследования органоидов в том виде, в каком они были определены до 1980 года, которые включали небольшие структуры в цитоплазме клеток.С 1980 года исследователи начали использовать матрицы, богатые коллагеном и ламинином, для культивирования клеток и органоидов в 3D, и, таким образом, 3D включала органоиды, как обсуждалось выше. На самом деле резкое увеличение количества опубликованных статей об органоидах началось примерно в 2011 году, когда к моменту написания этой статьи в 2016 году было опубликовано 150 статей. Для сравнения мы также показываем поиск со ссылкой на «3D клеточную культуру» (, зеленые треугольники). На самом деле, как мы утверждали, эти два термина являются одним и тем же до тех пор, пока ученые, работающие в этой области, не разделят и не определят различные типы 3D/органоидов, практикуемых в разных лабораториях.(Действительно, М. Дж. Бисселл и Х. Клевер обсуждали эту проблему номенклатуры на встрече под названием «Органоиды», организованной Европейской организацией молекулярной биологии в октябре 2016 года. контекст и архитектура в том, как формируются и поддерживаются ткани и органы.) Культуры органоидов как модели для изучения развития и болезней не могли бы появиться без достижений в том, что сейчас называется трехмерными клеточными культурами.Несмотря на то, что первые статьи, посвященные 3D-культурам/органоидам, были опубликованы в 1960-х годах, количество публикаций начало неуклонно расти с 2003 года, и на момент написания этой статьи в 2016 году было опубликовано 640 публикаций. Напоминаем, что потребовалось около полувека, чтобы признать, что этот способ мышления — это не просто использование техники, но что форма и функция фундаментально переплетены и что, как только организм сформирован, по существу, фенотип доминирует над генотипом.

Количество публикаций в год по органоидам и трехмерным клеточным культурам согласно PubMed. График количества публикаций в год для следующих поисковых запросов PubMed: «органоиды [tw]» показаны красными квадратами, «органоиды [tw]» показаны синими кружками, а «3D-клеточная культура» показана зелеными треугольниками. . Рисунок предоставлен Нилом Смитом.

Адекватная историческая перспектива необходима, чтобы понять, откуда взялось поле, каким мы его знаем, и куда оно движется.Несмотря на более причудливые системы и методы культивирования клеток, мы все еще пытаемся понять тот же основной вопрос, что и исследователи десятилетия назад: какие сигналы управляют формированием и стабильностью дифференцированного состояния, и можем ли мы повторить морфогенез в культуре?

Хронология органоидных и трехмерных клеточных культур

1906–1980: разработка инструментов

Когда на самом деле зародились трехмерные и органоидные культуры ()? Сегодняшние методы являются продуктом того, что началось в 1906 году с техники культивирования ткани висячей капли, разработанной Россом Харрисоном (Harrison, 1906). Еще в 1900 году исследователи хотели воспроизвести органогенез в культуре, и для этого они начали с культивирования фрагментов тканей. В этих новаторских экспериментах Харрисон хотел изучить происхождение нервных волокон. Он взял фрагмент нервного тяжа эмбриона и поместил его на каплю лимфы на покровном стекле, которое было перевернуто и запечатано над полым предметным стеклом (Harrison, 1906). Эта установка обеспечивала адекватную среду для прорастания нервных волокон в среду. Другие исследователи далее адаптировали эту систему для культивирования тканей различного происхождения в течение длительных периодов времени (Burrows, 1910; Carrel and Burrows, 1910; Fell, 1972).К 1914 году Томсон (1914) определил культуры как «контролируемые» и «неконтролируемые» в связи с тем, что в первых сохранялись гистологические и функциональные характеристики исходного органа, тогда как во вторых тканевая организация и функциональность были утрачены. В течение 1920-х годов исследования были сосредоточены на эмбриологии, особенно на морфогенезе конечностей, что привело к развитию пробирочных культур (Strangeways and Fell, 1926) и методу часового стекла, который состоял из вогнутой стеклянной поверхности, удерживающей в центре сгусток плазмы, над которым фрагмент ткани/зачаток органа заделывали и культивировали. Часовое стекло помещали в чашку Петри, покрытую влажной ватой (Fell, Robison, 1929). К 1950-м годам многие другие органы культивировались in vitro, но с ограничениями, налагаемыми этими методами культивирования и методом бумаги для линз, позволяющим культивировать тонкие срезы органов (Trowell, 1954, 1955). В основном исследователи работали над тем, чтобы избежать миграции клеток из образца ткани, пытались оптимизировать условия газообмена и уменьшить некроз. В это же время исследователи начали анализировать регенеративную способность диссоциированных клеток.Еще в 1907 г. Уилсон (1907) показал, что губки могут распадаться на отдельные клетки, способные вновь объединяться в тканеподобные структуры. То же самое относится к кишечнополостным (De Morgan, Drew, 1914) и эмбриональным клеткам амфибий (Holtfreter, 1948). Москона в начале 1950-х разработал метод ферментативного переваривания зачатков конечностей и почек ранних куриных эмбрионов. Он культивировал эти клетки в суспензии и показал, что они способны реагрегировать и восстанавливать структурный паттерн исходной ткани (Москона и Москона, 1952; Москона, 1959). Таким образом, к середине двадцатого века исследователи работали над созданием органов из диссоциированных клеток, хотя в основном в виде суспензии. Зная, что коллаген является универсальным компонентом соединительной ткани, еще в 1932 году Huzella (1932) и его сотрудники экспериментировали с культивированием клеток на волокнистом коллагене, что считается двумерной культурой. Однако именно в 1956 году Роберт Эрманн и Джордж Гей опубликовали метод восстановления коллагена, извлеченного из сухожилий крысиного хвоста, в виде прозрачного геля (Ehrmann and Gey, 1956).В их оригинальной статье было протестировано 29 клеточных линий и тканей, и в большинстве случаев клетки лучше росли и выживали на поверхности коллагена, высушенного на 2D-чашках, чем на стеклянных или плазменных сгустках. В то время Мандл и соавт. (1953) выделили коллагеназу из Clostridium histolyticum , а четыре года спустя Lasfargues (1957) разработал метод, использующий коллагеназу для диссоциации ткани молочной железы взрослых мышей с образованием молочных органоидов (фрагментов протоков), лишенных фибробластов и адипоцитов. Это было обоснованием, которое привело к созданию метода получения миллионов жизнеспособных гепатоцитов Берри и Френдом (1969) путем перфузии печени той же самой коллагеназой.Было показано, что взрослые и эмбриональные гепатоциты, а также другие типы клеток лучше растут на коллагене, но в большинстве случаев клетки теряли свои дифференцировочные функции после одного или нескольких дней культивирования (Bissell and Tilles, 1971). Михалопулос и Пито (1975) определили в 1975 г., что можно вызвать дифференцировку специфических эпителиальных клеток, таких как гепатоциты, путем изменения поведения субстрата, к которому они прикреплены; в частности, эти исследователи наблюдали, что, когда клетки оказывали давление на толстые коллагеновые гели, на которых они росли, гели отделялись и всплывали на поверхность среды.Таким образом, сама по себе флотация создала более благоприятную среду для дифференциации, хотя они не сообщали о механизме. Когда эти исследователи воспроизвели явления, обогнув гели, чтобы они могли плавать, взрослые клетки печени экспрессировали тканеспецифические маркеры дифференцировки. Emerman и Pitelka (1977) выполнили те же экспериментальные условия с диссоциированными нормальными эпителиальными клетками молочной железы, полученными от беременных мышей, в присутствии лактогенных гормонов и показали, что, когда гели заставляли плавать, клетки сохраняли некоторую экспрессию молочного белка в течение месяца в культуре. явление, которое не наблюдалось на пластике, стекле или прикрепленных коллагеновых гелях (Emerman, Pitelka, 1977).

Тем временем в Нью-Джерси Ричард Сварм и его группа работали над характеристикой внеклеточного матрикса хондросаркомы, выясняя взаимодействие между коллагеном, гиалуроновой кислотой и ассоциированными белками. При этом они выделили гель с характеристиками базальной мембраны и назвали его саркомой EHS, используя инициалы трех исследователей — Энгельбрета, Холма и Сварма (Swarm, 1963; Orkin et al., 1977), — которые обнаружили и определили Это. Это было открытие того, что мы знаем сегодня как Matrigel (Kleinman and Martin, 2005), или, точнее, гель, богатый ламинином. В основополагающей статье Orkin et al. (1977), исследователи определили, что коллаген IV является основным компонентом матрикса, выделенного из опухоли. Два года спустя ламинин был охарактеризован, также выделенный из матрикса саркомы EHS (Timpl et al., 1979). Антитела против ламинина определили, что он является составной частью базальных мембран в нормальных тканях. Фибронектин был открыт в 1973 г. в контексте культивируемых клеток (Gahmberg and Hakomori, 1973; Hynes, 1973; Ruoslahti et al., 1973) и, как было установлено, является основным компонентом базальной мембраны (Stenman and Vaheri, 1978).

1980–2016: Понимание механизмов морфогенеза

Описанный выше ранний период подготовил почву для следующей эры в развитии органоидных и трехмерных культур. К 1980 году у исследователей были инструменты (как материальные, так и концептуальные), чтобы начать разгадывать тайны, управляющие тканеспецифической функцией и морфогенезом. В 1981 году Бисселл и соавт. представил статью в Journal of Theoretical Biology , в которой выдвинул гипотезу о том, что ECM регулирует экспрессию генов. Статья под названием «Как внеклеточный матрикс регулирует экспрессию генов» (Bissell et al., 1982) была опубликована в том же году, что и Hall et al. (1982) определили, что если MDCK или нормальные клетки молочной железы мыши, культивированные поверх гелей коллагена I, после слияния покрываются другим слоем коллагена (эпителием в ответ на коллагеновый кокон), клетки перестраиваются с образованием тканеподобных структур, что совместимо с представлением о том, что именно матрица дергает за ниточки. Подобный феномен был описан для образования фолликулов из изолированных клеток щитовидной железы (Chambard et al., 1981). Используя плавающие коллагеновые гели, как описано Emerman and Pitelka (1977), и радиоактивный углерод, Lee et al. (1984, 1985) показали, что вырабатываемое и секретируемое молоко действительно вырабатывается эндогенно. Появились доказательства того, что синтез молочных белков de novo находится под контролем ВКМ (Lee et al., 1984, 1985). Идея о том, что внеклеточный матрикс влияет на экспрессию генов, была дополнительно подтверждена культивированием клеток молочной железы мыши на матрице EHS, где синтез β -казеина наблюдался более чем в 90% клеток вместе с образованием железистых структур (Li et al. ., 1987; Барселлос-Хофф и др., 1989). Было показано, что другие типы клеток, такие как клетки Сертоли крысы, культивируемые либо на матрице EHS, либо внутри нее, претерпевают поразительные изменения в морфологии и секреторной активности (Hadley et al., 1985), как и гепатоциты крысы (Bissell et al., 1987). Schuetz et al., 1988), культуры клеток нервного гребня птиц (Maxwell and Forbes, 1987) и экзокринные ацинарные эпителиальные клетки (Oliver et al., 1987). Аналогичные результаты были получены при культивировании первичных нормальных клеток предстательной железы человека в EHS (Fong et al., 1991). Представление о том, что определенные компоненты матрикса регулируют клеточный морфогенез и дифференцировку, было очевидным; остался вопрос, каков точный механизм? В 1990 г. были получены дополнительные данные, свидетельствующие о том, что компоненты матрикса взаимодействуют с ответными элементами в ядре (Schmidhauser et al., 1990, 1992; Myers et al., 1998). Одновременно Streuli и Bissell (1990) продемонстрировали, что появление молочного белка после флотации коллагеновых гелей сопровождалось образованием эндогенной базальной мембраны в первичных клетках молочной железы. Первые доказательства того, что внеклеточный матрикс посредством прямого взаимодействия с интегринами регулирует экспрессию и дифференцировку генов, появились в 1991 г., когда Streuli et al. (1991) встраивали одиночные клетки молочной железы внутрь богатого ламинином ВКМ. Они показали, что эти клетки способны синтезировать β -казеин, когда присутствует ламинин, но обработка антителом против интегрина β1 предотвратит экспрессию молочного белка. Дальнейшие исследования показали, что чистый ламинин-111, но не другие компоненты ВКМ, направляет экспрессию гена казеина β с помощью репортерных анализов (Streuli et al., 1995) и что участвуют как интегрины α6β4, так и β1 (Muschler et al., 1999).

В качестве накопленных данных, показывающих критическую роль ECM в организации морфогенеза и функции тканей с использованием животных моделей, первичные клетки молочной железы человека и клетки карциномы опухоли, полученные при биопсии, культивировали в матрице EHS, показывая, что эта система культивирования резюмирует поведение роста и структурные и функциональная дифференцировка этих клеток in vivo. В этой работе был разработан метод культивирования, позволяющий отличать нормальные клетки от раковых (Петерсен и др., 1992).

В течение 1990-х годов другие исследователи начали тестировать трехмерные органоидные культуры различного происхождения. Молочная железа не ограничивается только ацинусами. Чтобы проанализировать механизмы, лежащие в основе морфогенеза ветвления молочной железы, мы использовали небольшие кусочки железы девственных мышей, которые мы назвали органоидами, в коллагеновых гелях. Мы показали, что морфогенез зависит от взаимодействия факторов роста, морфогенов и матриксных металлопротеиназ (MMP; Simian et al., 2001). Ранее Монтесано и его сотрудники описали роль фактора роста гепатоцитов и TGF-β в морфогенезе ветвления клонально полученных эпителиальных клеток молочной железы в гелях коллагена I (Soriano et al., 1995, 1996). И epimorphin (Hirai et al., 1992), и MMPs необходимы для морфогенеза, но ни один из них не требуется для пролиферации. Эти результаты предоставили первые прямые доказательства критической роли MMPs в ветвлении в эпителии молочных желез. Исследование 2006 г. показало, что геометрия ткани определяет место морфогенеза ветвления (Nelson et al., 2006). Используя подход микроструктурирования для контроля исходной трехмерной структуры эпителиальных канальцев молочной железы мышей, было установлено, что канальцы диктуют положение ветвей, определяя локальную концентрацию TGF-β, который действует в этом контексте как ингибирующий морфоген.Впоследствии была создана модифицированная система 3D-культивирования первичных органоидов молочной железы мыши с использованием богатого ламинином ECM в 96-луночных планшетах для культивирования органоидов (Fata et al., 2007). Эта новая система, которая позволяет одновременно исследовать несколько видов лечения, позволила авторам установить, что взаимодействие между факторами роста, их пространственной локализацией и продолжительностью их активации, а также нижестоящие эффекторы взаимодействуют и регулируют, инициируются ли ветви молочной железы и/или удлиняются.Для оценки в режиме реального времени клеточного поведения, которое приводит к морфогенезу ветвления, описанная выше система использовалась для проведения долгосрочного конфокального покадрового анализа (Ewald et al. , 2008; Huebner et al., 2016). За поведением как просветных, так и миоэпителиальных клеток следили в реальном времени, показывая, что протоки молочных желез удлиняются посредством определенного типа коллективной эпителиальной миграции без ведущих клеточных расширений или ведущих актин-богатых выпячиваний (Ewald et al., 2008). В целом эти эксперименты показали, что системы 3D-культур являются отличной платформой для раскрытия основных механизмов развития, предоставляя возможность понять контекст, в котором они остаются нормальными или дают сбои и влияют на развитие болезни.

Стволовые клетки в сравнении с органоидами

По мере того, как классическая область органоидов развивалась вместе с трехмерными культурами, в биологии стволовых клеток был достигнут значительный прогресс. В 1981 г. Evans и Kaufman (1981) создали культуры плюрипотентных стволовых клеток из культур in vitro мышиных бластоцитов. В 1996 г. были охарактеризованы первые культуры нейросфер из эмбрионов мышей (Reynolds and Weiss, 1996). В 1998 г. Томсон и соавт. (1998) установили плюрипотентные клеточные линии, полученные из бластоцист человека. В области молочных желез Макс Вича и Габриэла Донту, методологически основываясь на работе Рейнольдса (Reynolds and Weiss, 1996), разработали систему культивирования in vitro, которая позволила размножать стволовые клетки молочной железы человека и назвали их маммосферами (Dontu et al. ., 2003). Они показали ранее гипотетическое существование молочных предшественников, способных дифференцироваться в люминальные, миоэпителиальные или оба клеточных клона. Когда отдельные клетки-предшественники культивировали при низкой плотности в Matrigel, они развивались в функциональные протоковые/ацинарные структуры. Таким образом, стволовые клетки, выделенные либо из эмбрионов, либо из тканей взрослых, могут давать органоиды. В 2009 г. Сато и соавт. (2009) использовали стволовые клетки, которые экспрессируют рецептор 5, связанный с G-белком, содержащий богатые Leu повторы, выделенный из первичной ткани кишечника, и показали, что эти стволовые клетки могут клонально генерировать архитектуру крипта-ворсинка в 3D-культуре. Основываясь на литературе по молочной железе, эти авторы также использовали Matrigel для проведения своих 3D-культур и дополняли их факторами, необходимыми для роста кишечного эпителия. Были созданы органоиды крипт, состоящие из центрального просвета, выстланного ворсинкоподобным эпителием, и нескольких окружающих криптоподобных доменов (Sato et al., 2009). Затем эта методология была успешно использована на культурах желудка (Barker et al., 2010), поджелудочной железы (Huch et al., 2013a), толстой кишки (Sato et al., 2011) и печени (Huch et al., 2013б). Эмбриональные стволовые клетки мыши и человека также использовались для создания органоидов в чашке, таких как поляризованные ткани коры головного мозга (Eiraku et al., 2008) и глазные бокалы (Eiraku et al., 2011; Nakano et al., 2012). Индуцированные плюрипотентные стволовые клетки, прорыв, который произошел в 2007 г., предоставили дополнительный инструмент для изучения морфогенеза (Takahashi et al., 2007; Yu et al., 2007; Park et al., 2008). Ланкастер и др. (2013) разработали метод культивирования, позволяющий получать церебральные органоиды из индуцированных плюрипотентных стволовых клеток, полученных из фибробластов кожи пациента с микроцефалией.В недавнем обзоре Келава и Ланкастер (2016) подчеркнули важность внеклеточного матрикса и микроокружения в недавних достижениях в органоидных культурах тканей мозга, неявно демонстрируя актуальность прошлого века для нынешних достижений. В контексте методологического и экспериментального пути, к которому мы вернулись в этой статье, мы определяем органоид как единицу функции данного органа, которая способна воспроизвести в культуре биологическую структуру, подобную по архитектуре и функциям своему аналогу в виво.Сегодня эта единица имеет множественное происхождение, так как она может исходить из фрагмента ткани, стволовой клетки, расположенной во взрослом органе, эмбриональной стволовой клетки или индуцированной плюрипотентной стволовой клетки. Однако важно помнить, что актуальность или необходимость стволовых клеток для производства органоидов может быть, по меньшей мере, преувеличена. Еще в 1992 году было показано, что даже неотобранные одиночные клетки молочной железы человека способны образовывать красивые клональные ацинусы, которые, конечно же, являются органоидами в трехмерных культурах (Petersen et al., 1992). Еще более поразительно, что отдельные злокачественные клетки молочной железы в нормальных условиях могут образовывать фенотипически нормальные органоиды, которые не образуют опухолей у животных (Weaver et al., 1997; Bissell and Hines, 2011). Мы должны помнить о заявлениях о том, что «стебельность» необходима для образования органоидов. Мораль здесь в том, что при создании правильного контекста одна клетка, полученная из замороженной молочной железы овцы, может стать куклой! Сложность и парадоксы биологии — это и ее красота, которая не перестает манить нас углубиться в поиски ответов.

«Хотя верно то, что полезность системы культивирования увеличивается в зависимости от того, насколько далеко она разработана для имитации ситуации in vivo, мы используем культивируемые клетки, потому что события in vivo на самом деле недостаточно хорошо изучены». Bissell, 1981

Использование силы органоидов: будущие направления

Многие открытия, описанные здесь, были упущены из виду в литературе по оганоидам за последние шесть лет или около того. Многие ученые внесли свой вклад в технологическое развитие систем, позволяющих культивировать органоиды практически из любого мышиного или человеческого органа: тем новичкам, которые публикуются под названием «органоиды», надлежит ознакомиться с историей и достижениями пионеров прошлого, многие из которых больше не с нами.Это позволит глубже понять, что необходимо для решения проблем биологии развития, дифференцировки, механизмов поддержания тканеспецифической функции, старения и рака. Конечно, в этой области еще многое предстоит сделать. В настоящее время разрабатываются новые захватывающие платформы. Достижения в областях биотехнологии, таких как тканевая инженерия, биоматериалы, а также микро- и биофабрикация, заложили основу для разработки устройств, в которых микрофабрикация и микрофлюидная технология сочетаются для поддержки органоидных культур и потоков жидкости, что позволяет проводить высокопроизводительные испытания, экологические исследования. отбор проб и биозондирование (Skardal et al., 2016). Эти технологии в настоящее время изучаются в различных типах тканей и могут оказать значительное влияние на медицину, если будет уделено внимание функциональной дифференциации и сохранению целостности формы и функции. В это время они будут готовы к применению не только при разработке лекарств, но и при лечении пациентов. Будущее улучшит многоорганоидные системы, также называемые «тело на чипе», разрабатывая системы повышенной биологической сложности, в которых несколько органоидов, полученных из разных тканей, объединяются и позволяют интегрироваться (Maschmeyer et al., 2015а,б).

В будущем, безусловно, будет много способов изучения органов в правильном контексте. Называем ли мы эти трехмерные культуры или органоиды, это все равно, что называть розу любым другим именем. Что мы должны иметь в виду, так это то, что суть одна и та же. Область появилась, и ученые теперь понимают, что «размерность» и контекст имеют огромное значение. Эта область и этот образ мышления останутся центральными в разработке новых терапевтических стратегий и развитии персонализированной медицины.При изучении трехмерных культур и органоидов обращение к прошлому позволяет нам понять, куда нам следует двигаться.

Быстрая индукция церебральных органоидов из индуцированных человеком плюрипотентных стволовых клеток с использованием гидрогеля определенного химического состава и среды для культивирования клеток определенного состава | Трансляционная медицина стволовых клеток

Аннотация

Тканевые органоиды — многообещающая технология, которая может ускорить развитие требований общества и Национального института здоровья к точной медицине. Здесь мы описываем надежный и простой метод создания церебральных органоидов (cOrgs) из плюрипотентных стволовых клеток человека с использованием химически определенного гидрогелевого материала и химически определенной культуральной среды. Без использования дополнительных компонентов нейральной индукции cOrgs появлялись на поверхности гидрогеля в течение 10–14 дней, а в условиях статического культивирования к 28 дню достигали размеров до 3 мм в наибольшем измерении. -подобные структуры и признаки раннего кортикогенеза. Иммуноокрашивание и количественная полимеразная цепная реакция с обратной транскрипцией продемонстрировали экспрессию белков и генов, характерную для развития переднего, среднего и заднего мозга.Физиологические исследования показали реакции на глутамат и деполяризацию во многих клетках, соответствующие поведению нейронов. Описанный здесь метод генерации мозговых органоидов облегчает доступ к этой технологии, позволяет масштабировать приложения и обеспечивает потенциальный путь к трансляционным приложениям, где желательны определенные компоненты.

Значение

Тканевые органоиды представляют собой многообещающую технологию со многими потенциальными приложениями, такими как фармацевтические скрининги и разработка моделей заболеваний in vitro, особенно для полигенных состояний человека, когда моделей на животных недостаточно. В этой работе описывается надежный и простой метод получения церебральных органоидов из индуцированных человеком плюрипотентных стволовых клеток с использованием гидрогелевого материала с определенным химическим составом и культуральной среды с определенным химическим составом. Этот метод, благодаря своей простоте и использованию определенных материалов, значительно облегчает доступ к технологии церебральных органоидов, позволяет масштабировать приложения и обеспечивает потенциальный путь к трансляционным приложениям, где желательны определенные компоненты.

Введение

Становится все более очевидным, что трехмерное (3D) культивирование как плюрипотентных, так и дифференцированных клеток приводит к появлению важных возникающих биологических признаков, отсутствующих в традиционном двумерном (2D) культивировании на чашках.Действительно, традиционное представление о клетках, имеющих один и тот же фенотип в 2D и 3D, ошибочно, при этом широко расходящиеся фенотипы развиваются в ответ на их нишевое микроокружение, полярность и взаимодействие внеклеточного матрикса [1]. Особого внимания заслуживает способность плюрипотентных стволовых клеток (ПСК), таких как индуцированные плюрипотентные стволовые клетки (ИПСК) или эмбриональные стволовые клетки (ЭСК), к самоорганизации в различных условиях с образованием сложных тканевых структур, повторяющих важные особенности развития и взрослой жизни. структурно-функциональные характеристики характерны для каждой конкретной ткани [2–4].Клеточная и структурная сложность этих органоидов и их соответствие структуре соответствующих тканей in vivo делают их особенно интересными в качестве легкодоступных моделей in vitro для широкого круга физиологических и метаболических исследований, для фармацевтических скринингов и в качестве моделей патологических состояний человека. . Кроме того, если бы методы масштабирования для создания органоидов были легко доступны и соответствовали современным передовым методам производства, клетки из органоидов могли бы потенциально использоваться в терапевтических целях [5, 6].

В настоящее время существует особая потребность в разработке основанных на органоидах моделей заболеваний in vitro для неврологических нарушений развития человека, которые трудно воспроизвести на экспериментальных животных моделях, и для нейродегенеративных расстройств со сложной генетикой (например, болезнь Альцгеймера, болезнь Паркинсона и адренолейкодистрофия). В этих условиях гены, генные модификаторы и факторы окружающей среды вносят свой вклад в заболевание, и поэтому их нельзя легко свести к линейным экспериментам, которые прояснили бы механизм действия.Таким образом, церебральные органоиды (cOrgs), полученные из иПСК, специфичных для пациентов и заболеваний, могут быть уникальной возможностью для получения новых знаний, ведущих к клинически значимым вмешательствам. В связи с этим недавно было описано средство для создания относительно больших и сложных cOrgs [5]. В этом отчете было показано, что cOrgs содержат нейроны и структурные устройства, представляющие несколько различных областей мозга в пределах отдельных органоидов, и, кроме того, продемонстрировали черты нормального развития и структуры человеческого мозга.Полезность этого подхода была элегантно продемонстрирована созданием ИПСК у пациентов с микроцефалией, связанной с нарушением развития нервной системы, и последующим производством cOrgs, которые проявляли специфические для заболевания особенности этого состояния. Таким образом, исследование продемонстрировало потенциал для создания доступных in vitro моделей неврологических заболеваний человека с использованием врожденной способности плюрипотентных стволовых клеток дифференцироваться в нервные линии и самоорганизовываться таким образом, который повторяет нормальное (или аномальное) развитие.Точно так же, используя ESC, Kadoshima et al. также недавно сообщалось о генерации удивительно сложных cOrgs, которые демонстрировали спонтанное развитие внутрикортикальной полярности, изогнутой морфологии и сложных разделений зон, которые повторяли нормальное развитие человеческого мозга [6]. Таким образом, эти отчеты подтвердили сложность, достижимую в cOrgs, полученных из PSC, и их применимость к приложениям для моделирования заболеваний in vitro.

Мы сосредоточены на создании модели болезни in vitro для адренолейкодистрофии (ALD), которая в субпопуляции пораженных мальчиков приводит к разрушительному, прогрессирующему, дегенеративному неврологическому состоянию. ALD представляет собой Х-сцепленное пероксисомальное заболевание, поражающее нервную систему, кору надпочечников и яички и возникающее в результате мутаций в гене ABCD1 [7]. Эта мутация может привести к нескольким фенотипам, включая адреномиелоневропатию, церебральную взрослую форму, изолированную болезнь Аддисона и церебральную детскую адренолейкодистрофию (ccALD) — наиболее тяжелую форму ALD, характеризующуюся быстрым неврологическим снижением вследствие демиелинизации в белом веществе головного мозга [7]. Более 643 мутаций в гене ABCD1 связаны с ALD; однако корреляции между конкретными мутациями и фенотипами ALD остаются неуловимыми, что означает, что могут быть задействованы дополнительные генетические, эпигенетические и/или экологические модификаторы [8].В настоящее время трансплантация гемопоэтических клеток является единственным методом лечения, способным стабилизировать ccALD, при этом раннее лечение имеет решающее значение для оптимального долгосрочного результата [9]. Таким образом, создание механизмов раннего скрининга для выявления пациентов с мутациями ALD с фенотипом ccALD является огромной клинической потребностью, которая еще не удовлетворяется с помощью изучаемых в настоящее время методов, таких как повышенный уровень цитокинов в спинномозговой жидкости (CSF) [10], диффузионно-тензорная томография головного мозга [11] и активность хитотриозидазы в плазме и спинномозговой жидкости [12].cOrgs, полученные из иПСК пациентов с ALD, могут служить мощной моделью in vitro для изучения экспрессии генов, эпигенетики и эффектов факторов окружающей среды, потенциально освещая механизмы действия и приводя к клинически значимым вмешательствам, а также потенциальные биомаркеры, которые можно использовать в ранний скрининг ccALD.

Хотя метод, использованный Lancaster et al. [5] для создания cOrgs было высокоэффективным, имеет высокую степень сложности в выполнении, требует дорогостоящих компонентов культуры клеток нейральной индукции и предполагает использование ксенобиотического материала внеклеточного матрикса. Здесь мы сообщаем о нашей разработке нового метода создания cOrgs, который решает эти проблемы. Этот метод надежен, прост, не требует компонентов нервной индукции, помимо тех, которые включены в среду Essential 8 (E8), и использует гидрогель определенного химического состава, называемый Cell-Mate3D. Гистологический, иммуногистохимический анализ и анализ экспрессии генов в сочетании с исследованиями кальциевых сигналов подтвердили фенотип церебральных органоидов, включая доказательства спецификации переднего, среднего и заднего мозга.В целом, эта система может способствовать как фундаментальным исследованиям, так и трансляционным приложениям, где желательны определенные компоненты.

Материалы и методы

Приготовление сухой смеси Cell-Mate3D

Гиалуронан натрия (HA-Na) (исходная молекулярная масса [MW] = 1600–1800 кДа; индекс полидисперсности [PDI] < 4,0) и хитозан (CT), протонированный муравьиной кислотой (CT Nh4+ ) (исходная молекулярная масса = 400– 600 кДа; PDI <3,0). Гиалуронан (HA; Lifecore Biomedical, Chaska, MN, http://www.lifecore.com) использовали в готовом виде. CT (NovaMatrix; FMC Health and Nutrition, Princeton, NJ, http://www.fmcbiopolymer.com) получали в качестве основания при степени деацетилирования 85–87,5% и протонировали муравьиной кислотой до 100% доступных аминогрупп. . Протонированную основу хитозана готовили в виде 0,1% (масса/объем) раствора, стерилизовали фильтрованием (0,2 мкм) и асептически разливали в стерильные флаконы объемом 120 мл. Раствор СТ лиофилизировали, превращали в маленькие листочки и механически смешивали с мелкими частицами ГК-Na при массовом отношении ГК-Na = 1.0: СТ = 1,44; несущий коэффициент заряда CT-n + = 2,0: HA-Na-n = 1,0.

Подготовка жидкости для гидратации Cell-Mate3D

Жидкость для гидратации была получена путем приготовления раствора, содержащего 37,5% 10% LMD декстрана 40 в 5% растворе для инъекций декстрозы класса USP (Pfizer, New York, NY, http://www. pfizer.com) и 51,75% 0,9% раствор хлорида натрия для инъекций марки USP (Pfizer). pH доводили до 6,5 раствором 0,6% динатриевой соли глицеринфосфата (Sigma-Aldrich, St.Louis, MO, http://www.sigmaaldrich.com), разбавляли стерильной водой для инъекций класса USP (Pfizer), а оставшийся объем состоял из стерильной воды для инъекций класса USP (Pfizer).

Подготовка кокона Cell-Mate3D

Сухую смесь HA-CT доводили до комнатной температуры и перемешивали энергичным встряхиванием. Сухую смесь гидратировали путем пипетирования клеточной суспензии в жидкости для гидратации при постоянном перемешивании. Всего для гидратации 35 использовали 500 мкл клеточной суспензии, содержащей 19 миллионов иПСК (в виде целых колоний).5 мг сухой смеси. Нагруженный клетками матрикс переносили в цилиндр шприца объемом 1 мл путем центрифугирования при 1000 g через воронку. В результате этого процесса был получен цилиндр объемом от 400 до 500 мкл со встроенными клетками матрикса, который затем выдавливали из цилиндра шприца, разрезали на секции по 100 мкл и помещали в культуральную среду E8 (Invitrogen, Carlsbad, CA, http:// www. invitrogen.com).

Получение и культивирование ИПСК

Использовали

нормальные линии иПСК ccALD, описанные в таблице 1.Клетки получали на облученных культурах MEF и переносили на Matrigel (Corning, Corning, NY, http://www.corning.com) и среду E8 (Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher. com) для дополнительного расширения без фидера. Клеточные линии были перепрограммированы с использованием Cytotune IPS 1.0 (WT2, WT3 и WT4; Thermo Fisher Scientific Life Sciences) или Cytotune 2.0 (ALD3; Thermo Fisher Scientific Life Sciences) или были получены с использованием ретровирусной доставки генов с использованием факторов перепрограммирования Oct4, Sox2. , Klf4 и c-Myc (WT1, ALD1 и ALD2).

Таблица 1

Линии иПСК и методы получения

Таблица 1

Линии иПСК и методы получения

Культура клеток в Cell-Mate3D и индукция церебральных органоидов

матрицы, залитые ИПСК, культивировали в среде E8 (Thermo Fisher Scientific Life Sciences), среду меняли каждые 3–4 дня. Органоиды спонтанно появлялись в матриксе и выделялись из матрикса между 10-м днем ​​(D10) и D14.

Выделение, экспрессия и анализ РНК

Органоиды

собирали и лизировали в буфере RLT (Qiagen, Venlo, Нидерланды, http://www.qiagen.com) и хранили при температуре -80°C до обработки. РНК выделяли из клеточных лизатов с использованием набора RNA mini plus (Qiagen) в соответствии с инструкциями производителя. Внеколоночную обработку ДНКазой проводили с использованием Turbo DNase (Thermo Fisher Scientific Life Sciences) в соответствии с инструкциями производителя. кДНК синтезировали с использованием обратной транскриптазы Superscript III (Thermo Fisher Scientific Life Sciences) в соответствии с инструкциями производителя. Каждая полимеразная цепная реакция (ПЦР) состояла из 20 нг кДНК, 6 мкл буфера для реакции ПЦР 1× SYBR Green Mix (Thermo Fisher Scientific Life Sciences) и 100 нМ праймеров (Integrated DNA Technologies, Coralville, IA, https:// www. idtdna.com; дополнительную онлайн-таблицу 1) плюс воду, не содержащую РНКазы, чтобы получить общий объем 12 мкл. Все реакции проводили в трех экземплярах на мастер-циклере Realplex (Eppendorf, Гамбург, Германия, https://www.eppendorf.com) по следующей программе: 50°C в течение 2 минут, 95°C в течение 10 минут, 40 циклов 95°C в течение 15 секунд и 59°C в течение 60 секунд, затем 95°C в течение 15 секунд, 59°C в течение 20 секунд, 20-минутное повышение до 95°C и 95°C в течение 15 секунд. Результаты экспрессии гена рассчитывали, используя экспрессию относительно глицеральдегид-3-фосфатдегидрогеназы (GAPDH), где ΔCt = (интересующий ген Ct — Ct GAPDH).Затем Δ (ΔCt) рассчитывали относительно D0 соответствующей РНК линии IPS, где Δ (ΔCt) = ΔCt ген — ΔCt контроль. Затем рассчитывали кратность изменения относительно контроля для каждого гена, где кратность изменения = 2 -Δ(ΔCt) . Образцы со значением Ct более 35 считались отсутствием экспрессии гена.

Испытание механических свойств

Механические свойства коконов Cell-Mate3D с клетками и без них измеряли с помощью реометра AR-G2 от TA Instruments (Schaumburg, IL, http://www. tainstruments.com). Коконы готовили из 35,5 мг сухой смеси, гидратированной 500 мкл гидратирующей жидкости при постоянном перемешивании. Нагруженные клетками коконы были приготовлены с 19 миллионами иПСК WT1 в жидкости для гидратации. После гидратации гели формировали в цилиндрические диски диаметром 16 мм и высотой 3 мм и помещали в 5 мл питательной среды Е8 на 24 часа. Коконы переносили на пластину Пельтье и обрезали до 8-мм параллельной пластины с зазором 2,2 мм. Развертки деформации выполнялись с постоянной частотой для выбора процентной деформации в пределах линейного вязкоупругого режима матрицы.Затем выполняли свипирование по частоте от 100 до 0,1 рад/сек с деформацией 1% при 25°C. Модуль Юнга E был рассчитан по следующей формуле: E = 3 × sqrt(G’ 2 + G» 2 ), где значения G’, модуля накопления и G », модуль потерь, оба были включены в расчеты по 1 рад/сек. Данные представлены как среднее значение ± SE из шести независимых экспериментов, проведенных в разные дни, каждый с одной повторностью ( n = 6). Статистический анализ теста Стьюдента t использовали для сравнения E для гелей с клетками и без них.

Гистология и иммуногистохимия

Образцы

помещали в 10% нейтральный забуференный раствор формалина и фиксировали при комнатной температуре в течение 3,5 часов. После фиксации образцы переносили в 70% раствор этанола до обработки для обычной заливки в парафин. Затем образцы делали срезы толщиной 4 мкм и окрашивали гематоксилином и эозином.Для иммуногистохимического окрашивания нарезали срезы размером 4 мкм, депарафинизировали и регидратировали с последующей инкубацией с 3% перекисью водорода для подавления активности эндогенной пероксидазы и 15 минут в бессывороточном белковом блоке (DAKO, Glostrup, Дания, http://www. .dako.com). Затем срезы подвергали соответствующим методам извлечения антигена (при необходимости) и инкубировали с первичным антителом при комнатной температуре в течение 60 минут (дополнительная онлайн-таблица 2). Окрашенные срезы исследовали с использованием микроскопа Olympus BH-2 (Olympus America, Center Valley, PA, http://www.olympusamerica.com) и изображения с помощью цифровой камеры SPOT Insight 4 с мегавыборкой и программного обеспечения SPOT Advanced (Diagnostic Instruments Inc., Sterling Heights, MI, http://www.spotimaging.com).

Криосрезы

Органоиды

собирали в дни 14 и 28, дважды промывали фосфатно-солевым буфером (PBS; Sigma-Aldrich) и помещали в 10% формалин при 4°C на ночь. Образцы промывали PBS и помещали в 30%-ный раствор сахарозы на ночь при 4°C. Затем органоиды помещали в форму и большую часть сахарозы удаляли промокательной бумагой.Образцы блокировали в смеси с оптимальной температурой резки (Tissue-Tek; Sakura Finetek, AV Alphen aan Den Rijn, Нидерланды, http://www.sakura.eu) в течение 20 минут в сухом льду. Срезы толщиной 8 мкм вырезали с использованием криостата модели CM3050 S (Leica Biosystems, Wetzlar, Germany, http://www2. leicabiosystems.com). Срезы помещали на предметные стекла superfrost plus (Thermo Fisher Scientific, Waltham, MA, https://www.thermofisher.com) и хранили при температуре -20°C перед обработкой для иммуноцитохимии.

Иммуноцитохимия

предметных стекла помещали в PBS (Sigma-Aldrich), содержащий 0,1% Tween-20 (Sigma-Aldrich) (PBS-T), на 10 минут. Срезы блокировали 1% бычьим сывороточным альбумином (Sigma-Aldrich) и 0,1% Tween-20 в PBS в течение 30 минут при комнатной температуре. Срезы инкубировали с первичными антителами, разведенными в блокирующем буфере, при 4°С в течение ночи. Срезы трижды промывали PBS-T по 10 минут каждый. Срезы инкубировали со вторичным антителом (Alexa Fluor 488 или 555) в блокирующем буфере в течение 30 минут при комнатной температуре.Все используемые антитела и разведения подробно описаны в дополнительной онлайн-таблице 1. Образцы промывали PBS-T, а предметные стекла помещали в среду для заливки Vectashield, содержащую 4′,6-диамидино-2-фенилиндол (Vector Laboratories, Burlingame, CA, http: //vectorlabs. com). Окрашенные срезы исследовали с помощью конфокального микроскопа Bio-Rad (Bio-Rad Laboratories, Hercules, CA, http://www.bio-rad.com).

Визуализация общей пробы

изображения Gross были получены с использованием стереоскопа SMZ1500 (Nikon, Chiyoda, Токио, Япония, http://www.nikon.com) и камеру EVOLT E-300 (Olympus, Синдзюку, Токио, http://www.olympus-global.com).

Визуализация кальция

Органоиды

инкубировали в 10 мкМ Fluo-3 AM с PowerLoad (Thermo Fisher Scientific Life Sciences) в культуральной среде при 37°C в течение 1 часа. Органоиды помещали в перфузионную камеру, стабилизировали с помощью полиэфирной сетки и непрерывно заливали внеклеточной средой, содержащей 146 мМ NaCl, 3 мМ KCl, 2 мМ CaCl 2 , 2 мМ MgCl 2 , 1.25 мМ NaH 2 PO 4 , 10 мМ HEPES, 10 мМ глюкозы и 1 мМ пирувата натрия (pH 7,4). Повышенные растворы калия содержали 50 мМ KCl и 99 мМ NaCl, а также другие компоненты, перечисленные выше. Замороженные исходные растворы 100 мМ глутамата разбавляли в культуральной среде в 1000 раз в день эксперимента, чтобы получить конечную концентрацию 100 мкМ. Все химикаты были приобретены у Sigma-Aldrich. Оба раствора глутамата или калия с повышенным содержанием наносили на 30–90 секунд через суперфузат с использованием четырехходового клапана для переключения растворов.

Перфузионную камеру помещали на предметный столик инвертированного микроскопа (Olympus модель IX-70), оснащенного масляным объективом ×40, флуоресцентной лампой Λ DG-4 и переключателем длины волны, а также камерой Hamamatsu Orca E2 (Hamamatsu Photonics, Город Хамамацу, Япония, http://www.hamamatsu.com). MetaFluor (Molecular Devices, Саннивейл, Калифорния, http://www.молекулярное устройство. время с использованием графического программного обеспечения GraphPad Prism (GraphPad Software Inc., Ла-Хойя, Калифорния, http://www.graphpad.com).

Объект cOrg, использованный для визуализации кальция, был получен из клеточной линии WT1 на D49. Эту cOrg культивировали в среде E8 в течение 33 дней и в среде для нейральной индукции, содержащей смесь 1:1 DMEM/F12 (Thermo Fisher Scientific Life Sciences) и нейробазала, 1:200 N2 (Thermo Fisher Scientific Life Sciences), 1:100. B27 (Thermo Fisher Scientific Life Sciences), 3,5 мкл 2-меркаптоэтанола на литр (Thermo Fisher Scientific Life Sciences), 1:4000 инсулина (Sigma-Aldrich), 1:100 л-глютамина (Thermo Fisher Scientific Life Sciences) и 1 : 200 минимальных незаменимых средних заменимых аминокислот (Thermo Fisher Scientific Life Sciences) в течение дополнительных 18 дней.

Статистический анализ

Переменная результата для количественных данных полимеразной цепной реакции с обратной транскрипцией представляла собой ΔΔCt, умноженное на 1000. Средние значения и стандартные отклонения были рассчитаны и представлены в каждый момент времени для каждого гена в каждой клеточной линии (дополнительные онлайн-таблицы 3–7). Дисперсионный анализ. F-тесты были выполнены для сравнения средних значений в D0 и D14, D0 и D28 и D14 и D28. Поскольку было выполнено несколько сравнений, поправки Тьюки-Крамера для значений p были сделаны для учета множественного тестирования в пределах признака.Весь анализ был выполнен с использованием программного обеспечения для статистического анализа (версия 9.3; SAS Institute Inc., Кэри, Северная Каролина, http://www.sas.com). Двустороннее значение p <0,05 считалось статистически значимым.

Результаты

Формирование встроенного гидрогеля iPSC Cell-Mate3D

Гидрогели

Cell-Mate3D, залитые ИПСК, были сформированы, как описано ранее [13], за исключением того, что здесь использовалась гидратирующая жидкость определенного химического состава, состоящая из забуференного декстрана.Вкратце, когда клетки, суспендированные в жидкости для гидратации, добавляли к сухой смеси гиалуроновой кислоты и хитозана при сильном перемешивании (встряхивании), мгновенно образовывался гель посредством полиэлектролитического комплексообразования между HA COO- и CT Nh4+ . Затем из геля формовали цилиндр, помещая его в воронкообразный корпус шприца с последующим кратким центрифугированием. Его выдавливали из цилиндра шприца, разрезали на несколько срезов по 100 мкл и культивировали в среде Е8 (Thermo Fisher Scientific Life Sciences).ИПСК внедряли в виде больших неразрушенных колоний.

Механические свойства гидрогелей Cell-Mate3D

Осцилляторная реология была использована для характеристики механических свойств Cell-Mate3D с ИПСК и без них. Образцы Cell-Mate3D имели модуль упругости G’ выше, чем модуль потерь G», что указывает на образование геля. Расчетный модуль Юнга Cell-Mate3D с иПСК и без них составил 9 838 ± 694 Па и 10 111 ± 1 673 Па соответственно, и между этими двумя измерениями не было статистически значимой разницы ( p > .05).

Гистологический анализ

В наших первоначальных экспериментах с использованием линии иПСК человека WT4, культивируемых в среде E8 в гидрогелях Cell-Mate3D, мы отметили появление поверхностных структур на конструкциях между D10 и D14. На этой стадии структуры были размером примерно до 1 мм в наибольшем размере и имели приблизительно сферическую форму. Гистологическое исследование этих структур выявило морфологию нейронов, включая образование нейронных розеток и других нейроэпителиальных структур, соответствующих развитию cOrgs (рис.1). Используя иммуногистохимическое окрашивание, мы дополнительно оценили эти структуры на 14-й день и обнаружили, что большинство клеток были сильно положительными по β-3 тубулину, Sox2 (ядерному) и нестину (цитоплазматическому), что согласуется с нейральной дифференцировкой (рис. 1). Отмечая заметное сходство этих структур с cOrgs, о которых недавно сообщили Lancaster et al. [5], мы предприняли дальнейшие эксперименты, чтобы определить, является ли это генерализованным явлением среди различных линий иПСК.

Рисунок 1

Внешний вид, гистология и иммунофлуоресценция церебральных органоидов (cOrgs), полученных из индуцированных человеком плюрипотентных стволовых клеток (hiPSC), встроенных в матрицу Cell-Mate3D и культивированных в среде E8. (A): Макроскопическая фотография церебрального органоида на 28-й день (стрелки), прикрепленная к матрице. Масштабная линейка = 1 мм. (B): Нервные розетки (стрелки) в cOrg, полученные из линии плюрипотентных стволовых клеток, индуцированной WT3, на 14-й день (D14). Окраска гематоксилином и эозином. Масштабная линейка = 50 мкм. (C): Структура, похожая на нервную трубку, в D14 cOrg, полученная из линии ALD1 hiPSC. Окраска гематоксилином и эозином. Масштабная линейка = 50 мкм. (D): D14 cOrg, полученный из линии ALD1 hiPSC и иммуногистохимически окрашенный на β-3 тубулин.Масштабная линейка = 1236 мкм. (E): Иммунофлуоресцентное окрашивание, показывающее совместную локализацию Sox1 (красный) и нестина (зеленый) в клетке с нервной трубчатой ​​структурой и окружающей области в cOrg из линии hiPSC WT1 на D14. Масштабная линейка = 60 мкм. (F): Иммунофлуоресцентное окрашивание, показывающее колокализацию Sox2 (зеленый) и нестина (красный) в нервных розетках в cOrg из линии ALD2 hiPSC на 14 день. Масштабная линейка = 18 мкм. (G-I): Иммунофлуоресцентное окрашивание нейрокортикоподобных областей в D28 cOrgs для Tbr1 (ALD3) (G) , даблкортина (ALD1) (H) и рилина (WT3) (I) .Масштабные линейки = 30 мкм (G) и 15 мкм (H, I) .

Рисунок 1

Внешний вид, гистология и иммунофлуоресценция церебральных органоидов (cOrgs), полученных из индуцированных человеком плюрипотентных стволовых клеток (hiPSC), встроенных в матрицу Cell-Mate3D и культивированных в среде E8. (A): Макроскопическая фотография церебрального органоида на 28-й день (стрелки), прикрепленная к матрице. Масштабная линейка = 1 мм. (B): Нервные розетки (стрелки) в cOrg, полученные из линии плюрипотентных стволовых клеток, индуцированной WT3, на 14-й день (D14).Окраска гематоксилином и эозином. Масштабная линейка = 50 мкм. (C): Структура, похожая на нервную трубку, в D14 cOrg, полученная из линии ALD1 hiPSC. Окраска гематоксилином и эозином. Масштабная линейка = 50 мкм. (D): D14 cOrg, полученный из линии ALD1 hiPSC и иммуногистохимически окрашенный на β-3 тубулин. Масштабная линейка = 1236 мкм. (E): Иммунофлуоресцентное окрашивание, показывающее совместную локализацию Sox1 (красный) и нестина (зеленый) в клетке с нервной трубчатой ​​структурой и окружающей области в cOrg из линии hiPSC WT1 на D14.Масштабная линейка = 60 мкм. (F): Иммунофлуоресцентное окрашивание, показывающее колокализацию Sox2 (зеленый) и нестина (красный) в нервных розетках в cOrg из линии ALD2 hiPSC на 14 день. Масштабная линейка = 18 мкм. (G-I): Иммунофлуоресцентное окрашивание нейрокортикоподобных областей в D28 cOrgs для Tbr1 (ALD3) (G) , даблкортина (ALD1) (H) и рилина (WT3) (I) . Масштабные линейки = 30 мкм (G) и 15 мкм (H, I) .

В этой системе были протестированы шесть дополнительных линий ИПСК человека (таблица 1), в том числе три, полученные от здоровых контрольных субъектов, и три, полученные от пациентов с ccALD. Все продемонстрировали образование cOrgs, которые обычно были видны на D10. Гистологический и иммуногистохимический анализ cOrgs D14 во всех случаях показал иммунореактивность к β-3 тубулину, Sox2 и нестину (рис. 2), как видно из исходных cOrgs, полученных из клеточной линии WT4. Кроме того, маркер нейральных предшественников переднего мозга Pax6 часто обнаруживается в рыхлых скоплениях клеток (Fig. 2). Кроме того, замороженные срезы cOrgs, окрашенные как для Sox1, так и для нестина, и парафиновые срезы, окрашенные как для Sox2, так и для нестина, часто обнаруживали клетки с двойной меткой, соответствующие нейральным стволовым клеткам/клеткам-предшественникам (рис.1). Многие клетки в cOrgs, полученные из всех линий iPSC, были положительными в отношении маркера ядерного рецептора среднего мозга, родственного 1 (Nurr1). Кроме того, небольшие скопления клеток во многих органоидах из всех линий иПСК также были положительными по тирозингидроксилазе и имели дендритную морфологию, соответствующую образованию дофаминергических нейронов (рис. 2). Реже клетки, экспрессирующие olig2, маркер клеток-предшественников олигодендроцитов и моторных нейронов, были обнаружены в некоторых cOrgs из всех клеточных линий (данные не показаны).

Рисунок 2

Репрезентативные панели иммуногистохимического окрашивания нейральных маркеров на 14-й день церебральных органоидов (cOrgs), полученных из контрольных (WT1 и WT3) или пациентов с церебральной детской адренолейкодистрофией (ALD2) индуцированных человеком плюрипотентных стволовых клеток (hiPSCs). Большинство клеток во всех cOrgs, полученных из hiPSC контрольной группы или пациентов с адренолейкодистрофией (ALD), окрашены на β-3 тубулин, Sox2 и нестин. Более локализованная экспрессия Nurr1 и Pax6 наблюдалась в большинстве cOrgs.Положительные по тирозингидроксилазе клетки, которые часто демонстрировали нейроноподобные отростки, были обнаружены в рыхлых группах во многих cOrgs. Шкала баров = 50 мкм. Специфическое иммуногистохимическое окрашивание (коричневое окрашивание) ядерным окрашиванием гематоксилином (синее). Сокращение: Nurr1, связанный с ядерным рецептором. клетки (hiPSCs).Большинство клеток во всех cOrgs, полученных из hiPSC контрольной группы или пациентов с адренолейкодистрофией (ALD), окрашены на β-3 тубулин, Sox2 и нестин. Более локализованная экспрессия Nurr1 и Pax6 наблюдалась в большинстве cOrgs. Положительные по тирозингидроксилазе клетки, которые часто демонстрировали нейроноподобные отростки, были обнаружены в рыхлых группах во многих cOrgs. Шкала баров = 50 мкм. Специфическое иммуногистохимическое окрашивание (коричневое окрашивание) ядерным окрашиванием гематоксилином (синее). Аббревиатура: Nurr1, связанный с ядерным рецептором 1.

Дополнительные эксперименты были проведены до D28 на всех клеточных линиях ( n = 7). cOrgs D28 были гистологически и иммуногистохимически похожи на таковые на D14, но, как правило, были крупнее, причем некоторые из них достигали 2,5–3,0 мм в наибольшем измерении (рис. 1), и они часто демонстрировали повышенную сложность с дополнительными узелками, отпочковывающимися от исходного органоида. Кроме того, были также обнаружены компактные области, демонстрирующие раннее расслоение клеток вблизи поверхностей cOrgs, которые показали клетки, меченные Т-боксом мозга 1 (Tbr1), даблкортином (Dcx) или рилином (рис.1), что указывает на ранние стадии кортикогенеза. Некоторые из cOrgs также полностью отделялись от поверхности гидрогеля и свободно плавали в планшете для культивирования клеток. Одновременно с увеличением размера D28 cOrgs наблюдалась повышенная гибель клеток в центральных областях многих органоидов, на что указывал пикноз ядер, кариорексис и фрагментация клеток.

Экспрессия генов в церебральных органоидах

Для дальнейшей характеристики развития cOrg мы проанализировали экспрессию переднего мозга (Forkhead box G1 [ FoxG1 ] и гомеобокс 3 sine oculis [ SIX3 ]), заднего мозга (реакция раннего роста 2 [ EGR2 ] и островка 1 [ ISL1 ]) и маркеры кортикогенеза ( DCX и Reelin ) в недифференцированных ИПСК, D14 cOrgs и D28 cOrgs, полученных из двух контрольных линий и двух линий hiPSC пациентов с ALD (фиг. 3; дополнительные онлайн-таблицы 3–7). Оба маркера переднего мозга были значительно активизированы в cOrgs по сравнению с недифференцированными иПСК во всех четырех клеточных линиях по отдельности, и комбинированный анализ показал значительно повышенную экспрессию в обе временные точки для FOXG ( p <0,0004) или только для SIX3 . D14 ( p = 0,0001). Оба маркера заднего мозга также экспрессировались в cOrgs, полученных из всех клеточных линий, и, за исключением EGR2 в клеточной линии WT1, экспрессировались на значительном уровне ( p <.05) выше недифференцированных иПСК в одну или обе временные точки. Однако из-за различий в экспрессии EGR2 среди клеточных линий различия в экспрессии не достигали значимости в общем анализе ( p > 0,30). Экспрессия ISL1 была значительно выше экспрессии в недифференцированных иПСК в комбинированном анализе на D28 ( p <0,02). Оба маркера кортикогенеза были экспрессированы и значительно активировались во всех клеточных линиях выше недифференцированных иПСК. Экспрессия DCX в общем анализе была значительно повышена как в день 14 ( p < 0,02), так и в день 28 ( p < 0,0001), а экспрессия Reelin в общем анализе была значительно повышена в день 28 ( p < 0,0001).

Рисунок 3

Количественный анализ полимеразной цепной реакции с обратной транскрипцией экспрессии генов маркеров переднего и заднего мозга и кортикогенеза в недифференцированных индуцированных человеком плюрипотентных стволовых клетках, церебральных органоидах на 14-й день (cOrgs) и cOrgs на 28-й день.Указанные значения являются средними ± SD. Приведены данные по экспрессии генов для каждой отдельной клеточной линии в D0 (недифференцированная индуцированная плюрипотентная стволовая клетка), D14 и D28, а «общий» анализ включал объединенные данные по всем четырем клеточным линиям (WT1, WT3, ALD1 и ALD3). в каждый момент времени. Сокращения: DCX, даблкортин; EGR2, ранняя реакция роста 2; FOXG1, вилочная коробка G1; ISL2, островок 2; SIX3, sine oculis гомеобокс 3.

Рисунок 3

Количественный анализ полимеразной цепной реакции с обратной транскрипцией экспрессии генов маркеров переднего и заднего мозга и кортикогенеза в недифференцированных плюрипотентных стволовых клетках, индуцированных человеком, 14-й день церебральных органоидов (cOrgs) и день 28 корр.Указанные значения являются средними ± SD. Приведены данные по экспрессии генов для каждой отдельной клеточной линии в D0 (недифференцированная индуцированная плюрипотентная стволовая клетка), D14 и D28, а «общий» анализ включал объединенные данные по всем четырем клеточным линиям (WT1, WT3, ALD1 и ALD3). в каждый момент времени. Сокращения: DCX, даблкортин; EGR2, ранняя реакция роста 2; FOXG1, вилочная коробка G1; ISL2, островок 2; SIX3, sine oculis homeobox 3.

Физиологическая оценка церебральных органоидов

Для оценки функциональных характеристик предполагаемых нейронов в cOrgs с использованием индикатора кальция Fluo-3 исследовали реакцию на деполяризацию (вызванную повышением внеклеточного калия) и на аппликацию возбуждающего нейротрансмиттера глутамата. Повышение внутриклеточной концентрации кальция в ответ на суперфузию с 50 мМ K наблюдали в трех различных cOrgs, происходящих от WT4. Один cOrg, который культивировали в течение 33 дней в среде E8 и 18 дней в нейробазальной среде, показал до 10–20 клеток, отвечающих на поле (рис. 4). В этой же cOrg все клетки в трех разных полях также реагировали на 100 мкМ глутамата увеличением концентрации внутриклеточного кальция (рис. 4). Эти ответы согласуются с ожидаемыми для функционирующих нейронов.

Рисунок 4

Физиологический ответ клеток внутри церебрального органоида, полученного из контрольной индуцированной человеком линии плюрипотентных стволовых клеток WT1, на глутамат и калий (K + ). Концентрация внутриклеточного кальция увеличивалась при применении ванны с глутаматом (100 мкМ) и повышенной концентрации калия (50 К; 50 мМ). Вверху: изображения в искусственных цветах, показывающие интенсивность флуоресценции Fluo-3 до (1), на пике (2) и после восстановления (3) реакции на глутамат. Изображение справа представляет собой изображение того же поля в инфракрасном свете. Масштабная линейка = 10 мкм. Внизу: график зависимости интенсивности флуоресценции от времени, показывающий флуоресценцию Fluo-3 в области, обозначенной кружком на изображениях выше. Глутамат и повышенное содержание калия применяли в ванне в течение времени, указанного черными полосами. Сокращение: Glut, глутамат.

Рисунок 4

Физиологический ответ клеток внутри церебрального органоида, полученного из контрольной индуцированной человеком линии плюрипотентных стволовых клеток WT1, на глутамат и калий (K + ).Концентрация внутриклеточного кальция увеличивалась при применении ванны с глутаматом (100 мкМ) и повышенной концентрации калия (50 К; 50 мМ). Вверху: изображения в искусственных цветах, показывающие интенсивность флуоресценции Fluo-3 до (1), на пике (2) и после восстановления (3) реакции на глутамат. Изображение справа представляет собой изображение того же поля в инфракрасном свете. Масштабная линейка = 10 мкм. Внизу: график зависимости интенсивности флуоресценции от времени, показывающий флуоресценцию Fluo-3 в области, обозначенной кружком на изображениях выше.Глутамат и повышенное содержание калия применяли в ванне в течение времени, указанного черными полосами. Сокращение: Glut, глутамат.

Обсуждение

cOrg, полученные из ИПСК, специфичных для пациентов и заболеваний, могут быть исключительно ценным инструментом для моделирования in vitro различных неврологических расстройств человека, для изучения развития нервной системы, для нейрофизиологических исследований, для скрининга фармацевтических препаратов и в качестве источника терапевтических клеток. . В настоящем исследовании мы описываем новый метод создания cOrgs, который благодаря своей простоте, быстроте и использованию только определенных клеточных культур и компонентов матрицы может ускорить использование и дальнейшее развитие этой технологии.

Методы, доступные на сегодняшний день, основаны на использовании ксенобиотического компонента внеклеточного матрикса (матригеля), который может накладывать ограничения на последующие применения технологии cOrg. Генерация cOrgs с использованием нашего метода устраняет необходимость в этом компоненте и, таким образом, позволяет трансляционные приложения, такие как производство терапевтических клеток и использование встроенного в клетки гидрогеля для скрининга фармакологии или токсичности, где решающее значение имеет последовательное и воспроизводимое производство.Этот метод также может служить для ускорения изучения механизмов, участвующих в дифференцировке ПСХ. Напр., недавнее исследование показало, что спонтанная дифференцировка происходит по умолчанию для праймированных иПСК и что она регулируется согласованными или противоположными действиями Wnt и Fgf2 [14]. Наш метод генерации cOrg может служить уникальным инструментом для изучения таких основополагающих сигналов в норме и при заболеваниях, включая ALD.

Мы также предоставляем предварительные данные об использовании этого метода для моделирования in vitro ALD и, возможно, других нейродегенеративных заболеваний.Ранее потенциал cOrgs для моделирования нарушений развития нервной системы человека in vitro был элегантно продемонстрирован Lancaster et al. [5] в демонстрации специфических для заболевания изменений в cOrgs, полученных у пациентов с микроэнцефалией. cOrgs, полученные в этом исследовании, показали замечательный размер и сложность, которые включали корковый эпителий, который демонстрировал биологически значимые нейронные слои [4]. Кроме того, суспензионная культура широко использовалась для создания сложных структур, подобных нейронной ткани, из PSC.Эта парадигма включала формирование PSCs в эмбриоидные тельца с последующим добавлением среды кондиционированной гепатоцеллюлярной карциномы [15, 16] или, совсем недавно, использование метода «бессывороточного эмбриоидного тельца» (SFEB).

В методе SFEB используются колонии PSC или колонии, которые диссоциированы и реагрегированы, а затем культивируются в определенной среде в сочетании с мощными химическими ингибиторами для стимулирования специфических клеточных линий, таких как телэнцефальные предшественники [16] или корковые нейроэпителии [17].Хотя было показано расслоение как делящихся, так и неделящихся клеток коры, а также последовательное наслоение нейронов глубокого и верхнего слоев в культуре SFEB, фенотип нейроэпителия, подобный in vivo, который демонстрирует структуру, подобную вывернутой наизнанку, не был достигнут с помощью этого метода. метод [17–20]. Ланкастер и др. [5] преодолели эту трудность, применив свой метод, который включал формирование эмбриоидных телец (ЭТ) с последующим помещением ЭТ в матригель и воздействием специфических ингибиторов киназы и комбинации средств нейрональной индукции.Хотя этот метод был очень эффективным, он был сложным и основывался на использовании матригеля, что, как правило, ограничивает его использование для некоторых приложений. Другое ограничение, отмеченное Lancaster et al. [5] заключалась в том, что cOrgs имели тенденцию к развитию центральных областей гибели клеток, которые ограничивали их рост, который можно было обойти с помощью вращающихся колб для создания конвекции и улучшения обмена питательных веществ и газа. Эта тенденция к гибели клеток в центральных областях также была обнаружена в cOrgs, созданных нашим методом, и потребует дальнейшей разработки методов улучшения обмена питательных веществ и газа, таких как использование вращающихся колб, газопроницаемых культуральных чашек и /или проточные методы культивирования клеток.

Хотя концепция того, что определяет органоид ткани, все еще развивается, недавно предложенное определение гласит, что они: (а) содержат несколько типов клеток, специфичных для органа, (б) способны повторять некоторые специфические функции органа, и ( в) клетки и структуры сгруппированы и пространственно организованы подобно органу [4]. В наших конструкциях практически все клетки экспрессировали общий нейральный маркер β-3 тубулин, а многие также коэкспрессировали маркеры нейральных клеток-предшественников Sox1/nestin или Sox2/nestin.Дальнейшие иммуногистохимические доказательства региональной спецификации были обнаружены в экспрессии маркера среднего мозга Nurr1 во многих клетках и экспрессии маркера переднего мозга Pax6 или кортикальных маркеров Tbr1, doublecortin или reelin в локальных группах клеток. Региональная спецификация была дополнительно подтверждена нашим анализом экспрессии генов, который показал доказательства экспрессии маркеров переднего мозга ( FoxG1 и Six3 ) во всех клеточных линиях и заднего мозга ( Egr2 и Isl1 ). Наконец, клетки внутри предполагаемых cOrgs показали иммуногистохимические признаки различных типов нервных клеток, включая тирозингидроксилазу (дофаминергические нейроны), рилин (клетки Кахаля-Ретциуса) и даблкортин (нейроны коры головного мозга). Наряду с этим, наш анализ экспрессии генов также показал корковую дифференцировку со значительно повышенной экспрессией в cOrgs как даблкортина (D14 и D29), так и рилина (D28). Вместе эти данные подтверждают наш вывод о том, что наши предполагаемые cOrgs демонстрируют разнообразие путей дифференцировки, специфичных для нервных клеток и регионов, которые соответствуют критерию 1 cOrg, приведенному выше.Затем наши физиологические исследования показали, что клеточные популяции в наших предполагаемых cOrgs реагировали на глутамат способом, совместимым с нейронами, и, таким образом, соответствовали критерию 2 соответствующей клеточной функциональности. Наконец, предполагаемые cOrgs в наших исследованиях показали множественные нейроэпителиальные структуры, такие как розетки и более крупные структуры, подобные нервной трубке, а также участки раннего кортикогенеза, соответствующие архитектуре развития центральной нервной системы и, следовательно, удовлетворяющие требованиям наличия соответствующих структурных структур. организация критерия 3 (выше).

Хотя механизм, лежащий в основе нейральной дифференцировки, наблюдаемой в нашей химически определенной системе, не был выяснен в этом исследовании, возможно, что взаимодействия клеток с матриксом и/или жесткость микроокружения могут играть роль в описанном здесь развитии cOrg. Было обнаружено, что HA присутствует во внеклеточном матриксе в нише нейральных стволовых клеток, а также в эмбриональной и взрослой центральной нервной системе и играет несколько ролей в пролиферации и дифференцировке [21].Известно, что ГК, основной компонент матрицы Cell-Mate3D, взаимодействует с несколькими рецепторами клеточной поверхности, включая CD44, рецептор опосредованной гиалуроновой кислотой подвижности (RHAMM) [22, 23], TLR2 и TLR4 [24, 25]. ; однако, какие из них, если таковые имеются, могут опосредовать или влиять на нейронную дифференциацию в нашей системе, еще предстоит определить. Другие продемонстрировали, что сама по себе жесткость матрикса может влиять на клеточную судьбу, и что культивирование клеток на материалах различной жесткости или в них может направлять PSC в ряд клонов, включая нейрональные клоны [26-28]. В нашей предварительной оценке мы обнаружили, что модуль Юнга для одного только гидрогеля Cell-Mate3D составляет 10 111 ± 3 742 Па, а для матрицы Cell-Mate3D, встроенной в иПСК, — 9 838 ± 1 552 Па. Не было статистически значимой разницы между этими двумя измерений, и, следовательно, захват ИПСК в гелях Cell-Mate3D не влиял на механические свойства гелей. Уменьшение модуля Юнга гидрогеля после захвата клеток было продемонстрировано ранее и объяснялось внедрением клеток, более мягких, чем гель, и нарушением взаимодействий между волокнами геля [29].Интересно, что Энглер и др. показали, что мезенхимальные стволовые клетки дифференцируются в нервную линию при жесткости субстрата 0,1–1 кПа [26], а Лейпциг и Шойхет показали, что нейральные стволовые клетки/клетки-предшественники будут дифференцироваться в нейроны, астроциты и олигодендроциты при культивировании на субстратах с жесткостью между 0,6 и 7 кПа, тогда как на более жестких субстратах (≥10 кПа) они будут дифференцироваться в олигодендроциты [30]. Было измерено, что нативная мозговая ткань находится в диапазоне от 0,5 до 1 кПа [31–33]. Другие группы продемонстрировали аналогичные результаты с использованием материалов, содержащих ГК [34–36] . Таким образом, при использовании методологии реометра с вибрирующей пластиной гидрогель Cell-Mate3D имел более высокий модуль упругости, чем сообщалось ранее, что способствует дифференцировке нейронов, что позволяет предположить, что на это явление в нашей системе могут влиять дополнительные факторы.

Заключение

Здесь мы продемонстрировали, что иПСК, полученные как от лиц, страдающих ALD, так и от контрольных пациентов, неизменно образуют cOrgs в условиях исследования, описанных здесь. Таким образом, этот метод подходит для разработки in vitro модели ALD или других нейродегенеративных или нейродегенеративных заболеваний.Хотя эти первоначальные исследования не предназначались для оценки различий между ALD и cOrg, полученными от пациентов, не выявили каких-либо однозначных различий в частоте образования cOrg, размере, сложности, экспрессии маркеров дифференцировки или экспрессии генов. Однако, поскольку патогенез ccALD, вероятно, включает более тонкие изменения в метаболизме нейронов, астроцитов или олигодендроцитов, мы предполагаем, что для оценки cOrg-модели АЛД.

Благодарности

Мы благодарим Паулу Оверн за изготовление превосходных гистологических препаратов и разработку иммуногистохимических и иммунофлуоресцентных красителей, необходимых для этой работы. Общие изображения были получены с использованием стереоскопа Nikon SMZ1500 и при поддержке Гранта Бартеля из Центра визуализации Университета Миннесоты.

Вклад авторов

B.A.L.: концепция и дизайн, сбор и/или сборка данных, анализ и интерпретация данных, написание рукописи; Дж.HB: финансовая поддержка, предоставление учебного материала или пациентов; A.L.V., CBU, KTH, S.L.V. и C.M.S.: сбор и/или сборка данных; S.S.: сбор и/или сборка данных, анализ и интерпретация данных; CRE, PJO и WC: предоставление материалов для исследования или пациентов; QW: анализ и интерпретация данных; Ф. П. и S.A.K.: сбор и/или сборка данных, написание рукописи; Е.К.: анализ и интерпретация данных, окончательное утверждение рукописи; J.R.D. и JT: окончательное утверждение рукописи; Т.D.O.: концепция и дизайн, написание рукописи, окончательное утверждение рукописи.

Раскрытие потенциальных конфликтов интересов

Дж.Х.Б. является сотрудником, занимает должность изобретателя/руководителя и имеет оплачиваемые опционы на акции в BRTI Life Sciences, Inc. B.A.L. является сотрудником компании Bioactive Regenerative Therapeutics, Inc., которая предоставила материалы Cell-Mate3D для этого исследования, и имеет оплачиваемые опционы на акции. Т.Д.О. владеет акциями и имеет право на гонорары от BRTI, компании, которая продает Cell-Mate3D.П.Дж.О. является оплачиваемым консультантом в качестве председателя Институционального наблюдательного совета Национальной программы доноров костного мозга, получает компенсационные гонорары от Genzyme, а также его приглашают выступать на собраниях. Другие авторы указали на отсутствие потенциального конфликта интересов.

Каталожные номера

1

Бейкер

BM

,

Чен

CS

.

Деконструкция третьего измерения: как микроокружение трехмерной культуры изменяет клеточные сигналы

.

J Cell Sci

.

2012

;

125

:

3015

3015

3024

.2

3024

.2

Sasai

Y

,

EIRAKU

M

,

SUGA

H

.

Органогенез in vitro в трех измерениях: самоорганизующиеся стволовые клетки

.

Разработка

.

2012

;

139

:

4111

4111

4111

4111

.3

Karus

M

,

Blaess

S

,

Brüstle

O

.

Самоорганизация структур нервной ткани из плюрипотентных стволовых клеток

.

Дж Комп Нейрол

.

2014

;

522

:

2831

2844

. 4

Lancaster

 

MA

,

Knoblich

 

JA

.

Органогенез в блюде: моделирование развития и заболевания с использованием органоидных технологий

.

Наука

.

2014

;

345

:

1247125

.5

Lancaster

 

MA

,

Renner

 

M

,

Martin

3 CA

0 ..

Церебральные органоиды моделируют развитие человеческого мозга и микроцефалию

.

Природа

.

2013

;

501

:

373

373

379

.6

379

.6

Kadoshima

T

,

Sakaguchi

H

,

Nakano

T

et al. .

Самоорганизация осевой полярности, паттерн внутреннего слоя и видоспецифичная динамика предшественников в неокортексе, полученном из ЭС клеток человека [опубликованное исправление появляется в Proc Natl Acad Sci USA 2014;111:7498]

.

Proc Natl Acad Sci USA

.

2013

;

110

:

20284

20289

. 7

Berger

 

J

,

Gärtner

 

J

.

Х-сцепленная адренолейкодистрофия: клинические, биохимические и патогенетические аспекты

.

Биохим Биофиз Акта

.

2006

;

1763

:

1721

:

1721

1721

1732

.8

Berger

J

,

FORSS-PETTER

S

,

Eichler

FS

.

Патофизиология Х-сцепленной адренолейкодистрофии

.

Биохимия

.

2014

;

98

:

135

135

142

.9

Miller

WP

,

Rothman

SM

,

NASCEN

D

et al. .

Исходы после аллогенной трансплантации гемопоэтических клеток при церебральной адренолейкодистрофии у детей: крупнейший когортный отчет одного учреждения

.

Кровь

.

2011

;

118

:

1971

1971

1978

1978

.10

Lund

Tc

,

Stadem

PS

,

Panoskalts-mortari

A

et al. .

Повышенный уровень цитокинов в спинномозговой жидкости у мальчиков с церебральной адренолейкодистрофией коррелирует с тяжестью МРТ

.

PLoS Один

.

2012

;

7

:

e32218

.11

McKinney

AM

,

Nascene

D

,

Miller 3

3 0 et al

3  .

Детская церебральная Х-сцепленная адренолейкодистрофия: измерения диффузионно-тензорной визуализации для прогнозирования клинического исхода после трансплантации гемопоэтических стволовых клеток

.

AJNR Am J Нейрорадиол

.

2013

;

34

:

641

641

641

649

.12

Орчард

PJ

,

Lund

T

,

Miller

W

et al. .

Хитотриозидаза как биомаркер церебральной адренолейкодистрофии

.

J Нейровоспаление

.

2011

;

8

:

144

.13

Линдборг

B

,

Брекке

JH

,

Скотт

0 9000 и др. .

Новый гидроколлоид на основе хитозана и гиалуроновой кислоты поддерживает культуру in vitro и дифференцировку мезенхимальных стволовых/стромальных клеток (МСК) человека

.

Ткань Eng A

.

2015

;

21

:

1952

1952

1962

.14

WU

J

,

Okamura

D

,

LI

M

et al..

Альтернативное плюрипотентное состояние дает межвидовую химерную компетенцию

.

Природа

.

2015

;

521

:

316

316

321

.15

Rathjen

J

,

Озеро

JA

,

Bettess

MD

et al. .

Формирование примитивной эктодермоподобной клеточной популяции, клеток EPL, из клеток ES в ответ на биологически полученные факторы

.

J Cell Sci

.

1999

;

112

:

612

612

.16

Rathjen

J

,

Haines

BP

,

HUDSON

км

et al. .

Направленная дифференцировка плюрипотентных клеток в нервные линии: гомогенное формирование и дифференцировка популяции нейроэктодермы

.

Разработка

.

2002

;

129

:

2649

:

2649

2649

2661

. 17

Mariani

J

,

Simonini

MV

,

Palejev

D

et al..

Моделирование развития коры головного мозга человека in vitro с использованием индуцированных плюрипотентных стволовых клеток

.

Proc Natl Acad Sci USA

.

2012

;

109

:

12770

12775

.18

Эйраку

 

M

,

Sasai

 

Y

и др. .

Культура эмбриональных стволовых клеток мыши для создания трехмерных тканей сетчатки и коры головного мозга

.

Нацпроток

.

2011

;

7

:

69

79

.19. .

Самоорганизованное формирование поляризованных тканей коры из ЭСК и активная манипуляция внешними сигналами

.

Стволовая клетка

.

2008

;

3

:

519

519

532

532

.20

NASU

M

,

Takata

N

,

Danjo

T

et al..

Надежное формирование и поддержание непрерывного многослойного коркового нейроэпителия с помощью ламининсодержащего матрикса в культуре клеток ES мыши

.

PLoS Один

.

2012

;

7

:

e53024

.21

Brekke

 

J

,

Thacker

 

K

.

Гиалуронан как биоматериал

. В:

Hollinger

 

J

,

Guelcher

 

S

, ред.

Введение в биоматериалы

.

Boca Raton, FL

:

CRC Press

,

2006

:

219

248

.22

Preston

M

,

Sherman

LS

.

Ниши нервных стволовых клеток: роль внеклеточного матрикса на основе гиалуроновой кислоты

.

Front Biosci (школа)

.

2011

;

3

:

1165

:

1165

1179

.23

Choudhary

M

,

Zhang

x

,

stojkovic

p

et al..

Предполагаемая роль гиалуронана и родственных ему генов, HAS2 и RHAMM, в раннем предимплантационном эмбриогенезе человека и характеристике эмбриональных стволовых клеток

.

Стволовые клетки

.

2007

;

25

:

3045

3045

3057

3057

. 24

Termer

C

,

Benedix

F

,

Сюрман

J

et al. .

Олигосахариды гиалуронана активируют дендритные клетки через толл-подобный рецептор 4

.

J Exp Med

.

2002

;

195

:

99

99

111

.25

Jiang

D

,

Liang

J

,

NOBLE

PW

.

Гиалуронан как иммунорегулятор при заболеваниях человека

.

Физиол Ред.

.

2011

;

91

:

221

221

221

264

.26

Engler

AJ

,

SEN

S

,

Sweeney

HL

et al..

Эластичность матрикса определяет спецификацию линии стволовых клеток

.

Сотовый

.

2006

;

126

:

677

677

689

689

.27

Lee

J

,

abdeen

AA

,

китьян

KA

.

Изменение спецификации линии мезенхимальных стволовых клеток путем переключения биофизического микроокружения

.

Научный представитель

.

2014

;

4

:

5188

.28

Sun

 

Y

,

Yong

 

KMA

,

Villa-Diaz

 

LG

 et al. .

Hippo/YAP-опосредованная дифференцировка двигательных нейронов, зависящая от ригидности, человеческих плюрипотентных стволовых клеток

.

Нат Матер

.

2014

;

13

:

599

599

604

.29

Scott

см

,

Forster

CL

,

Kokkoli

E

.

Трехмерный захват клеток в зависимости от процентного содержания пептид-амфифильных гидрогелей

.

Ленгмюр

.

2015

;

31

:

6122

6129

.30

Лейпциг

 

ND

,

Shoichet

 

MS

.

Влияние жесткости субстрата на поведение взрослых нервных стволовых клеток

.

Биоматериалы

.

2009

;

30

:

6867

6867

6878

6878

.31

Pashuck

et

,

CUI

H

,

UTEMP

SI

.

Настройка надмолекулярной жесткости пептидных волокон за счет молекулярной структуры

.

J Am Chem Soc

.

2010

;

132

:

6041

:

6041

6041

6041

.32

Meijering

E

,

JACOB

M

,

Saria

J-CF

et al. .

Разработка и проверка инструмента для отслеживания и анализа нейритов на изображениях флуоресцентной микроскопии

.

Цитометрия А

.

2004

;

58

:

167

176

.33

Парамонов

 

SE

,

июнь

 

HW

,

Хартгеринк

 

JD

.

Самосборка пептидно-амфифильных нановолокон: роль водородных связей и амфифильной упаковки

.

J Am Chem Soc

.

2006

;

128

:

7291

:

7291

7291

7298

.34

Seidlits

SK

,

KHAING

ZZ

,

PETERSEN

RR

et al..

Влияние гидрогелей гиалуроновой кислоты с настраиваемыми механическими свойствами на дифференцировку нервных клеток-предшественников

.

Биоматериалы

.

2010

;

31

:

3930

3930

3940

3940

.35

Pan

L

,

REM

Y

,

CUI

F

et al. .

Жизнеспособность и дифференцировка нейронных предшественников на каркасе из гидрогеля гиалуроновой кислоты

.

J Neurosci Res

.

2009

;

87

:

3207

:

3207

3220

.36

Brännvall

K

,

K

,

Bergman

K

,

Uallenquist

U

et al. .

Усиленная дифференцировка нейронов в трехмерном коллагеново-гиалуроновом матриксе

.

J Neurosci Res

.

2007

;

85

:

2138

2146

.

Примечания автора

© AlphaMed Press, 2016 г.

Эта статья публикуется и распространяется на условиях издательства Oxford University Press, Standard Journals Publication Model (https://academic. oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка браузера на прием файлов cookie

Существует множество причин, по которым файл cookie не может быть установлен правильно. Ниже приведены наиболее распространенные причины:

  • В вашем браузере отключены файлы cookie.Вам необходимо сбросить настройки браузера, чтобы принять файлы cookie, или спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файл cookie.
  • Ваш браузер не поддерживает файлы cookie. Попробуйте другой браузер, если вы подозреваете это.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie.Чтобы это исправить, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Предоставить доступ без файлов cookie потребует от сайта создания нового сеанса для каждой посещаемой вами страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в файле cookie; никакая другая информация не фиксируется.

Как правило, в файле cookie может храниться только та информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, если вы не решите ввести его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступ к остальной части вашего компьютера, и только сайт, создавший файл cookie, может его прочитать.

Использование индуцированных человеком плюрипотентных стволовых клеток и почечных органоидов для разработки комбинированной терапии цистеамина/ингибирования mTOR для лечения цистиноза

Visual Abstract

Заявление о значимости

В наиболее тяжелой форме лизосомная болезнь накопления цистиноз характеризуется накоплением цистина; дисфункция проксимальных канальцев почек; и почечная недостаточность. Исследования также показали участие цистинозина в модулировании пути мишени рапамицина (mTOR) комплекса 1 у млекопитающих. Использование цистеамина, истощающего цистин, единственного варианта лечения цистиноза, только замедляет прогрессирование заболевания. Авторы разработали индуцированные плюрипотентные стволовые клетки и органоидные модели цистиноза, которые демонстрируют повышенные уровни цистина, увеличенные лизосомы, повышенный апоптоз и дефектную базальную аутофагию. Хотя последнее не устраняется лечением цистеамином, ингибирование mTOR с помощью эверолимуса было способно восстановить базальную аутофагию до уровней здорового контроля. Двойное лечение эверолимусом и цистеамином спасло все наблюдаемые цистинозные фенотипы в моделях, предполагая, что комбинированная терапия может улучшить исходы у пациентов с цистинозом.

Резюме

Исходная информация Мутации в CTNS — гене, кодирующем переносчик цистина цистинозина, — вызывают редкую аутосомно-рецессивную лизосомную болезнь накопления цистиноз. Исследования также показали участие цистинозина в модуляции пути mTORC1, который служит основным регулятором клеточного метаболизма, пролиферации, выживания и аутофагии. В наиболее тяжелой форме цистиноз характеризуется накоплением цистина, дисфункцией проксимальных канальцев почек и почечной недостаточностью.Поскольку лечение цистеамином, разрушающим цистин, только замедляет прогрессирование заболевания, существует острая необходимость в более эффективных методах лечения.

Методы Чтобы восполнить недостаток хороших моделей клеточных культур для изучения цистиноза, мы создали первые модели плюрипотентных стволовых клеток, индуцированных человеком (ИПСК), и органоидные модели заболевания почек. Мы использовали различные методы для изучения признаков цистиноза, включая накопление цистина, размер лизосом, путь аутофагии и апоптоз, и провели секвенирование РНК на изогенных линиях, чтобы идентифицировать дифференциально экспрессируемые гены в моделях цистиноза по сравнению с контролем.

Результаты По сравнению с контролем, эти модели цистиноза демонстрируют повышенный уровень цистина, усиленный апоптоз и дефектную базальную аутофагию. Лечение цистеамином улучшает этот фенотип, за исключением аномалий апоптоза и базальной аутофагии. Мы обнаружили, что лечение эверолимусом, ингибитором пути mTOR, уменьшает количество крупных лизосом, уменьшает апоптоз и активирует аутофагию, но не устраняет дефект загрузки цистином. Однако двойное лечение цистеамином и эверолимусом цистинозных иПСК или почечных органоидов корректирует все наблюдаемые фенотипические аномалии.

Выводы Эти наблюдения позволяют предположить, что комбинированная терапия препаратом, разрушающим цистин, таким как цистеамин, и ингибитором пути mTOR, таким как эверолимус, может улучшить лечение цистиноза.

Цистиноз — это редкое аутосомно-рецессивное заболевание накопления лизосом, вызываемое мутациями в гене CYSTINOSIN ( CTNS ), который кодирует переносчик цистина. 1,2 В отсутствие CTNS цистин накапливается в лизосомах, вызывая лизосомную дисфункцию.Нефропатический цистиноз является наиболее тяжелой формой цистиноза и первоначально связан с неспособностью реабсорбировать основные метаболиты из мочи в проксимальных канальцах почек (синдром Фанкони). Дефекты почек проявляются в возрасте от 6 до 18 месяцев и прогрессируют до почечной недостаточности к концу первого десятилетия жизни. 1,3 Другие осложнения включают нарушения в непочечных тканях, такие как обширное образование кристаллов цистина (особенно в роговице), гипотиреоз, неврологические и мышечные симптомы. 4⇓⇓–7

В настоящее время лечение цистиноза представляет собой пожизненную терапию цистеамином, молекулой, которая расщепляет цистеиндисульфидную связь с образованием смешанных дисульфидов, которые могут выходить из лизосом через альтернативные переносчики. 8,9 Однако цистеамин только замедляет прогрессирование почечной недостаточности, и трансплантация почки неизбежно требуется в более позднем возрасте. 9,10 В результате остается острая необходимость в разработке более эффективных методов лечения цистиноза.

Хотя еще нет полного понимания патогенеза цистиноза, несколько линий доказательств указывают на то, что цистиновая нагрузка вызывает увеличение лизосом, нарушение протеолиза и замедленное слияние с загруженными грузом везикулами. 11⇓⇓–14 Другие клеточные особенности цистинозных клеток, присутствующие в различных типах клеток, включают снижение уровней АТФ и GSH, повреждение митохондрий, окислительный стресс, усиление апоптоза и дедифференцировку клеток проксимальных канальцев. 9,15⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓–27 Кроме того, цистинозные клетки проксимальных канальцев демонстрируют сниженную экспрессию эндоцитарных рецепторов мегалина и кубулина, а также нарушение рециркуляции мегалина. 11,12

Дефекты макроаутофагии (здесь называемой аутофагией) также обнаруживаются в цистинотических клетках. Аутофагия включает секвестрацию части цитоплазмы двухслойной мембраной, известной как аутофагосома, с последующим слиянием с лизосомой с образованием аутолизосомы. 28 Этот последний этап можно модулировать бафиломицином A1 (BafA1), ингибитором закисления аутофаголизосом, который нарушает слияние аутофагосом-лизосом. 29 В состоянии покоя базовые уровни аутофагии необходимы для «домашнего хозяйства» для деградации долгоживущих и убиквитинированных белков; N-связанные гликаны; поврежденные органеллы, такие как митохондрии; и для подавления определенных путей, таких как воспалительная передача сигналов, Notch и Wnt. 30⇓–32 В условиях стресса, например, при голодании, аутофагия значительно усиливается, чтобы обеспечить повторное использование метаболически полезных молекул для поддержания клеточного гомеостаза. Хотя аутофагия может быть вызвана в цистинозных клетках голоданием, 33 базальный поток аутофагии снижается в ряде цистинозных клеточных линий, что приводит к накоплению аутофагосом, которые часто содержат митохондрии. 26,33,34 Кроме того, отдельный путь шаперон-опосредованной аутофагии, при котором специфические цитозольные белки доставляются непосредственно через лизосомальную мембрану для деградации, также дефектен в фибробластах мыши Ctns -knockout (KO). . 33

Совсем недавно CTNS был вовлечен в модулирование пути мишени рапамицина (mTOR) комплекса 1 (mTORC1) у млекопитающих, который объединяет как внутриклеточные, так и внеклеточные сигналы и служит основным регулятором клеточного метаболизма, пролиферации, выживания, и аутофагия. 35 mTORC1 переключается между активным и неактивным состояниями в зависимости от доступности питательных веществ. 36,37 Ингибирование mTORC1 классом препаратов, включающим эверолимус, который клинически используется в качестве иммунодепрессанта и противоракового средства, приводит к активации аутофагии. 38,39 ЦИСТИНОЗИН физически взаимодействует с партнерами по связыванию mTORC1, которые необходимы для активации mTORC1 аминокислотами. 40 Потеря функции цистинозина в условно иммортализованных клеточных линиях проксимальных канальцев человека и мыши приводит к снижению активности mTORC1, а также к замедленной реактивации после возвращения в условия, богатые аминокислотами. 40,41

Одной из проблем в области цистиноза является отсутствие хороших моделей клеточных культур на основе человека. Чтобы решить эту проблему, мы создали плюрипотентные стволовые клетки, индуцированные цистинозом, плюрипотентные стволовые клетки, специфичные для пациента и отредактированные с помощью CRISPR/Cas9 (iPSC). Эти клетки имеют то преимущество, что они являются возобновляемым источником неиммортализованных цистинозных клеток и могут быть дифференцированы во многие ткани, включая органоиды почек. Наш анализ иПСК CTNS и почечных органоидов выявил повышенные уровни цистина, увеличенные лизосомы, аномальный базальный поток аутофагии, повышенный апоптоз и измененную экспрессию генов по сравнению со здоровым контролем, что согласуется с моделированием ключевых аспектов цистинотического фенотипа.Далее мы обнаружили, что некоторые из этих дефектов могут быть устранены путем лечения только цистеамином или эверолимусом, но наиболее эффективной оказалась комбинированная терапия. Эти результаты свидетельствуют о том, что комбинированная терапия цистеамином/эверолимусом может иметь терапевтический потенциал для улучшения лечения и улучшения состояния здоровья людей с цистинозом.

Методы

Линии iPSC и техническое обслуживание

Все работы проводились с одобрения Комитета по этике участников Оклендского университета (UAHPEC 8712), Комитета по этике человека и инвалидов (17/NTA/204) и одобрения биобезопасности ( ГМО05).Клон CRL1502 C32 и линии ИПСК цистиноза были разработаны в лаборатории доктора Волветанга 42 и доктора Дэвидсона соответственно. Для линий цистиноза, полученных от пациентов ( CTNS -/- ), мезенхимальные клетки жирового происхождения были получены из небольшого образца жира (<1 г), взятого из почки человека с нефропатическим цистинозом, перенесшего трансплантацию почки. Образец обрабатывали для получения стромально-васкулярной фракции (СВФ) путем промывания образца жира в равных объемах PBS и расщепления внеклеточного матрикса при 37°C в течение 30 минут с помощью 0.075% коллагеназа. Активность фермента нейтрализовали DMEM, содержащей 10% FBS, и центрифугировали при 1200 × g в течение 10 минут с получением осадка SVF высокой плотности. Осадок ресуспендировали в 160 мкл л хлорида аммония и инкубировали при комнатной температуре (КТ) в течение 10 минут для лизиса загрязняющих эритроцитов. SVF собирали центрифугированием, как описано выше, и фильтровали через нейлоновую сетку 100- мкм мкм для удаления клеточного дебриса и инкубировали в течение ночи при 37°C с 5% диоксидом углерода в DMEM с 10% FBS, 1% раствором антибиотика/антимикотика.После инкубации планшеты тщательно промывали PBS для удаления остаточных эритроцитов. Для трансдукции 1×10 6 мезенхимальных клеток, полученных из жировой ткани, высевали за 24 часа до этого в колбы T75. Клетки инфицировали лентивирусным доксициклин-индуцируемым полицистронным вектором, содержащим OCT4 , SOX2 , CMYC , KLF4 и NANOG . Через пять дней после трансдукции клетки пассировали с использованием трипсина и повторно высевали с различной плотностью от 5×10 4 до 5×10 5 клеток на 10 см на питающих слоях MEF.Для индукции репрограммирования через 48 часов культуральную среду заменяли средой с добавлением доксициклина (2 мк мкг/мл). Колонии ИПСК человека собирали вручную на основе морфологии между 4 и 8 неделями после индукции доксициклином. Было создано пять CTNS -/- линий иПСК, три из которых (36, 108, 157) показали нормальный кариотип (определенный LabPLUS, Окленд, Новая Зеландия). Плюрипотентность этих линий была подтверждена на основании иммуноокрашивания маркеров клеточной поверхности (SSEA-4, TRA-1-60, TRA-1-81) и образования тератом после трансплантации 1×10 6 клеток под капсулу почки. 8-недельных мышей SCID ( n = 3 мыши на линию) в соответствии с установленными процедурами. 43

Все линии ИПСК культивировали в чашках для культур тканей, не содержащих LDEV, чЭСК-квалифицированных, покрытых Geltrex, в среде mTeSR1 (Stemcell Technologies) с добавлением 1% пенициллина-стрептомицина и 2,5 мк мкг/мл плазмоцина ( ИнвивоГен). При приблизительно 70% слиянии клетки диссоциировали с использованием 1/3 аккутазы в PBS Дульбекко (DPBS). Клетки соскабливали с чашки, осаждали при 800 об/мин в течение 5 минут и ресуспендировали в mTeSR1 плюс 5 мк М дигидрохлорида Y27632 (Stemcell Technologies) в течение первых 24 часов для облегчения выживания клеток.Если не указано иное, все лекарственные препараты (100 нМ эверолимуса, RAD001; Selleckchem; 1 мМ цистеамина, 30 мМ 3-метиладенина, 50 мМ сахарозы; Sigma) добавляли в среду для культивирования клеток и инкубировали с клетками в течение 24 часов. Линии клеток регулярно тестировали на загрязнение микоплазмой с использованием набора для обнаружения MycoAlert Mycoplasma (Lonza) в соответствии с инструкциями производителя.

Для экспериментов с голоданием/повторным питанием клетки выращивали на 12-луночных культуральных планшетах до 70% конфлюэнтности и инкубировали в течение 2 часов в свежей культуральной среде (базовые условия).Для голодания клетки дважды промывали в PBS и инкубировали в HBSS в течение 1 часа. Рефидинг осуществляли путем инкубации клеток в нормальной культуральной среде в течение указанных моментов времени.

Создание линий

CTNS -KO путем редактирования гена

Пары направляющих РНК (гРНК), направленные на введение делеции 257 п. .rgenome.net/cas-designer/) и онлайн-инструменты COSMID (http://crispr.bme.gatech.edu/). 44,45 Эффективность КО впервые была оценена в клетках HEK293.Оптимальные гРНК (gRNA_ex81.0, 5′-TCC ACC CCC TGC AGT GTC ATT GG-3′; gRNA_ex93.0, 5′-GCG TGA GGA CAA CCG CGT GCA GG-3′) клонировали в плазмиду pSPCas9(BB)-2A-зеленый флуоресцентный белок (GFP) (48138; Addgene) и вводили в ИПСК CRL1502 путем обратной трансфекции с использованием Trans IT-LT1 (Mirus Bio). GFP-положительные клетки выделяли через 48 часов методом проточной цитометрии и 8000 клеток высевали на 10-сантиметровую чашку, покрытую Geltrex, в предварительно нагретый mTeSR1, содержащий 5 мк M Y27632.Смену среды проводили ежедневно, используя mTeSR1 без Y27632. Отдельные колонии отбирали вручную, когда они достигали подходящего размера (примерно через 10 дней после посева), клонально размножали и подвергали скринингу на биаллельные делеции с использованием праймеров для ПЦР, фланкирующих удаленную область (прямой CTNS1_primer, 5′-CTC CAC CCC CGC CAG). TCCTC-3′; обратный CTNS_1праймер, 5′-TCTGTGCACGGCTCTCAGC-3′). Гомозиготные делеции подтверждали секвенированием по Сэнгеру. Три клона, КО 15, 32 и 73, были размножены и кариотипированы.

Создание цистинотических почечных органоидов

Мы использовали протокол, разработанный внутри компании, для преобразования ИПСК в почечные органоиды. 46 Вкратце, иПСК культивировали на 10-сантиметровых чашках, покрытых Geltrex, до приблизительно 40–50% слияния, затем дважды промывали 1× PBS и обрабатывали диспазой 1 мг/мл в течение 6 минут при 37°C. Диспазу удаляли и клетки дважды промывали 1× PBS. Используя скребок для клеток, клетки вручную снимают с чашки; ресуспендировали в среде BPEL 47 , содержащей 8 мкМ М CHIR99021, 3 мкМ М Y27632 и 1 мМ β -меркаптоэтанола; и равномерно распределяли в 6-луночные планшеты со сверхнизким креплением (Corning).Смену среды наполовину проводили на 2-й день с помощью BPEL с добавлением 8 мк M CHIR99021. На 3-й день эмбриоидным тельцам (ЭТ) давали осесть в пробирке на 50 мл и дважды промывали PBS. EB возвращали в 6-луночный планшет со сверхнизким содержанием и переносили в среду II стадии (DMEM, 15% заменителя сыворотки KnockOut [Thermo Fisher], 1% заменимых аминокислот, 1% пенициллина/стрептомицина, 1% HEPES, 1% GlutaMAX. , 0,05% поливинилового спирта, 2,5 мкг/мл мкг/мл плазмоцина) и выращивали в течение различных периодов времени (до 2 недель).Образование канальцев наблюдали на 7–8-е сутки. Как правило, 60–80% ЭТ становятся почечными органоидами. Все лекарственные обработки органоидов проводились с 13-го дня до 14-го дня, когда органоиды собирали для последующего анализа.

Иммуноокрашивание

Клетки промывали трис-буферным солевым раствором (TBS) и фиксировали в 4% параформальдегиде (PFA)/PBS (w/v) в течение 10 минут при комнатной температуре. После трех промывок фиксированные клетки блокировали при комнатной температуре не менее часа в блокирующем растворе (ТБС, содержащем 2% БСА [вес/объем] и 10% нормальную лошадиную сыворотку с 0.1% Triton X-100 [об./об.]). Клетки инкубировали с первичными антителами (дополнительная таблица 1) в блокирующем растворе в течение ночи при 4°C во влажной камере. Через 24 часа клетки трижды промывали 1× TBST (TBS, содержащим 0,1% Triton X-100 [v/v]) и инкубировали со вторичными антителами (дополнительная таблица 2) в разведении 1:500 в блокирующем растворе в течение 2 часов. на РТ. Клетки инкубировали с 10 мк г/мл Hoechst 33258 в течение 5 минут, дважды промывали TBST и помещали в ProLong Gold (Thermo Fisher) перед визуализацией.Клетки визуализировали с помощью конфокального микроскопа Zeiss LSM710.

Иммунохимия органоидов

Органоиды фиксировали в 4% PFA/PBS в течение ночи при 4°C. После промывания 1× PBS плюс 0,1% Tween 20 органоиды переносили в форму для заливки и заполняли средой для заливки (1% легкоплавкой агарозы, 0,9% агара, 5% сахарозы). После затвердевания блоки переносили в 70% этанол и инкубировали при 4°С в течение ночи. В течение следующих 2 дней блоки переносили через серию 95% и 2×100% этанола, 50:50 этанол/ксилол, 100% ксилол, 1 час каждый, покачивая при комнатной температуре, а затем 50:50 ксилол/парафин. при 65°С в течение ночи и с заменой парафина каждые 4 часа.После заливки блоки делали на микротоме Leica размером 6 мкм м. Срезы сушили на воздухе и затем хранили при 4°С. Иммуногистохимию проводили по стандартным методикам. Парафиновые срезы депарафинизировали при 65°С в течение 30 минут, затем инкубировали в двух сменах ксилола (по 10 минут каждая). Выделение антигена (10 мМ буфер цитрата натрия плюс 0,05% Tween 20, pH 6,0, при 95°C в течение 30 минут) проводили для всех антител. Иммуноокрашивание визуализировали с помощью конфокального микроскопа Zeiss LSM710 или Leica SP8.Список антител см. в дополнительных таблицах 1 и 2.

Окрашивание Magic Red-Cathepsin B

За 48 часов до визуализации клетки iPSC высевали на покрытые Geltrex 35-мм чашки Fluro (WPI). Перед окрашиванием клетки однократно промывали 1× DPBS. Клетки инкубировали в течение 1 часа с 26× Magic Red Cathepsin B (Bio-Rad, Hercules, CA) в mTeSR1. Hoechst 33258 был добавлен на последние 15 минут. После завершения окрашивания красители смывали 1× DPBS и клетки фиксировали 4% PFA в течение 10 минут.Клетки заливали ProLong Gold и добавляли покровные стекла. Изображения были получены с помощью конфокального микроскопа Zeiss LSM710.

Анализ DQ-BSA

ИПСК высевали на покрытые Geltrex 35-мм чашки Fluro за 48 часов до визуализации. В день анализа клетки промывали 1× DPBS перед инкубацией с 20 мкл мкг/мл рабочего раствора DQ-BSA green (Invitrogen) в mTeSR1 в течение 3 часов. Hoechst 33258 был добавлен на последние 15 минут. После инкубации клетки промывали DPBS и добавляли свежую среду mTeSR1.Изображения были получены с помощью конфокального микроскопа Zeiss LSM710.

Тест на апоптоз

Набор ApopTag Plus Fluorescein In Situ Detection Kit (Millipore) использовали для обнаружения апоптоза в соответствии с инструкциями производителя. Вкратце, клетки высевали на покрытые Geltrex 35-мм чашки Fluro за 48 часов до визуализации. Клетки фиксировали 1% PFA в течение 10 минут при комнатной температуре. Клетки дважды промывали 1× PBS в течение 5 минут. К постфиксным клеткам добавляли предварительно охлажденный этанол/уксусную кислоту в соотношении 2:1 в течение 5 минут при -20°С.Клетки дважды промывали 1× PBS. Сразу же добавляли уравновешивающий буфер (75 мкл мкл) на 10 секунд, затем 55 мкл мкл фермента терминальной дезоксинуклеотидилтрансферазы рабочей концентрации и инкубировали в течение 1 часа при 37°С. Добавляли буфер остановки/промывки рабочей концентрации и инкубировали в течение 10 минут при комнатной температуре. Клетки трижды промывали перед нанесением антидигоксигенинового конъюгата и инкубировали в течение 30 минут в темноте при комнатной температуре. Клетки промывали четыре раза и добавляли Hoechst 33258 на 15 минут перед заливкой ProLong Gold и добавлением покровных стекол.Изображения были получены с помощью конфокального микроскопа Zeiss LSM710.

Трансмиссионная электронная микроскопия

Образцы (диссоциированные ИПСК или целые почечные органоиды) фиксировали в 2,5% глутаральдегиде и 0,1 М фосфатном буфере, pH 7,4, при 4°C и хранили в фиксаторе до обработки. Образцы промывали три раза 0,1 М фосфатным буфером в течение 10 минут, затем фиксировали в 1% четырехокиси осмия в 0,1 М фосфатном буфере в течение часа при комнатной температуре и дважды промывали 0,1 М фосфатным буфером в течение 5 минут.Затем образцы обезвоживали в последовательной серии промывок этанолом по 10 минут каждая при комнатной температуре (50%, 70%, 90% и дважды при 100%), после чего следовали две промывки оксидом пропилена в течение 10 минут при комнатной температуре. Затем образцы были пропитаны смесью оксида пропилена и смолы (2:1, 1:1, 1:2) в течение 30 минут каждый, а затем были погружены в свежеприготовленную чистую смолу на ночь. На следующий день образцы помещали в формы и полимеризовали при 60°С в течение 48 часов. Все промывки выполнялись на качалке. Срезы образцов визуализировали с помощью просвечивающего электронного микроскопа Tecnai G 2 Spirit Twin.

Транзиторная трансфекция иПСК и почечных органоидов

Для обратной трансфекции 1 мк г плазмиды инкубировали с 2 мк л Trans IT-LT1 и 100 мк 5 минут Optilib atM1 1co ( lco) РТ. Комплексы ДНК добавляли в покрытые Geltrex 35-мм чашки Fluro, содержащие либо mTeSR1 (ИПСК), либо среду стадии II (органоиды) на 15 минут при комнатной температуре. ИПСК диссоциировали с использованием 1/3 аккутазы. Органоиды диссоциировали, инкубируя их в 100 мкл мкл TrypLE Express (gibco) при 37°C в течение до 10 минут.После диссоциации клетки центрифугировали при 800 × g в течение 5 минут и ресуспендировали в среде mTeSR1/стадия II. Затем в чашку, содержащую ДНК-комплексы, добавляли в общей сложности 1×10 6 клеток и инкубировали при 37°C в течение ночи. Клетки анализировали через 24 часа после трансфекции.

Иммуноблоттинг

Клетки высевали на 12-луночные планшеты по 2,5×10 5 клеток на лунку за 24–48 часов до эксперимента. Клетки дважды промывали ледяным PBS и соскребали на льду в 80 мкл л охлажденного льдом буфера для радиоиммунопреципитации, дополненного протеазой (cOmplete Mini; Roche) и ингибиторами фосфатазы (1 мМ ортованадата натрия, 100 мМ фторида натрия, 1 мкл). мМ β -глицеролфосфат, 2.5 мМ пирофосфата натрия). Образцы центрифугировали при 12 000 × g в течение 10 минут при 4°C. Содержание белка в супернатанте определяли с использованием набора для анализа белка Pierce BCA (Thermo Scientific, Rockford, IL). Равные количества белка кипятили в буфере Лэммли при 95°С в течение 5 минут. Всего 20 мкг г белка разделяли с помощью SDS-PAGE и переносили на нитроцеллюлозные мембраны (Bio-Rad) с использованием полусухого устройства Trans-Blot Turbo (Bio-Rad). Мембраны блокировали в 5% БСА в TBST в течение 1 часа при комнатной температуре и исследовали с использованием специфических антител к LC3BII (1:1000), p-P70S6K Thr389 (1:500), P70S6K (1:1000), p-RPS6. Ser235–236 (1:1000), RPS6 (1:1000), 4EBP-1 (1:1000), p-EIF4E Ser209 (1:1000), EIF4E (1:2000) (3868, 9205, 2078, 4856, 2317, 9644, 9741 и 9742 соответственно; Cell Signaling Technologies) и β -актин (A2228, 1:10 000; Sigma).Первичные антитела инкубировали в течение ночи при 4°С при легком встряхивании. На следующее утро мембраны исследовали либо антикроличьими, либо антимышиными, связанными со вторичными антителами пероксидазы хрена (разведение 1:12 000; дополнительная таблица 2) в течение 1 часа при комнатной температуре. Мембраны экспонировали с использованием реагента для усиления хемилюминесценции (набор ECL Select; GE HealthCare), а хемилюминесцентные сигналы регистрировали с помощью устройства обработки изображений ChemiDoc (Bio-Rad). Денситометрический анализ белковых полос количественно определяли с использованием программного обеспечения ImageJ (Национальные институты здравоохранения, Бетесда, Мэриленд).Интенсивность каждой полосы регистрировали по отношению к объединенному контрольному образцу на каждом геле.

4E-BP1 представляет собой фосфопротеин, который разделяется на несколько электрофоретических форм, поэтому для измерения их состояния фосфорилирования использовали метод сдвига подвижности. 48,49 Фосфорилирование приводит к миграции белка с более высокой кажущейся молекулярной массой. Суммарный белок 4E-BP1 регистрировали как экспрессию всех форм 4E-BP1 ( α -, β -, γ — и δ -форм), а фосфорилирование 4E-BP1 выражали как отношение верхних полос к общему белку.

Анализ изображений лизосом и флуоресцентных точек

Конфокальные необработанные изображения DQ-BSA и Magic Red при 63-кратном увеличении (примерно 10 случайных полей на условие) анализировали с использованием программного обеспечения для анализа ImageJ. Ядра подсчитывали вручную. Для получения площади поперечного сечения увеличенных везикул был проведен анализ частиц и определено количество везикул >10 мк м 2 на поле. Данные выражали как среднее количество увеличенных везикул на клетку и подвергали статистическому анализу.Для измерения аутофагических точек клетки трансфицировали вектором LC3-mCherry-GFP и визуализировали с помощью конфокальной микроскопии (10 случайных полей на условие, содержащее примерно от одной до трех клеток в трех независимых экспериментах) и анализировали с помощью ImageJ. Ядра и красные и желтые точки подсчитывали вручную с помощью инструмента подсчета ImageJ, и рассчитывали процент каждой точки на клетку.

Клетки, обработанные ApopTag Plus, просматривали при 20-кратном увеличении (примерно 10 случайных полей на условие) и изображения анализировали с помощью ImageJ.Ядра и зеленые точки (апоптотические тельца) подсчитывали вручную с помощью инструмента подсчета ImageJ, и процент апоптотических телец на клетку рассчитывали для каждого состояния.

ВЭЖХ-тандемная масс-спектрометрия для измерения цистина

Для определения концентрации цистина использовали настольный тройной квадрупольный масс-спектрометр Agilent 6140 (Agilent Technologies, Пало-Альто, Калифорния), работающий в режиме положительной ионизации с источником многорежимного зонда ионизации. . Это было связано с системой ВЭЖХ Agilent 1200 (Agilent Technologies).Образцы готовили, как описано Jamalpoor et al. 50 Вкратце, замороженные осадки клеток ресуспендировали и оттаивали в 100 мкл мкл NEM (5 ммоль/л в 0,1 М фосфатно-натриевом буфере, рН 7,2) на льду. Клетки обрабатывали ультразвуком на льду три раза по 10 секунд с 20-секундными интервалами охлаждения (один цикл, амплитуда 80%). Белок осаждали добавлением 50 мкл л сульфосалициловой кислоты (15% масс./об.) и образец центрифугировали при 20000 rcf в течение 10 минут при 4°C. Супернатант извлекали и разбавляли 1:10 в 0.1% муравьиной кислоты. Добавляли объем 5 мкл л внутреннего стандарта (20 мк М цистина-D4) и образец пипеткой переносили в стеклянный флакон. Хроматографическое разделение осуществляли на колонке Thermo Scientific Hypercarb (2,1×150 мм; Thermo Scientific) при температуре 30°C. Подвижная фаза состояла из воды с 0,01% муравьиной кислоты и ацетонитрила (АЦН) с 0,1% муравьиной кислоты с быстрым градиентным элюированием при скорости потока 0,3 мл/мин и времени анализа 5 минут. Объем вводимой пробы составлял 4 мкл л, а автоматический пробоотборник был настроен на 5°C.Приборные параметры масс-спектрометра: расход газа 6 л/мин; температура газа 300°С; температура испарителя 250°С; распылитель, 40 фунтов на квадратный дюйм; и капиллярное напряжение 2500 В. Данные были получены и проанализированы с помощью программного обеспечения Agilent MassHunter. Была построена стандартная кривая с наблюдаемым отношением площади пика аналита к внутреннему стандарту в зависимости от концентрации аналита для извлечения наклона и точки пересечения.

Масс-спектрометрия для измерения GSH

Клетки лизировали на льду с холодным 50% ACN и центрифугировали при 16 000 × g в течение 10 минут при 4°C.Супернатант переносили в холодную пробирку Эппендорфа и хранили при -80°C до тех пор, пока образцы не были готовы к обработке. Образец объемом 2 мкл л добавляли к 5 мкл л 50% раствора АЦН и 50 мМ бикарбоната аммония (АБС). Образец объемом 3 мкл л обрабатывали либо 3 мкл л 1 мМ гидрохлорида трис(2-карбоксиэтил)фосфина, либо 2 мМ монобромбимана (MBrB) в 50% ACN/ABC и инкубировали при комнатной температуре в темноте в течение 20 минут. К образцам, обработанным гидрохлоридом трис(2-карбоксиэтил)фосфина, добавляли объем 3 мкл л 2 мМ MBrB и 3 мкл л 50 мМ ABC.ACN (6 мк л, 25%) добавляли к набору, обработанному MBrB. Образцы инкубировали при комнатной температуре в темноте в течение 20 минут. После инкубации ко всем образцам добавляли 950 мк л 0,1% муравьиной кислоты и 5 мк л 4,292 мк М внутреннего стандарта GSH. Картриджи HLB SPE на 10 мг кондиционировали 0,5 мл метанола, а затем 0,5 мл 0,1% муравьиной кислоты. Весь образец загружали в кондиционированный картридж и промывали 1 мл 0,1% муравьиной кислоты. Образцы элюировали в чистые пробирки с 0.3 мл 10% ацетонитрила в 0,1% муравьиной кислоте. Образцы вращали в SpeedVac до тех пор, пока их объемы не уменьшались до 50–100 мк л. Образцы вводили в чистом виде или разбавляли 1:3 в 0,1% муравьиной кислоте и пропускали через систему QStar XL LC-MS и через колонку для ЖХ (Zorbax SB-C18, 3,5 мкм м, 150×0,3 мм; Agilent Technologies). .

Анализ АТФ

Клетки лизировали с использованием 1× лизирующего буфера в течение 10 минут на льду. Лизат центрифугировали при 12000× г в течение 5 минут при 4°С. Собирали супернатант и использовали набор для определения АТФ (Invitrogen) в соответствии с указаниями производителя.Образцы считывали с помощью планшетного ридера VICTOR X Multilabel (PerkinElmer). Осадок клеток ресуспендировали в 0,1 М растворе гидроксида натрия и через 24 часа проводили анализ на бицинхониновую кислоту для определения концентрации белка.

Анализ реабсорбции

Всего 20 мкг/мл 10 кДа Texas Red-декстрана (Invitrogen) добавляли в культуральную среду стадии II на 48 часов. Органоиды промывали в среде стадии II в течение 5 часов, затем фиксировали в 4% PFA, заливали парафином и делали срезы, как описано выше.

Экстракция РНК, синтез кДНК и количественный ПЦР-анализ

Клетки сначала промывали 1× PBS перед лизисом в GENEzol в течение 5 минут. РНК выделяли с использованием набора GENEzol TriRNA Pure (Geneaid). кДНК синтезировали с использованием qScript cDNA SuperMix (Quanta). Для количественной ПЦР (кПЦР) использовали PerfeCTa SYBR Green FastMix (Quanta). КПЦР проводили на машине QuantStudio 6 Flex для ПЦР в реальном времени. Используемые праймеры перечислены в дополнительной таблице 3. Образцы нормализовали до экспрессии HPRT1 и CREBP .Экспрессию гена рассчитывали методом ddCt. 51 Столбики погрешностей представляют стандартное отклонение от трех технических повторов.

Секвенирование и анализ РНК

Тотальную РНК из четырех образцов на линию иПСК готовили с использованием набора GENEzol TriRNA Pure. Качество (число целостности РНК), концентрацию и чистоту (OD260/230 и OD260/280) РНК определяли на приборах Bioanalyser (РНК-наночип), Qubit и Nanodrop. Подготовку библиотеки и секвенирование выполняли на коммерческой основе (New Zealand Genomics Limited, Отаго, Новая Зеландия).Библиотеки были приготовлены с использованием стандартного набора для тотальной РНК TruSeq со стандартными протоколами (Illumina). Секвенирование парных концов (2×125 п.н.) проводили на секвенаторе Illumina HiSeq 2500. Чтения были отфильтрованы адаптером и усечены по качеству с использованием BBDuk версии 37.75 с отсечкой качества phred=10 (trimq=10) и, чтобы уменьшить потенциальные ошибки картирования, все чтения <50 п.н. после обрезки были удалены. Чтения, отфильтрованные для контроля качества, были сопоставлены с геномом человека (GRCh48), загруженным с сайта ENSEMBL (www.ensembl.org/Homo_sapiens/Info/Index) с использованием HISAT2 (версия 2.0.5) в режиме многоцепочечного картирования (–rna-strandness RF). Счетчики прочтений были сгенерированы из файлов выравнивания с использованием HT-Seq (версия 0.6.0) в режиме Union, а для параметра пряди установлено значение «reverse». DESeq2 использовали для генерации вызовов дифференциальной экспрессии и статистики для сравнения контроля и нокаута на основе наблюдаемого количества прочтений для каждого гена. Изменения экспрессии были признаны значимыми для q -значение <0,05. Тепловые карты были сгенерированы в R с использованием файла pheatmap_1.пакет 0,8. Обогащение терминов Gene Ontology (GO) было проанализировано с использованием пакета R goseq (версия 1.22). Обогащение было протестировано для всех дифференциально экспрессируемых генов со значением P с поправкой на частоту ложных открытий <0,05. Термины GO также были скорректированы на коэффициент ложных открытий с той же скоростью.

Статистический анализ

Данные представлены как среднее ± стандартная ошибка среднего. Программное обеспечение GraphPad PRISM версии 7 (GraphPad Software) использовалось для всех статистических анализов. Статистическую значимость различий между двумя группами рассчитывали с помощью непарного теста t .Для трех или более групп использовали однофакторный дисперсионный анализ. Значение P <0,05 считалось статистически значимым.

Результаты

Получение линий

CTNS -iPSC

Индивидуальные для пациента CTNS iPSC были получены, как описано в методах, из мезенхимальных клеток жировой ткани, выращенных из образца жира пациента с нефропатическим цистинозом, перенесшего трансплантацию почки. Секвенирование экзонов выявило составную гетерозиготность по двум описанным мутациям CTNS : делеции 57 т.п.н. и миссенс-мутации L158P в экзоне 8. 2 Клетки были перепрограммированы в ИПСК, и были идентифицированы три CTNS -/- линий (36, 108, 157) с нормальным кариотипом (результаты не показаны). Все три линии окрашивались положительно на маркеры плюрипотентности щелочной фосфатазы, SSEA-4, Tra-1-60 и Tra-1-81 и давали тератомы, содержащие ткани всех трех зародышевых листков (рис. 1, A, B и D, данные для CTNS −/− 36). Повторная экспрессия эндогенных OCT4 , NANOG , SOX2 , CMYC и KLF4 была подтверждена количественной ПЦР (рис. 1C, репрезентативные данные для -6 CTNS

1/

).Поскольку все эти линии демонстрировали сходные фенотипы, для последующих анализов использовали линию 36 (здесь она называется CTNS -/- ). В дополнение к линиям, специфичным для пациентов, мы также создали независимые линии CTNS -KO, выполнив редактирование гена CRISPR/Cas9 в ИПСК CRL1502. 42 гРНК использовали для введения делеции размером 257 п.н. в экзон 8 и 9 гена CTNS , что привело к делеции второго трансмембранного домена (рис. 1, E и F). Три линии с гомозиготными делециями (KO 15, 32 и 73) были идентифицированы с помощью секвенирования по Сэнгеру.Поскольку все три линии нокаута CTNS ( CTNS KO ) демонстрировали схожий фенотип (дополнительный рисунок 1, A, B и C), линия CTNS KO KO73 использовалась для последующих экспериментов.

Рисунок 1.

Полученные от пациента CTNS ИПСК демонстрируют маркеры плюрипотентности. (A) CTNS -/- ИПСК, окрашенные на поверхностные антигены стволовых клеток SSEA-4, TRA-1-60 и TRA-1-81. Масштабная линейка, 500 мкм мкм. (B) CTNS -/- ИПСК, окрашенные на щелочную фосфатазу.Масштабная линейка, 500 мкм мкм. (C) qPCR эндогенных генов относительно экспрессии HPRT1 . Нанесенные данные представляют собой среднее значение ± стандартное отклонение. (D) Окрашенные гематоксилином и эозином гистологические срезы опухолей, полученных от мышей SCID после инъекции CTNS -/- иПСК под капсулу почки. Были идентифицированы все три зародышевых листка: мезодерма, энтодерма и эктодерма ( n =3). Масштабная линейка, 100 мкм мкм. (E) Схематический обзор основанной на CRISPR стратегии по разрушению гена CTNS в ИПСК дикого типа.Степень делеции экзона 8 и экзона 9 отмечена черными стрелками. (F) Хроматограмма секвенирования по Сэнгеру показывает результирующую последовательность в CTNS KO iPSCs. PAM, мотив, прилегающий к протоспейсеру.

CTNS ИПСК Загрузка цистина

Цистин измеряли в цистинозных и контрольных ИПСК с помощью ВЭЖХ-тандемной масс-спектрометрии, обнаруживая в 33–54 раза более высокие уровни в CTNS −/− 5 4 и

3 CT ИПСК по сравнению с контрольными клетками CRL1502 (рис. 2А, дополнительная таблица 4).Чтобы оценить, реагируют ли уровни цистина на цистеамин, иПСК CTNS обрабатывали диапазоном доз цистеамина (10 мк М, 100 мк М и 1 мМ) в течение 1 или 24 часов. В то время как 10 мкМ М цистеамина не влияли на уровни цистина, 100 мкМ М и 1 мМ снижали уровень цистина, при этом 1 мМ был наиболее эффективным и значительно снижал уровни цистина в CTNS -/- и CTNS KO иПСК (рис. 2А, дополнительная рис. 1, D и E).

Рисунок 2.

CTNS ИПСК демонстрируют накопление цистина и увеличенные лизосмы. (A) Количество цистина (нмоль/мг белка) в ИПСК дикого типа (WT), CTNS -/- иПСК и CTNS KO иПСК с различными обработками (1 мМ цистеамин; 100 нМ эверолимус; комбо, 1 мМ цистеамина и 100 нМ эверолимуса; 24 часа). Выполнен однофакторный дисперсионный анализ, данные нанесены как среднее ± стандартная ошибка среднего, три независимых эксперимента. ** Р <0,01, *** Р <0.001, **** Р <0,0001. (B) График, показывающий количественную оценку среднего количества везикул Magic Red (лизосом) на клетку в течение 10 мк м 2 . Выполнен односторонний ANOVA ( n = 600 клеток из восьми-десяти случайных полей на условие, 20 клеток на поле, три независимых эксперимента), данные нанесены на график как среднее значение ± стандартная ошибка среднего. *** P =0,001, WT контроль по сравнению с CTNS -/- контроль ; ** P <0,01, контроль WT по сравнению с контролем CTNS KO ; $ P <0.05, CTNS -/- контроль по сравнению с CTNS -/- 1 мМ цистеамин и CTNS -/- комбинация; $$$ P <0,001, CTNS -/- контроль против CTNS -/- 100 нМ эверолимуса; # P <0,05, CTNS KO контроль против CTNS KO 1 мМ цистеамин и CTNS 5 -/- комбинация 90; ### P <0.001, CTNS KO контроль по сравнению с CTNS KO 100 нМ эверолимуса. (C–H) Репрезентативные изображения флуоресцентного окрашивания Magic Red в контроле WT, CTNS KO в контроле и CTNS KO с обработкой (1 мМ цистеамин; 100 нМ эверолимус; комбинация, 1 мМ цистеамин и 100 нМ). нМ эверолимуса; 24 часа) и ИПСК дикого типа, обработанных 50 мМ сахарозой в течение 24 часов. Масштабная линейка, 10 мкм мкм. (I) Репрезентативное иммунофлуоресцентное окрашивание анти-LAMP1 (зеленый) в иПСК дикого типа и (J) CTNS -/- и (K) CTNS KO иПСК соответственно.Стрелкой указаны увеличенные везикулы. Масштабная линейка, 10 мкм мкм. (L и M) Трансмиссионная электронная микрофотография (L) WT и (M) CTNS -/- ИПСК, показывающая увеличенные везикулы. Масштабные линейки, 5 µ м в (L) и 1 µ м в (M). (N) График, показывающий количественную оценку среднего количества везикул Magic Red на клетку в течение 10 мкм м 2 в иПСК WT и CTNS -/- иПСК, сверхэкспрессирующих пустой вектор (pcDNA 3.1) или экзогенный CTNS-GFP. Выполнен однофакторный ANOVA ( n =300 клеток из пяти-восьми случайных полей на условие, 20 клеток на поле, три независимых эксперимента), данные нанесены как среднее значение ± стандартная ошибка среднего. *** Р <0,001, **** Р <0,0001. (O) Среднее количество везикул Magic Red на клетку более 10 мкм м 2 . ИПСК дикого типа, обработанные 50 мМ сахарозой или сахарозой и 100 нМ эверолимусом в течение 24 часов. Выполнен однофакторный дисперсионный анализ ( n =300 клеток из пяти случайных полей на условие, 20 клеток на поле, три независимых эксперимента), все данные нанесены на график среднего ± стандартная ошибка среднего.* Р <0,05, ** Р <0,01. CTN S KO , CRISPR-генерированные цистинозные KO иПСК. Контрастное окрашивание ядер в (C-H) и (I-K) было Hoechst.

CTNS ИПСК демонстрируют увеличенные лизосомы

Для оценки размера и распределения лизосом в цистинозных ИПСК и для функционального подтверждения их лизосомной идентичности клетки инкубировали с Magic Red, субстратом, который расщепляется катепсином В и флуоресцирует внутри лизосомы и эндолизосомы.Увеличенные точки Magic Red + чаще наблюдались в CTNS iPSC по сравнению с контролем и имели тенденцию группироваться в перинуклеарном месте (рис. 2, B, C и D). Количественное определение подмножества увеличенных лизосом, определяемых как имеющие оптическую площадь поперечного сечения >10 мкм м 2 , показало, что среднее число на клетку было примерно в 2,5 раза выше в CTNS иПСК по сравнению с контролем (рис. 2Б). Чтобы дополнительно подтвердить, что эти структуры являются лизосомами, мы исследовали цистинозные ИПСК с лизосомальным маркером LAMP1 с помощью иммунофлуоресценции и на ультраструктурном уровне с помощью электронной микроскопии. CTNS -/- и CTNS KO ИПСК содержат смесь мелких и увеличенных точек LAMP1 + , тогда как контрольные ИПСК показывают качественно меньше увеличенных точек 8 LAMP1 901 I, J и К). В соответствии с данными LAMP1 и Magic Red, мы наблюдали большие тельца, подобные деградации/накоплению, в CTNS -/- , но не в контрольных ИПСК с помощью электронной микроскопии (рис. 2, L и M). Как и ожидалось от дисфункциональных лизосом, эти тельца содержат электронно-плотный материал, внутрипросветные везикулы и непереваренные мембраны и, вероятно, представляют собой увеличенные лизосомы и/или амфизомы (рис. 2М).Чтобы показать, что этот фенотип связан с потерей цистинозина, мы провели эксперименты по спасению путем трансфекции CTNS iPSC плазмидой, кодирующей цистинозин-GFP, и провели анализ через 24 часа. 52 Сверхэкспрессия цистинозина-GFP, который колокализуется с Magic Red + puncta (дополнительная фигура 1, G – J), уменьшала количество увеличенных лизосом до уровней ниже, чем в контрольных ИПСК (рисунок 2N).

Для оценки проникновения через эндоцитоз CTNS иПСК и контрольные иПСК инкубировали с DQ-BSA, жидкофазным зондом, который становится флуоресцентным, когда достигает лизосомы, в течение 3 часов. 53 Количественный анализ положительных точек на клетку показал, что иПСК CTNS имели одинаковое количество точек по сравнению с контрольными иПСК (в среднем 5,6 общих точек на клетку для иПСК CTNS и 7,8 общих точек на клетку для контрольных иПСК; дополнительная фигура 1, К–М). Этот результат согласуется с тем, что эндоцитарный поток жидкофазных грузов по эндоцитарному пути является относительно нормальным в CTNS iPSCs, несмотря на наличие увеличенных лизосом.

Затем мы попытались фенокопировать фенотип увеличенных лизосом CTNS iPSCs в клетках дикого типа, используя сахарозу, которая накапливается в лизосомах нормальных клеток. 54,55 Обработка контрольных ИПСК 50 мМ сахарозы в течение 24 часов приводила к увеличению числа увеличенных лизосом, подобно тому, что наблюдалось в CTNS ИПСК, но не влияла на нагрузку цистином (рис. 2, A, С, Н и О). Это наблюдение подтверждает идею о том, что фенотип увеличенных лизосом CTNS iPSCs обусловлен накоплением цистина. Чтобы подтвердить это, обработка иПСК CTNS 1 мМ цистеамином в течение 24 часов привела к снижению среднего числа увеличенных лизосом на клетку, хотя и не полностью восстановила контрольные уровни (рис. 2, B и E).Обработка цистеамином не оказала существенного влияния на общее количество лизосом на клетку (дополнительная фигура 1F).

GSH, АТФ, апоптоз и митохондрии в

CTNS иПСК

Затем мы исследовали GSH, АТФ, апоптоз и митохондрии, поскольку предыдущие сообщения предполагают, что они изменены в цистинотических клетках. 9,15⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓–27 Количественно определяли уровни GSH (окисленного и восстановленного), АТФ и апоптоза, тогда как митохондрии оценивали качественно с помощью просвечивающей электронной микроскопии и иммуногистохимии.Никаких существенных различий не наблюдалось с GSH (дополнительная фигура 1, N и O) или АТФ (дополнительная фигура 1P). Апоптоз был количественно определен с использованием анализа обнаружения ApopTag, и количественный анализ положительных точек на клетку показал, что CTNS iPSC демонстрируют более чем в 1,4 раза более высокие уровни апоптоза по сравнению с контролем (дополнительная фигура 1Q). Лечение цистеамином не смогло снизить степень апоптоза. Никаких явных различий в митохондриальной морфологии не наблюдалось в иПСК CTNS по сравнению с контролем (дополнительная фигура 1, RU).

Анализ секвенирования РНК выявил дифференциально регулируемые гены в

CTNS KO iPSC

CTNS KO иПСК и их изогенные контрольные клетки ( n = 4 биологических повтора для каждого; номер доступа к биопроекту Национального центра биотехнологической информации PRJNA5

).Мы обнаружили в общей сложности 12 750 дифференциально экспрессируемых генов, 8792 из которых значительно активировались, а 3958 значительно подавлялись ( P <0,05) по сравнению с контролем. Киотская энциклопедия генов и геномов выявила несколько значительно обогащенных путей в CTNS KO иПСК, которые включают рибосомы, сплайсосомы, протеасомы, окислительное фосфорилирование, процессинг белков в эндоплазматическом ретикулуме и убиквитин-опосредованный протеолиз (отсечка P <1×10 -6 , таблица 1).Интересно, что пути, связанные с болезнью Хантингтона, Паркинсона и Альцгеймера, были обогащены. 56 Анализ обогащения терминов GO дал гораздо более обширный список наборов генов, который было труднее обобщить (данные не показаны). Однако в категории «биологический процесс» мы обнаружили обогащение путей, связанных с цистинозом, включая аутофагию, транспортировку везикул, окислительно-восстановительный гомеостаз, путь mTOR и катаболизм белков (таблица 2).

Таблица 1.

Киотская энциклопедия путей генов и геномов, значительно обогащенная CTNS KO iPSC (отсечка P <1×10 -6 )

Таблица 2.

Термины GO в категории биологических процессов, обогащенные CTNS KO iPSCs

Затем мы исследовали, могут ли некоторые из дифференциально экспрессируемых генов быть полезными в качестве молекулярных биомаркеров цистинотического фенотипа. Из 50 наиболее дифференциально экспрессируемых генов (дополнительная фигура 2) мы сосредоточились на DDIT3 (также известном как CHOP ), который кодирует фактор транскрипции, относящийся к «интегрированному стрессовому ответу», участвующему в клеточной адаптации к стрессу. 57 Кроме того, мы идентифицировали две нижестоящие мишени DDIT3 : TRIB3 , кодирующие псевдокиназу, которая действует как регулятор с отрицательной обратной связью DDIT3 , 58 и CHAC1 , кодирующий фермент, разлагающий GSH. 59 С помощью количественной ПЦР мы независимо подтвердили, что DDIT3 , TRIB3 и CHAC1 были значительно активизированы в CTNS иПСК по сравнению с контрольными иПСК (рис. 3А, дополнительная фигура 3А).Чтобы оценить, реагирует ли экспрессия этой триады генов на цистеамин, мы обработали иПСК CTNS 1 мМ цистеамином в течение 24 часов и обнаружили, что они значительно снизились до почти контрольных уровней. Инкубация контрольных ИПСК с 50 мМ сахарозы в течение 24 часов также приводила к значительному усилению DDIT3 , TRIB3 и CHAC1 , что указывает на то, что эти гены, хотя и не являются специфическими биомаркерами цистинотических клеток per se , могут « считывать» лизосомную дисфункцию, вызванную накоплением субстратов (рис. 3В).

Рисунок 3.

CTNS ИПСК демонстрируют нарушение регуляции генов. (A) количественная ПЦР интересующих генов — DDTI3 , TRB3 и CHAC1 — в ИПСК дикого типа (WT) и CTNS -/- ИПСК с различными обработками (1 мМ цистеамина; нМ эверолимус: комбинация, 1 мМ цистеамин и 100 нМ эверолимус; 24 часа) нормализовано до HPRT и CREEBP и выражено как кратное изменение WT. Выполнен однофакторный дисперсионный анализ, данные нанесены на график как среднее значение ± стандартное отклонение.**** P <0,0001 по сравнению с относительным контролем WT; $$$$ P <0,0001 по сравнению с контролем CTNS KO . (B) КПЦР-анализ генов-мишеней в ИПСК дикого типа, обработанных 50 мМ сахарозой в течение 24 часов. Выполнен двусторонний непарный тест t , данные нанесены как среднее ± стандартное отклонение. *** Р <0,001, **** Р <0,0001. (C) Сложите изменения выбранных генов аутофагии из РНК-seq, которые дерегулируются в CTNS KO iPSCs.

Путь mTORC1 не изменяется в

CTNS iPSCs

Более тщательное изучение генов аутофагии, идентифицированных в результате анализа термина GO, показало, что CTNS KO iPSCs демонстрируют небольшое усиление регуляции MTOR4, а также MTOR4 мишени ( ULK1 и ATG13 ) по сравнению с контрольными клетками (рис. 3C). Чтобы оценить активность mTORC1 в иПСК CTNS , мы провели вестерн-блоттинг в трех повторах для фосфорилированных S6, RPS6, 4EBP-1 и EIF4e (все нижележащие мишени mTORC1) в исходных условиях и после голодания в течение 60 минут с последующим возобновлением питания. 60,61 Мы не обнаружили статистической разницы в уровнях p-S6, p-RPS6, p-4EBP-1 и p-EIF4e между цистинозными ИПСК и контрольными клетками в исходных условиях (дополнительная фигура 3B) и, в отличие от предыдущих отчетов , 40,41 мы не обнаружили задержки реактивации mTORC1 через 2,5, 7, 12 или 15 минут после повторного кормления (дополнительная фигура 3B и данные не показаны). В совокупности эти наблюдения указывают на отсутствие значительных дефектов в активности mTORC1 в CTNS iPSC в исходных условиях или после голодания.

Базальный поток аутофагии нарушен в

CTNS iPSC

Среди генов, связанных с аутофагией, идентифицированных в анализе термина GO, есть гены, участвующие в процессах аутофагии от ранних до поздних, включая образование аутофагосом ( SQSTM1 , BECLIN1 , BECLIN1

). , LC3B , RAB7A ), Движение ( HDAC6 ), и привязка и слияние ( RUBICON , UVRAG , VPS16 , VAMP8 , STX17 , TSNARE 1, STX 17, SNAP29 ; эти и другие показаны на рисунке 3C).В большинстве случаев эти гены активируются в CTNS KO ИПСК по сравнению с контролем (рис. 3C). Примечательно, что увеличение SQSTM1/p62 может свидетельствовать о блокировании потока аутофагии.

Чтобы изучить базальные уровни аутофагии, мы сначала измерили уровни специфического для аутофагосом белка LC3B-II с помощью вестерн-блоттинга. В соответствии с данными секвенирования РНК мы обнаружили более высокие уровни LC3B-II в CTNS -/- иПСК по сравнению с контрольными иПСК, что указывает либо на увеличение количества аутофагосом, либо на уменьшение деградации аутофагосом (рис. 4А).Чтобы количественно определить количество аутофагосом и аутолизосом, мы трансфицировали иПСК CTNS и контрольные иПСК плазмидой, кодирующей датчик mCherry-LC3B-GFP, который флуоресцентно маркирует аутофагосомы желтым цветом, а аутолизосомы — красным. 62 Через 24 часа после трансфекции клетки были проанализированы, и мы обнаружили, что в исходных условиях CTNS -/- клетки имеют примерно в 2,6 раза более высокие уровни желтых точек (аутофагосом) по сравнению с контрольными ИПСК (рис. 4, В и С).

Рисунок 4.

Базальная аутофагия дисфункциональна в CTNS iPSCs. (A) Репрезентативный вестерн-блот против маркера аутофагосомы LC3B-II и β -актина из ИПСК дикого типа (WT) и CTN S и график, отображающий количественную оценку трех независимых экспериментов. (B и C) Процент клеток с точками только желтого цвета (аутофагосомы) и точками только красного цвета (аутолизосомы), обработанных ДМСО или 400 нМ BafA1 в течение 4 часов (представитель n = 30 клеток, из десяти случайных полей на условие содержащие примерно от одной до трех клеток в трех независимых экспериментах).Выполнена односторонняя AVOVA, данные средние ± SEM. **** P <0,0001 относительно ДТ. (D) Клетки, трансфицированные тандемной плазмидой mCherry-LC3B-GFP, с красными и желтыми точками. Контрокрашивание ядер представляло собой 4',6-диамидино-2-фенилиндол. Масштабная линейка, 10 мкм мкм. (E и F) Процент только желтых и красных точек после экзогенной экспрессии CTNS в CTNS -/- iPSCs. Выполнен двусторонний непарный тест t , данные средние ± стандартная ошибка среднего. * Р <0.05. (G) Обработка сахарозой (50 мМ) в течение 24 часов на иПСК дикого типа для индуцирования цистинотического фенотипа. Показан процент только желтых точек. Выполнен двусторонний непарный тест t , данные средние ± стандартная ошибка среднего. **** Р <0,0001. (H и I) Влияние медикаментозного лечения на процентное содержание желтых и красных точек; CTNS ИПСК, обработанные одним 1 мМ цистеамином, 100 нМ только эверолимусом или их комбинацией в течение 24 часов. Выполнен однофакторный ANOVA, данные нанесены на график как среднее ± SEM ( n = 30 клеток из десяти случайных полей на условие, содержащее приблизительно от одной до трех клеток в трех независимых экспериментах).**** P <0,0001, WT против CTNS -/- и CTNS KO ; $$$$ P <0,0001, CTNS −/− по сравнению с CTNS −/− 100 нМ эверолимуса и CTNS

90 комбинация; #### P <0,0001, CTNS KO по сравнению с CTNS KO 100 нМ эверолимуса и CTNS 6,9015 KO (J и K) Среднее количество везикул Magic Red на клетку более 10 мкм м 2 в иПСК дикого типа и CTNS -/- или CTNS KO иПСК, обработанных мММ 3 и -3 100 нМ эверолимуса в течение 24 часов. Выполнена односторонняя AVOVA, значения являются средними ± SEM ( n =300 клеток из пяти-восьми случайных полей на условие, 20 клеток на поле, три независимых эксперимента). * Р <0,05, ** Р <0,01, *** Р <0.001.

Чтобы оценить поток через путь аутофагии, мы обработали CTNS иПСК и контрольные иПСК, экспрессирующие датчик mCherry-LC3B-GFP, 400 нМ BafA1 63 в течение 4 часов. Хотя BafA1 индуцировал 2,7-кратное увеличение процента желтых точек в контрольных иПСК по сравнению с клетками, обработанными носителем (ДМСО), в CTNS иПСК наблюдалось лишь небольшое, но незначительное увеличение (рис. 4, B, C и D). . Чтобы подтвердить, что дефект аутофагии был специфичен для потери ЦИСТИНОЗИНА, мы котрансфицировали CTNS -/- ИПСК плазмидой, кодирующей цистинозин, pCMV-CFP (для отслеживания трансфицированных клеток) и mCherry-LC3B-GFP, в результате чего примерно в 1.Снижение процента желтых точек в 2 раза (рис. 4, Д и Е). Взятые вместе, эти результаты показывают, что потеря CYSTINOSIN в iPSCs вызывает накопление аутофагосом в исходных условиях из-за уменьшения слияния лизосом с аутофагосомами.

Базальный блок аутофагии в CTNS иПСК может быть вызван накоплением цистина в лизосомах. Чтобы изучить это, мы обработали контрольные иПСК 50 мМ сахарозой в течение 24 часов, а затем трансфицировали их сенсором mCherry-LC3B-GFP.Мы обнаружили, что процент желтых точек увеличился в 1,5 раза в клетках, нагруженных сахарозой, по сравнению с контрольными клетками, что свидетельствует о снижении базального потока аутофагии (рис. 4G). Учитывая это, мы затем проверили, улучшит ли лечение цистеамином базальный дефект аутофагического потока CTNS iPSC, трансфицированных датчиком mCherry-LC3B-GFP. Неожиданно мы обнаружили, что лечение цистеамином не значительно улучшило базальный поток аутофагии (рис. 4, H и I). Мы пришли к выводу, что базальный дефект аутофагии в CTNS iPSC вызван потерей цистинозина, но это не может быть улучшено обработкой цистеамином.

Дефекты базального потока аутофагии устранены в

CTNS иПСК с помощью ингибирования mTORC1 аутофагия через ингибирование mTORC1 может обеспечить дополнительный терапевтический эффект. Чтобы проверить это, мы обрабатывали иПСК CTNS в течение 24 часов 100 нМ эверолимуса и исследовали базальный поток аутофагии.Мы обнаружили, что эверолимус восстанавливает количество желтых точек (аутофагосом) до контрольных уровней и, соответственно, увеличивает количество аутолизосом, что согласуется с аналогичными результатами, полученными при использовании Ctns -/- мышиных фибробластов (рис. 4, H и I). 33 Важно отметить, что двойное лечение 1 мМ цистеамином и 100 нМ эверолимусом имело такие же эффекты, как и эверолимус в отдельности, без каких-либо признаков комбинированной токсичности (рис. 4, H и I).

Уровни цистина остаются высокими в

CTNS иПСК после ингибирования mTORC1

Затем мы оценили уровни цистина в клетках, обработанных эверолимусом и комбинированных клетках, обработанных эверолимусом/цистеамином.Эверолимус сам по себе не оказывал значительного влияния на уровни цистина в CTNS KO иПСК, но вызывал 1,5-кратное увеличение в CTNS -/- иПСК (рис. 2А). Комбинированное лечение снижало уровень цистина в обеих цистинозных линиях ИПСК до уровней, аналогичных лечению только цистеамином (рис. 2А), что указывает на то, что активация пути mTORC1 не влияет на способность цистеамина истощать цистин.

Ингибирование mTORC1 уменьшает увеличение лизосом в

CTNS -iPSCs посредством Аутофагия

Затем мы исследовали влияние лечения эверолимусом на фенотип увеличенных лизосом.Мы обнаружили, что эверолимус снижает среднее количество увеличенных лизосом до уровня, близкого к нормальному, что делает его более эффективным, чем один только цистеамин (рис. 2В). Качественно мы обнаружили, что эверолимус уменьшал перинуклеарную кластеризацию лизосом, но это не могло быть определено количественно из-за высокой плотности клеток и небольшого объема цитоплазмы в культурах ИПСК (рис. 2F).

Комбинированная обработка эверолимусом/цистеамином дала промежуточные результаты с примерно двукратным снижением по сравнению с необработанными CTNS иПСК, что указывает на то, что цистеамин препятствует способности эверолимуса уменьшать количество увеличенных лизосом (рис. 2, B и G).Кроме того, лечение эверолимусом уменьшало количество увеличенных лизосом, вызванных загрузкой сахарозой, что свидетельствует о том, что его воздействие на лизосомы не является специфичным для цистинотических клеток (рис. 20). Лечение не влияло на общее количество лизосом (дополнительный рисунок 1F.

). Чтобы определить, зависит ли действие эверолимуса на увеличенные лизосомы от аутофагии, мы исследовали эффекты 3-метиладенина (3-МА), ингибитора аутофагии, который действует после mTORC1. 64 Сначала мы обрабатывали контроль и CTNS иПСК в течение 24 часов только 30 мМ 3-MA.Мы наблюдали примерно четырех-пятикратное увеличение количества увеличенных лизосом на клетку в контрольных иПСК, тогда как уровни в CTNS / и CTNS KO иПСК значительно не увеличивались (рис. 4, J и K). Лечение иПСК CTNS как 3-MA, так и эверолимусом не оказало существенного влияния на количество увеличенных лизосом (рис. 4, J и K), что дает убедительные доказательства того, что эффекты эверолимуса опосредованы посредством стимуляции аутофагии.

Эверолимус снижает уровень апоптоза в

CTNS иПСК

Эверолимус отдельно и в сочетании с лечением снижает уровень апоптоза в CTNS иПСК (дополнительный рисунок 1Q), что указывает на то, что цистеамин не влияет на способность эверолимуса снижать апоптоз .

Эверолимус снижает экспрессию

CHOP, TRB3, и CHAC1 в CTNS иПСК

Затем мы оценили влияние эверолимуса в отдельности и комбинированного лечения эверолимусом/цистеамином на экспрессию DDIT3 и TRB3 ЧАС1 .Как в ИПСК CTNS -/- , так и в CTNS KO эверолимус в отдельности и в сочетании с лечением значительно снижали уровни экспрессии триады генов до почти контрольных уровней, в соответствии с представлением о том, что эти гены обеспечивают считывание дисфункции лизосом в иПСК (рис. 3А, дополнительная рис. 3А).

Характеристика цистинотических почечных органоидов

Установив потенциальные терапевтические эффекты комбинированного лечения эверолимусом/цистеамином в CTNS iPSC, мы затем оценили, будут ли эти соединения демонстрировать эффективность в отношении цистинозной почечной ткани человека, используя разработанный нами протокол почечных органоидов. 46 Используя этот подход, мы созрели CTNS -/- , CTNS KO и контрольные клетки в почечные органоиды в течение 14 дней. 46 Подобно нашим результатам, полученным с недифференцированными ИПСК CTNS , мы обнаружили, что органоиды CTNS -/- и CTNS KO также демонстрируют нагрузку цистина, но не показывают различий в соотношении GSH/GSH дисульфида по сравнению с изогенными контрольными органоидами (рис. 5А, дополнительная таблица 4 и рис. 3С).

Рисунок 5.

Цистинозные почечные органоиды, полученные из CTNS ИПСК, демонстрируют повышенное содержание цистина, увеличенные лизосомы, базальные дефекты аутофагии и нарушение регуляции генов. (A) Количество цистина (нмоль/мг белка) в органоидах дикого типа (WT), CTNS -/- и CTNS KO при различных обработках. Выполнен односторонний ANOVA, данные нанесены как среднее ± стандартная ошибка среднего, n = 30 органоидов на эксперимент, три независимых эксперимента. ** Р <0.01, *** Р <0,001, **** Р <0,0001. (B) Репрезентативные электронные микроскопические изображения WT, CTNS -/- и CTNS KO органоидов, показывающие увеличенные мультивезикулярные тела (черные стрелки). Масштабная линейка, 5 µ м в (A) и 2 µ м в (B). (C) Среднее количество везикул Magic Red на клетку в 10 мкм м 2 в WT, CTNS -/- и (D) CTNS KO органоидов.Выполнена односторонняя AVOVA, значения средние ± SEM ( n =300 клеток из десяти случайных полей на условие, десять клеток на поле, три независимых эксперимента). * Р <0,05, ** Р <0,01, *** Р <0,001. (E и F) Влияние 1 мМ цистеамина, 100 нМ эверолимуса и комбинированного лечения в течение 24 часов на поток аутофагии, определяемый процентом желтых и красных точек на 14-й день CTNS -/- и CTNS КО органоиды.Выполнен однофакторный ANOVA, все данные нанесены на график как среднее ± SEM ( n = 30 клеток из десяти случайных полей на условие, содержащее приблизительно от одной до трех клеток в трех независимых экспериментах). * Р <0,05, ** Р <0,01. (G) КПЦР представляющих интерес генов в контроле CTNS -/- органоидов с различными обработками, выраженная как кратное изменение по сравнению с контролем, данные представлены как среднее ± стандартное отклонение. Выполнен однофакторный дисперсионный анализ, данные нанесены на график как среднее значение ± стандартное отклонение. * Р <0.5, ** P <0,01, **** P <0,0001 по сравнению с относительным контролем WT; $ P <0,5, $$ P <0,01, $$$$ P <0,0001, по сравнению с CTNS 1 -/-6 контроль . (H) количественная ПЦР мегалина ( LRP 2) и кубилина ( CUBN ) с различными обработками, выраженная как кратное изменение по сравнению с контролем. Выполнен однофакторный дисперсионный анализ, данные нанесены на график как среднее значение ± стандартное отклонение. ** Р <0,01, *** Р <0.001 по сравнению с относительным контролем WT; $ P <0,5, $$ P <0,01, $$$ P <0,001 по сравнению с относительным контролем CTNS .

На уровне световой микроскопии органоиды почек CTNS -/- и CTNS KO кажутся эквивалентными органоидам контрольной группы, и мы не видим признаков аномалий, таких как характерная цистинотическая «лебединая шея». поражение (данные не показаны).На ультраструктурном уровне митохондрии в органоидах CTNS демонстрируют количество и морфологию, аналогичные контрольным (дополнительная фигура 4A). Тем не менее, мы качественно наблюдали наличие многочисленных увеличенных вакуолей в канальцах цистинозных органоидов, напоминающих тельца, подобные деградации / хранению, наблюдаемые в CTNS iPSC, тогда как они редко наблюдаются в контрольных органоидах (рис. 5B).

Дефектный эндоцитоз, еще один признак цистиноза, 11,12 первоначально исследовали путем инкубации CTNS KO почечных органоидов с 10 кДа декстраном, меченым Texas Red, который специфически поглощается LTL + 901 проксимальными канальцами . 65 Никакой разницы в поглощении декстрана не наблюдалось в цистинозных органоидах по сравнению с контролем, что позволяет предположить, что абсорбционная функция проксимальных канальцев за счет жидкофазного эндоцитоза не повреждена (дополнительная фигура 4, B и C). Рецепторно-опосредованный эндоцитоз с использованием флуоресцентно меченого альбумина или трансферрина не был технически успешным в наших руках, однако иммуноокрашивание эндоцитарного рецептора CUBN и маркера дистальных канальцев CDH 1 согласовывалось с ненарушенной сегментацией канальцев и поляризацией в цистинозных органоидах (Дополнительная информация). Рисунок 4D).Экспрессию CUBN и LRP2 исследовали в органоидах с помощью количественной ПЦР. Органоиды iPSC- CTNS KO показали нормальную экспрессию LRP 2 и значительно сниженную экспрессию CUBN по сравнению с изогенным контролем, тогда как органоиды iPSC- CTNS -/- показали значительно более высокие уровни обоих генов контроль (рис. 5H).

Для количественной оценки увеличенных лизосом в цистинозных органоидах мы диссоциировали ткань на 12-й день на отдельные клетки и на 14-й день инкубировали их в Magic Red в течение 1 часа.Мы обнаружили, что органоида CTNS демонстрируют примерно в два-три раза больше увеличенных лизосом по сравнению с контрольными органоидами (рис. 5, C и D, дополнительная фигура 4E).

Чтобы определить, затрагивается ли базальный поток аутофагии в органоидах почек CTNS , мы реверсировали трансфицированные диссоциированные отдельные клетки с помощью сенсорной плазмиды mCherry-LC3B-GFP. Мы обнаружили, что цистинозные органоидные клетки почек демонстрируют примерно в 1,5–2 раза больше аутофагосом по сравнению с контрольными органоидными клетками, что согласуется с дефектом базальной аутофагии (рис. 5, E и F, дополнительная фигура 4F).

Затем мы оценили экспрессию мРНК DDIT3 , TRB3 и CHAC1 в цистинозных и контрольных почечных органоидах с использованием количественной ПЦР. Мы обнаружили, что DDIT3 и CHAC1 были значительно увеличены в цистинозных почечных органоидах по сравнению с контролем (рис. 5G, дополнительная фигура 3D). TRB3 не активировался, что указывает на то, что этот ген может быть полезен только в качестве биомаркера лизосомной дисфункции в определенных типах клеток.

Затем мы изучили влияние однократного и комбинированного лечения цистеамином и эверолимусом на органоиды почек CTNS в отношении фенотипов нагрузки цистином, экспрессии CUBILIN и LRP 2, увеличенных лизосом, базального потока аутофагии и DDIT3 , TRB3 и CHAC1 .С этой целью мы обработали 13-й день CTNS и органоиды контрольной почки 1 мМ цистеамина, 100 нМ эверолимуса или комбинацией обоих препаратов в течение 24 часов. В соответствии с нашими наблюдениями в иПСК CTNS , мы обнаружили, что цистеамин сам по себе и в сочетании с эверолимусом снижал уровни цистина, тогда как при лечении только эверолимусом эффекта не наблюдалось (рис. 5А). Лечение не влияло на поглощение декстрана или уровни CUBN с помощью иммунного окрашивания (дополнительная фигура 4, B и C), и не наблюдалось последовательных тенденций для транскриптов CUBN и LRP2 с помощью количественной ПЦР (рисунок 5H).Только цистеамин или эверолимус и комбинированное лечение уменьшали количество увеличенных лизосом (рис. 5, C и D, дополнительная рис. 4E). Один только эверолимус активировал аутофагию, как и комбинированное лечение, но один только цистеамин не имел эффекта (рис. 5, E и F, дополнительная рис. 4F). КПЦР-анализ обработанных почечных органоидов показал, что уровни экспрессии DDIT3 и CHAC1 нормализовались до значений, близких к контрольным, в ответ на лечение только цистеамином и комбинированное лечение, а также лечение только эверолимусом в случае CTNS . -/- органоидов.Однако лечение только эверолимусом значительно снижало DDIT3 , но не оказывало существенного влияния на CHAC1 в органоидах CTNS KO (рис. 5G, дополнительная фигура 3D).

Обсуждение

В этом отчете мы создали новые человеческие модели цистиноза в виде цистинозных иПСК и почечных органоидов и продемонстрировали фенотип, характеризующийся нагрузкой цистином, увеличенными лизосомами, измененной экспрессией генов, повышенным апоптозом и дефектной базальной аутофагией.Используя эту уникальную человеческую платформу, мы протестировали терапевтические эффекты цистеамина и эверолимуса и обнаружили, что комбинированная терапия способна смягчить все наблюдаемые цистинотические фенотипы полезным и эффективным образом. Кроме того, эти модели могут быть использованы в качестве доклинической модели для тестирования других терапевтических средств, а также в качестве нового инструмента для углубления нашего понимания патогенных механизмов, действующих при цистинозе.

Из дефектов, наблюдаемых в цистинозных ИПСК и почечных органоидах, блокада базального потока аутофагии кажется наиболее значительной, поскольку цистеамин не может его восстановить.Тот факт, что количество аутофагосом в CTNS iPSC значительно не увеличивается в присутствии BafA1, может указывать на накопление аутофагосом в исходных условиях из-за дефекта слияния лизосом. Хотя ЦИСТИНОЗИН является транспортером, управляемым ионами водорода , 52, , и рН лизосом важен для слияния лизосом, , 66, предыдущие отчеты показали, что рН цистинотических лизосом является нормальным. 12 Таким образом, основная причина неспособности лизосом сливаться с аутофагосомами остается неясной.Существует ряд белковых комплексов, которые координируют это слияние и необходимы для физического движения как аутофагосом, так и лизосом. Следовательно, возможно, что один или несколько из этих процессов затронуты в цистинозных клетках. 67 Наблюдение, что нагрузка сахарозой индуцирует эквивалентный фенотип в нецистинозных ИПСК и что другие лизосомные болезни накопления демонстрируют базальные дефекты потока аутофагии, указывает на внутрилизосомальное накопление материала как общую причину дефекта потока. 68⇓⇓–71 Наше обнаружение того, что CTNS iPSCs активируют ряд генов в пути аутофагии, предполагает, что скомпрометированная базальная аутофагия приводит к активации механизмов транскрипционной обратной связи для компенсации сниженного потока.

Если накопление цистина нарушает слияние аутофагосомы и лизосомы и снижает базальный поток аутофагии, то можно было бы ожидать, что лечение цистеамином восстановит базальный фенотип аутофагии CTNS iPSCs. Интерпретация неспособности цистеамина восстанавливать базальную аутофагию осложняется сообщением, показывающим, что обработка цистеамином клеток HeLa в базальных условиях влияет на путь аутофагии в двух местах: во-первых, действуя рано, чтобы вызвать образование аутофагосом, а затем действуя позже, чтобы ингибировать созревание аутолизосом. 72 Таким образом, вполне вероятно, что, хотя цистеамин может восстанавливать лизосомальную функциональность в цистинозных клетках за счет истощения цистина, его независимое ингибирующее действие на созревание аутолизосом индуцирует эквивалентный блок базального потока аутофагии. Эта дополнительная активность цистеамина может быть связана с его антиоксидантными свойствами, поскольку известно, что активные формы кислорода регулируют аутофагию посредством окислительно-восстановительной модификации нескольких компонентов аутофагии, а антиоксиданты могут ингибировать базальную аутофагию. 73,74

Несколько исследований на мышах продемонстрировали критическую роль базальной аутофагии в поддержании функции проксимальных канальцев и подтвердили мнение о том, что продолжающаяся почечная дисфункция у пациентов с цистинозом, получающих цистеамин, связана с неспособностью восстановить базальную аутофагию. В частности, было показано, что блокирование аутофагии в клетках почек in vivo и in vitro в условиях насыщения питательными веществами приводит к накоплению деградирующих вакуолей, деформированных митохондрий и p62- и убиквитин-позитивных телец включения. 75⇓–77 Аналогичные наблюдения были зарегистрированы для биоптатов почек и клеток мочи у пациентов с цистинозом и клеток первичных проксимальных канальцев у мышей Ctns -/- . 26,27,75,78 В соответствии с одной из функций базальной аутофагии, заключающейся в удалении поврежденных митохондрий, работа с использованием клеток первичных проксимальных канальцев цистинозных мышей привела к модели, в которой дефектная аутофагия опосредованная очисткой поврежденных митохондрий (митофагия ) вызывает окислительный стресс и запускает дисфункцию почечных эпителиальных клеток. 27 Хотя мы не обнаружили повышенного уровня окислительного стресса или деформированных митохондрий в CTNS иПСК, это может быть связано с тем, что иПСК полагаются на гликолиз, а не на окислительное фосфорилирование для удовлетворения своих потребностей в энергии. 79 Напротив, клетки проксимальных канальцев содержат большое количество митохондрий для управления процессами мембранного транспорта, и разумно заключить, что эти клетки будут сильно зависеть от эффективной базальной аутофагии для контроля качества митохондрий.Было обнаружено, что другие ткани, такие как гепатоциты, нейроны, сердце и скелетные мышцы, также зависят от базальной аутофагии 80 , и, хотя нервные и мышечные ткани в конечном итоге поражаются у людей с цистинозом, именно проксимальные канальцы поражаются на ранних стадиях. в болезни. Одним из объяснений этого является то, что лизосомальная система клеток проксимальных канальцев находится под высокой деструктивной нагрузкой из-за поглощения и деградации альбумина и других белков плазмы, несущих дисульфидные связи. 81,82 Таким образом, уровень лизосомального накопления цистина и результирующая базальная дисфункция аутофагии (при условии, что она пропорциональна нагрузке цистина) должны быть выражены в цистинозных клетках проксимальных канальцев по сравнению с другими тканями. Мы не наблюдали каких-либо признаков поражений типа «лебединая шея», дефектов дедифференцировки клеток или повреждения митохондрий в наших цистинозных почечных органоидах. Это не является неожиданным, учитывая, что почечные органоиды культивируются только в течение нескольких недель, представляют собой эмбриональную стадию дифференцировки нефрона и не имеют фильтрации (что ограничивает их деструктивную нагрузку). 46

Предыдущие исследования с использованием иммортализованных клеток проксимальных канальцев мыши и человека выявили независимую от транспорта роль цистинозина, которая вовлекала его в положительную регуляцию mTORC1. 40,41 Несмотря на обнаружение незначительной активизации MTOR РНК и двух ее нижестоящих мишеней ( ULK1 и ATG13 ) в CTNS иПСК, мы не обнаружили доказательств того, что активность белка mTORC1 изменена. Точно так же не было обнаружено влияния на активность mTORC1 в цистинозных фибробластах мыши. 33 На данном этапе причина этих расхождений неизвестна, но может быть связана с метаболическими различиями между клеточными линиями. В качестве альтернативы могут иметь место искажающие влияния вирусных антигенов, используемых для иммортализации, поскольку они могут влиять на уровни mTORC1. 83

Мы обнаружили, что ингибирование mTORC1 эверолимусом способно преодолеть базальный блок аутофагии. Хотя механизм этого спасения неизвестен, потенциальным медиатором является TFEB, основной регулятор транскрипции лизосомального биогенеза и аутофагии. 70 TFEB подавляется в цистинотических клетках 84 , но активируется после ингибирования mTORC1 и может вызывать аутофагию. 85 Эверолимус также снижал частоту увеличенных лизосом в CTNS иПСК, и поскольку этот эффект был аннулирован 3-MA, вполне вероятно, что эти структуры очищаются за счет аутофагии. Это представление согласуется с открытием того, что аутофагия участвует в удалении/переработке старых и дисфункциональных лизосом (лизофагия) для предотвращения повреждения клеток, вызванного утечкой гидролитических ферментов. 86,87 На этой стадии остается неясным, приводит ли базальный блок аутофагии, наблюдаемый в цистинозных клетках, к дефекту лизофагии. Это привлекательная гипотеза, потому что большие лизосомы особенно уязвимы для разрыва, а некоторые цистинозные клетки оказались чувствительными к апоптозу. 14,24,25,88,89 Интересно, что если не удалять дисфункциональные лизосомы, общее количество лизосом остается неизменным, даже если некоторые из них нефункциональны. 87 Таким образом, контроль качества лизосом имеет решающее значение для поддержания способности клеток к деградации, и поэтому дефекты лизофагии могут вызывать дополнительный стресс для цистинотических клеток проксимальных канальцев.В отличие от предыдущих отчетов, лечение цистеамином не смогло снизить исходный уровень апоптоза в наших клетках. 24,25 Однако в предыдущих исследованиях изучался эффект предварительной обработки цистеамином с последующей индукцией апоптоза, а не влияние на базовые уровни, что указывает на то, что цистеамин может оказывать защитное действие при предварительной обработке клеток.

В настоящее время ингибиторы mTOR используются в клинике в качестве иммунодепрессантов и для лечения некоторых видов рака. 90,91 Наша работа предполагает, что эверолимус и родственные производные рапамицина также могут иметь терапевтический потенциал для лечения цистиноза.Это представление согласуется с исследованиями лизосомных заболеваний, мукополисахаридоза и болезни Ниманна-Пика, где преодоление блока аутофагического потока улучшает жизнеспособность клеток. 68,92,93 В случае болезни Нимана-Пика типа С была предложена комбинированная терапия низкими дозами гидроксипропил- β -циклодекстрина (который истощает накопление холестерина в лизосомах) в сочетании со стимулятором аутофагии. 94 Мы пришли к тому же заключению, что и наши результаты, и выдвинули гипотезу о том, что двойное лечение лиц с цистинозом цистеамином и индуктором аутофагии, таким как эверолимус, улучшит долгосрочные результаты.Следующий шаг в проверке этой гипотезы требует исследований на животных в моделях рыбок данио или грызунов. 14,95,96 При рассмотрении этих экспериментов необходимо уделить особое внимание поиску минимальной эффективной схемы дозирования, поскольку ингибиторы mTOR имеют побочные эффекты, включающие дислипидемию и нарушение гомеостаза глюкозы, что может осложнить их длительное применение у пациентов. с цистинозом. 97 Тем не менее, продолжают разрабатываться новые препараты пути mTOR, которые в будущем могут стать превосходными альтернативами.

Раскрытие информации

Доктор Дэвидсон сообщает о грантах Фонда исследования цистинозов и грантах Фонда исследований цистинозов в Ирландии во время проведения исследования. Доктор Харрисон сообщает о личных гонорарах от Vertex, помимо представленной работы. Доктор Холм сообщает о грантах Фонда исследования цистинозов и грантах Фонда исследований цистинозов в Ирландии, помимо представленной работы. Доктору Д’Суза, доктору Голливуду, доктору Пшепирски, мистеру Срибхавану и доктору Вольветангу нечего раскрывать.

Благодарности

Мы благодарим Adrian Turner, Jacqui Ross и Ratish Kurian за помощь в электронной микроскопии и микроскопии.

Д-р Дэвидсон, д-р Харрисон, д-р Голливуд и д-р Холм разработали концепцию исследования; Д-р Дэвидсон и д-р Холм совместно руководили исследованием; Доктор Дэвидсон и доктор Голливуд написали рукопись; Д-р Д’Суза и г-н Срибхаван провели эксперименты по Вестерн-блоттингу и ВЭЖХ соответственно; Доктор Голливуд, доктор Холм и доктор Пшепирски разработали и провели эксперименты; Доктор Холм установил линии пациентов с цистинозом; Д-р Дэвидсон, д-р Харрисон и д-р Холм получили финансирование; Доктор Вольветанг создал линию иПСК CRL1502 и рассмотрел рукопись.

  • Copyright © 2020 Американского общества нефрологов

%PDF-1.6 % 133 0 объект > эндообъект внешняя ссылка 133 89 0000000016 00000 н 0000002690 00000 н 0000003075 00000 н 0000003111 00000 н 0000003362 00000 н 0000003509 00000 н 0000003656 00000 н 0000003827 00000 н 0000004198 00000 н 0000004539 00000 н 0000004809 00000 н 0000005306 00000 н 0000005674 00000 н 0000006150 00000 н 0000006582 00000 н 0000007273 00000 н 0000007717 00000 н 0000008258 00000 н 0000008743 00000 н 0000008911 00000 н 0000008988 00000 н 0000009341 00000 н 0000009703 00000 н 0000009863 00000 н 0000011776 00000 н 0000012009 00000 н 0000012291 00000 н 0000012732 00000 н 0000012924 00000 н 0000013375 00000 н 0000013457 00000 н 0000013785 00000 н 0000016009 00000 н 0000016330 00000 н 0000016560 00000 н 0000018683 00000 н 0000020676 00000 н 0000022621 00000 н 0000023159 00000 н 0000023599 00000 н 0000035839 00000 н 0000035878 00000 н 0000038077 00000 н 0000038357 00000 н 0000039546 00000 н 0000039696 00000 н 0000039738 00000 н 0000039822 00000 н 0000040872 00000 н 0000041117 00000 н 0000041318 00000 н 0000041553 00000 н 0000043409 00000 н 0000043458 00000 н 0000045285 00000 н 0000047002 00000 н 0000053045 00000 н 0000053815 00000 н 0000069356 00000 н 0000072114 00000 н 0000072935 00000 н 0000073744 00000 н 0000077400 00000 н 0000080540 00000 н 0000083379 00000 н 0000087372 00000 н 0000087781 00000 н 0000088002 00000 н 0000088511 00000 н 0000088736 00000 н 0000088792 00000 н 0000089000 00000 н 0000089212 00000 н 0000089621 00000 н 0000089679 00000 н 0000089968 00000 н 00000

00000 н 00000

00000 н 00000

00000 н 00000

00000 н 00000

00000 н 00000

00000 н 00000

00000 н 00000

00000 н 00000

00000 н 00000

00000 н 00000

00000 н 00000
00000 н 0000002076 00000 н трейлер ]/предыдущая 1760824>> startxref 0 %%EOF 221 0 объект >поток hb««

Метод характеристики ниши стволовых клеток желудочно-кишечного тракта

Эпителий желудочно-кишечного тракта характеризуется высоким оборотом клеток, а стволовые клетки кишечника преимущественно находятся на дне крипт, а их потомство служит для поддержания нормального гомеостаза кишечника .Накопленные данные демонстрируют ключевую роль ниши, окружающей стволовые клетки кишечника в криптах, которая состоит из клеточных и растворимых компонентов и создает среду, постоянно влияющую на судьбу стволовых клеток. Здесь мы описываем различные системы трехмерного культивирования для культивирования эпителия желудочно-кишечного тракта, которые должны позволить нам в будущем изучать нишу стволовых клеток in vitro : органоидная культура и многослойные системы, такие как органотипическая клеточная культура и культура фрагментов кишечной ткани ex vivo .Эти методы имитируют in vivo ситуацию in vitro путем создания условий 3D-культуры, которые отражают физиологическое состояние кишечных крипт. Модификации состава культуральной среды, а также совместное культивирование эпителиальных органоидов с ранее описанными клеточными компонентами, такими как миофибробласты, коллаген и нейроны, показывают влияние методов, применяемых для исследования взаимодействия ниш in vitro . Далее мы представляем новый метод выделения меченых нервов из кишечной нервной системы с использованием мышей Dclk1-CreGFP.

1. Введение

Тканевые стволовые клетки взрослых необходимы для гомеостаза тканей и регенерации после повреждения, но при определенных условиях они могут подвергаться злокачественной трансформации и вызывать рак. Эта гипотеза была широко изучена in vivo но in vitro методы анализа лежащих в основе факторов и взаимодействия эпителия и стромы отсутствуют. Общей и отличительной чертой большинства взрослых стволовых клеток является их локализация [1], поскольку они находятся в определенном и защищенном анатомическом месте, называемом нишей стволовых клеток.Такая ниша состоит из клеточных компонентов, окружающих стволовые клетки, внеклеточного матрикса (ECM) и растворимых факторов. Считается, что основной функцией этой ниши стволовых клеток является удержание стволовых клеток с контролируемым симметричным и асимметричным делением. Закрепление стволовых клеток опосредовано их контактом с внеклеточным матриксом и зависит от адгезионных соединений [2, 3]. Клеточная часть ниши содержит стромальные клетки, такие как остеобластные клетки в костном мозге, клетки Сертоли в нише стволовых клеток зародышевой линии или перикриптальные фибробласты в кишечнике [1, 4].Поскольку желудочно-кишечный эпителий склонен к воспалению и канцерогенезу, важно расшифровать механизмы регуляции ниши кишечных стволовых клеток не только в физиологии, но и при воспалении и канцерогенезе.

Кишечник является органом с высоким уровнем оборота эпителиальных клеток, включающим самообновление каждые два-семь дней в контексте нормального тканевого гомеостаза [5], что делает его идеальной моделью для изучения влияния ниши на пролиферацию и дифференцировку стволовых клеток.Эта пластичность возникает из-за присутствия мультипотентных стволовых клеток кишечника (ISC), которые находятся в криптах или желудочно-кишечных железах [5]. Lgr5 -положительные (и Prom1- / Sox9 -положительные) быстроциклирующие стволовые клетки находятся в основании крипты, поэтому также называются столбчатыми клетками основания крипты (CBC), и были показаны четыре линии клеток кишечной крипты быть получены из этих стволовых клеток [6]. Окруженные эндотелиальными клетками (сосудистый и лимфатический эндотелий), перицитами, клетками иммунной системы, фибробластами и нейронами, ИСК постоянно модулируются высвобождением цитокинов, хемокинов, факторов роста и нейротрансмиттеров и, таким образом, могут изменяться в сторону канцерогенной судьбы. [7, 8].Поддержание и пролиферация стволовых клеток сильно зависят от модуляции сигнальных путей, таких как Wnt, Notch, BMP или Hedgehog [8]. Недавно было показано, что клетки Панета являются важным компонентом ниши кишечных стволовых клеток [9]; однако истощение этого типа клеток у мышей существенно не изменило фенотип крипт [10]. Это предполагает, что нишевые факторы обеспечиваются стромальными клетками.

В подавляющем большинстве из исследований in vitro в биомедицинских исследованиях преобладает применение двухмерных (2D) моделей клеточных культур.Однако последние плохо отражают клеточную гетерогенность и клеточное поведение тканей in vivo . Кроме того, 2D-культура клеток не позволяет изучать связь между разными типами клеток или взаимодействие клеток ECM. В биомедицинских исследованиях растет интерес к применению трехмерных (3D) систем культивирования клеток. Недавно была разработана 3D-культура кишечных крипт мыши, известная как культура минигута или органоидная культура [11]. Культура крипт воспроизводит клеточное разнообразие кишечного эпителия.Кроме того, в культуре кишечных органоидов могут быть идентифицированы домены крипт и ворсинок, таким образом напоминающие пролиферирующие и дифференцированные компартменты в кишечнике in vivo . Поскольку возможно добавить стромальные клетки в органоидную культуру, это перспективная физиологически релевантная модель для изучения нишевых факторов ex vivo . Здесь мы предлагаем изучить нишевые факторы, использующие нервы и фибробласты в качестве нишевых клеток для кишечных и кардиальных крипт органоидов in vitro .

2. Методы
2.1. Животные

Эксперименты на животных были одобрены местным комитетом защиты животных. Для выделения крипт СИ использовали ткань мышей линии C57BL/6 (Jackson Laboratories). Для выделения кишечных миофибробластов использовали мышей дикого типа C57BL/6J в возрасте от 4 недель до 2 лет. Мышей Dclk1-CreGFP скрещивали с репортерными штаммами Rosa26-mTomato/mGFP (R26-TGFP), как описано ранее [12]. Мыши, использованные для совместного культивирования нейронов, имели возраст от 7 до 10 дней и были трансгенными, повсеместно экспрессирующими белок Dclk1Cre в Dclk1 -положительных клетках и их линиях в сочетании с репортерным белковым комплексом.Для получения клеток органоидной кардии Барретта выделяли ткани мышей pL2-IL-1b в возрасте одного года. Мыши pL2-IL-1beta несут трансген EBV-L2-IL-1 β , сверхэкспрессирующий человеческий IL-1beta в слизистой оболочке пищевода и плоского преддверия желудка. У мышей наблюдается эзофагит, который прогрессирует до метаплазии и дисплазии в более старшем возрасте (~ 12 месяцев) [13]. Кроме того, для культуры кардии и кишечных крипт использовали мышей Lgr5-CreTMG с индуцируемой экспрессией Cre и стабильной экспрессией GFP в Lgr5-положительных клетках в возрасте 60 и 32 недель соответственно [6].

2.2. Культура кишечных органоидов (кишечные склепы)

Тонкую кишку (SI) мышей извлекали и промывали в PBS (Life Technologies), удаляя весь жир и прилегающие ткани. Его открывали в продольном направлении и промывали в PBS для удаления всех оставшихся остатков пищи. Ткань SI разрезали на ок. Части длиной 3–5  см, которые хранили в чашке Петри, содержащей холодный PBS + 10% фетальной телячьей сыворотки (FBS) (Life Technologies), далее именуемой PBS/FBS. Части кишечника расплющивали на чашке Петри и соскабливали ворсинки с помощью покровного стекла.Этот шаг был повторен внутри и снаружи частей SI. Эти части SI разрезали скальпелем на кусочки размером 2–4 мм и переносили в 20 мл PBS/FBS в пробирке Falcon объемом 50 мл. Образцам ткани давали осесть, а надосадочную жидкость удаляли. Добавляли дополнительные 10 мл PBS/FBS для промывания ткани и удаляли супернатант. Эти этапы повторяли до тех пор, пока супернатант не становился прозрачным (примерно 5 раз). Оставшуюся ткань расщепляли в PBS + EDTA (2 мМ) в течение 15 мин при 4°C на шейкере.После переваривания супернатант удаляли. Ткань ресуспендировали в 10 мл PBS/FBS и фильтровали через клеточный фильтр 70  мкм мкм (BD Biosciences) в новую пробирку Falcon объемом 50 мл. Этот шаг повторялся несколько раз (~4 раза). Для осаждения крипт их центрифугировали в течение 8 мин, 800 об/мин при 4°С. Супернатант удаляли как можно полнее, к осадку добавляли 150–200  мкл л матригеля, избегая пузырьков воздуха. 50  мк мкл Matrigel помещали в каждую лунку предварительно нагретого 24-луночного планшета.В каждую лунку добавляли 0,5 мл среды для культивирования крипт (CM), состоящей из улучшенной DMEM/F12 (Life Technologies), дополненной бессывороточным B27 (1 : 50, Life Technologies), N2 (1 : 100, Life Technologies). Technologies), N-ацетилцистеин (50 мМ, Sigma), рекомбинантный фактор роста эпителия мыши (EGF 50 нг/мл, Peprotech), Noggin (100 нг/мл, Peprotech), R-Спондин (1  мк г/мл, Peprotech), добавка Glutamax-I (1 : 100, Life Technologies), пенициллин/стрептомицин (500  μ г/мл, Life Technologies) и HEPES (10  μ M, Life Technologies) (см. Таблицу 1).Культуры инкубировали во влажном инкубаторе при 37°C и 5% CO 2 .


Условия культуры
9
Advanced Medium (CM) Advanced DMEM / F12 + HEPES + PEN / STREP + GLUTAMAX + PEN (B27 , N2) + ENR (EGF, R-Spondin и Noggin) + N-ацетилцистеин

Среда для кардии (CaM) Wnt-кондиционированная расширенная DMEM/F12 + HEPES + Penes + Penes + Strep + добавки для роста (B27, N2) + ENR (EGF, R-Spondin и Noggin) + N-ацетилцистеин

Через 1 день можно наблюдать за ростом изолированных крипт.Через 2-3 дня начинают формироваться крипты SI, напоминающие структуру крипт-ворсинок в кишечнике. Среду меняли через день. Примерно каждую неделю склепы можно разделить от 1 : 2 до 1 : 4, в зависимости от количества и размера склепов. Для пассирования органоидов среду заменили на 0,5 мл ледяной среды (СМ без факторов роста, также называемой полной средой), несколько раз ввели и опустили пипетку, чтобы разрушить матригель, и поместили новый сокол объемом 15 мл. Разрушенные склепы больше не должны быть видны невооруженным глазом.Их осаждали при 800 об/мин в течение 5 минут при 4°C, и к осадку добавляли соответствующее количество Matrigel. Капли матригеля снова высевали в 24-луночный планшет и добавляли среду для культивирования крипт.

2.3. Выделение кишечных миофибробластов

Кишечные миофибробласты выделяли методом эксплантации. Тонкую кишку мышей собирали и разрезали на фрагменты размером 2-3 мм. Фрагменты ткани промывали холодным промывочным раствором, состоящим из сбалансированного солевого раствора Хэнкса (HBSS) (Life Technologies), 1% пенициллина/стрептомицина (Life Technologies) и 50  мкг/мл г/мл гентамицина (Life Technologies). и инкубировали в 1 мМ дитиотреитола (ДТТ) в течение 15 минут при комнатной температуре.Затем фрагменты ткани инкубировали в 1 мМ ЭДТА в течение 30 мин при 37°С при периодическом перемешивании. После промывки HBSS повторяли инкубацию с 1 мМ ЭДТА. Затем фрагменты ткани промывали и инкубировали с 1 мг/мл коллагеназы типа I (Sigma) в течение 30 мин при 37°С. После промывания раствором, содержащим HBSS, 10% FBS (Life Technologies) и 1% пенициллин/стрептомицин, фрагменты ткани высевали и культивировали в среде, содержащей RPMI1640 (Life Technologies), 10% FBS, 1% пенициллин/стрептомицин, и 100  мк мкг/мл нормоцина (Invivogen).Миофибробласты мигрируют из фрагментов ткани и прикрепляются к культуральному планшету.

2.4. Совместное культивирование крипт-фибробластов в органотипической системе культивирования клеток (OTC)

Миофибробласты и крипты выделяли, как указано выше, от мышей в возрасте от 6 недель до 8 месяцев (для 2-дневных культур и для 7-дневных культур), размножали , а затем использовать для эксперимента. Бесклеточный и клеточный матрикс готовили, как было опубликовано ранее [14], с небольшими изменениями. 900  мк л бесклеточного матрикса пипетировали на трансвелл (24 мм трансвелл с 3.0  Вставка из поликарбонатной мембраны с размером пор мкм и размером пор мкм, Corning), которую помещали в 6-луночный трансвелловый носитель (Organogenesis). После затвердевания отливали 450  мкл л клеточного матрикса, содержащего кишечные миофибробласты. После стабилизации матрикса сверху заливали 450  мкл л клеточного матрикса, содержащего кишечные крипты. На лунку добавляли 7,5 мл среды, содержащей RPMI1640 (Life Technologies), 10% FBS (Life Technologies), 1% пенициллин/стрептомицин (Life Technologies) и 330 нг/мл R-спондина (Peprotech).В день 0 клетки высевали. Р-Спондин добавляли в среду только на 0-е сутки. На 2-е и 7-е сутки культуру фиксировали в формалине, обезвоживали и заливали в парафин. На срезанных парафиновых предметных стеклах проводили окрашивание H&E, Ki-67 (Abcam) и α -SMA (Abcam). Общее количество крипт определяли количественно на предметных стеклах, окрашенных H&E. Разрушенные склепы считались нежизнеспособными. Выживаемость определяли как процент жизнеспособных крипт.

2.5. Культура ткани
Ex Vivo

Тонкий кишечник брали у 5-недельных мышей, разрезали на мелкие кусочки, помещали в матрикс и культивировали.Метод выполняли, как ранее опубликовано [15], за исключением состава бесклеточного нижнего слоя и клеточного слоя, которые готовили по протоколу для органотипической культуры клеток [14]. Культивирование проводили в транслуночной камере (транслуночной камере 24 мм с вставкой из поликарбонатной мембраны 3,0  мкм с порами мкм, Corning), которую помещали в 6-луночный транслуночный носитель (Organogenesis). Культуральная среда состояла из Ham’s F12 (Life Technologies), 20% FBS (Life Technologies) и 50  мкг/мл гентамицина (Life Technologies) и была заменена через одну неделю.В каждую лунку добавляли по 1 мл среды. Через две недели культуру фиксировали в формалине, заливали в парафин и проводили окрашивание PAS.

2.6. Влияние внеклеточного матрикса на фенотип кишечных органоидов

Крипты тонкого кишечника от трех мышей дикого типа в возрасте от 7 недель до 17 месяцев выделяли и культивировали в матригеле, как описано выше. Для эксперимента крипты засевали либо в матригеле, либо в клеточный матрикс, приготовленный по ранее опубликованной [14], за исключением ФБС, которую не добавляли.Крипты смешивали с клеточным матриксом и высевали по 50  мкл л матрикса на лунку в 24-луночный планшет. Крипты засевали в день 0, а культуральная среда была такой же, как опубликовано ранее [16]. Анализ и фиксацию в формалине проводили на 2-е сутки. Срезы окрашивали на Ki-67 (Abcam).

2.7. Cardia Organoid Culture

Собранный желудок вскрывали по большой кривизне и промывали холодным PBS + 10% FBS для удаления остатков пищи. Для выделения ткани чешуйчато-столбчатого перехода (SCJ) вскрытый желудок клали на твердую поверхность наизнанку; исследуемую ткань вырезали, промывали в PBS, нарезали на мелкие кусочки и переносили в 20 мл буфера PBS, замещенного ЭДТА и этиленгликольтетрауксусной кислотой (EGTA, конечная концентрация 2 мМ).Для отделения отдельных слоев ткани собранную ткань инкубировали в течение 45 мин на шейкере при 4°С. После инкубации супернатант удаляли и добавляли 10 мл PBS с 10% FBS. Аналогично выделению кишечных крипт, дальнейшее разрушение ткани осуществляли с помощью сдвигающих сил при пипетировании. Фрагменты пропускали через сито для клеток 70  мкм м (BD Biosciences). Суспензию клеток центрифугировали при 600 об/мин в течение 5 мин. Осадок ресуспендировали в матригеле и высевали на предварительно нагретый 24-луночный планшет каплями 50  мкл л матригеля в каждую лунку.Для длительного культивирования органоиды культивировали в среде для культивирования кишечных крипт, кондиционированной Wnt (0,5 мл на лунку), которую добавляли свежей через день. Wnt-CM (позже названный средой cardia, CaM) был получен из клеточной линии L-Wnt3a (ATCC), которую культивировали в среде, состоящей из усовершенствованной DMEM/F12 (Life Technologies), HEPES (10  мк М, Life Technologies). Technologies), пенициллин/стрептомицин (500  мкг/мл г/мл, Life Technologies) и добавку Glutamax-I (1 : 100, Life Technologies).Кардиальные органоиды обычно нуждаются в Wnt3a для роста и долгосрочного выживания в качестве дополнительного фактора роста [17]. Для эффективного размножения органоидов их необходимо пассировать через 7 и 10 дней в культуре с той же процедурой, что и кишечные органоиды. На 10-е сутки культуры фиксировали в формалине, обезвоживали и заливали в парафин. После разрезания парафиновых препаратов проводили окрашивание гематоксилином и эозином (H&E), периодической кислотой-Шиффом (PAS), Ki-67 (Abcam) и α -SMA (Abcam).

2.8. Выделение нервной ткани и совместное культивирование

Нейрональную ткань получают из межмышечного сплетения путем удаления серозно-мышечного слоя подготовленной тонкой кишки (адаптировано из [18, 19]). В процессе выделения выделенную ткань хранили на льду в минимально необходимой среде (MEM, Life Technologies). Полученную ткань переваривали в течение ок. 45–80 мин при 37°C в HBSS, содержащем коллагеназу типа II (1  мк г/ мк л, Worthington). С помощью микроскопа тщательно следили за ходом процесса пищеварения.После первого периода инкубации недостаточно переваренные сплетения отделяли и переваривали еще 15 мин. Затем полученные небольшие фрагменты осторожно разрушали с помощью шприцев для инъекций (Sterican 23 G × 1    или 20 G × 1   ′′). Для остановки процесса пищеварения добавляли HBSS с добавлением 10% FBS. Суспензию клеток центрифугировали (600 об/мин, 5 мин) и после еще одного этапа промывки HBSS/FBS ресуспендировали в усовершенствованной среде DMEM/F12 (Life Technologies). Для роста и дифференцировки нейронов клетки высевали в Matrigel вместе с органоидами кардии и культивировали в нейробазальной полной среде (NBM), которая состоит из нейробазальной среды (Life Technologies), фактора роста нервов (NGF, 1 : 1000, Life Technologies). , бессывороточный B27 (1 : 50, Life Technologies), N2 (1 : 100, Life Technologies), N-ацетилцистеин (50 мМ, Sigma), рекомбинантный мышиный эпителиальный фактор роста (EGF 50 нг/мл, Peprotech), Noggin (100 нг/мл, Peprotech), R-спондин (1  μ г/мл, Peprotech), добавка Glutamax-I (1 : 100, Life Technologies), пенициллин/стрептомицин (500  μ г/мл, Life Technologies) и HEPES (10  μ M, Life Technologies).Среду меняли через день. Сокультуры инкубировали во влажном инкубаторе при 37°C и 5% CO 2 .

2.9. Calcium Imaging

Ca 2+ -визуализация позволяет визуализировать внутриклеточные видимые изменения с помощью флуоресцентных красителей, изменяющих интенсивность своей флуоресценции в зависимости от . Хотя прямой вклад Ca 2+ в мембранный потенциал нейронов ограничен, было показано, что события мембранного потенциала тесно связаны с изменениями в [20, 21].Поэтому для обнаружения активации нейронов в сокультурах использовали индикатор Ca 2+ Fluo-4 AM (Invitrogen). Клетки инкубировали в 10  мкл M Fluo-4 AM в течение 20 минут с последующим 20-минутным отмыванием. Во время экспериментов по визуализации Ca 2+ клетки непрерывно перфузировали раствором Кребса [22] при 37°C, который постоянно фумигировали карбогеном (95% кислорода и 5% CO 2 ). Чтобы обеспечить стабильное окрашивание нейронов в течение нескольких часов, мы добавили 1.25 мМ пробенецида (Sigma) в растворе Кребса, используемом для экспериментов. Пробенецид является ингибитором переносчиков органических анионов, элиминирующих красители и индикаторы из цитоплазмы [23]. Изменения флуоресценции определяли с помощью цифровой камеры (AxioCam Hsm, Zeiss) и программного обеспечения Zeiss Axio Vision в сочетании с инвертированным микроскопом (Axio Observer A1, Zeiss). Частота кадров записи составляла 2 Гц, что достаточно для выявления активации нейронов. Для тестирования жизнеспособности мы нанесли 100  мк М никотина (Sigma) с помощью приложения давления (PDES-2L, npi electronic GmbH, Тамм, Германия) через вытянутую стеклянную пипетку (диаметр наконечника ок.5  мкс м). Никотин действует как агонист никотинэргических ацетилхолиновых рецепторов и поэтому подходит в качестве теста на жизнеспособность культивируемых кишечных нейронов [24]. Чтобы количественно оценить изменения флуоресценции при никотиновой активации ацетилхолиновых рецепторов, мы присвоили интенсивность света покоя (RLI) в интересующих областях.

2.10. Полимеразная цепная реакция с обратной транскрипцией (RT-PCR)

РНК выделяли с использованием набора RNeasy Mini Kit (Qiagen). Остаточная геномная ДНК была удалена расщеплением ДНКазой на колонке (Qiagen).кДНК создавали с помощью набора для обратной транскрипции (Promega). Использовали следующие праймеры: α -SMA (fw 5′ CGCTGTCAGGAACCCTGAGA 3′, rv 5′ ATGAGGTAGTCGGTGAGATC 3′), β -актин (fw 5′ CCCTGAACCCTAAGGCCAACC 3′, rv 5′ ACCCCGTCTCCGGAGTCCATC 3′), fw 5′ ACCACTGCCCTCGTAATCGAA 3′, rv 5′ CGTCCTGCCAATCCTGATGAA 3′), Lgr5 (fw 5′ GACGCTGGGTTATTTCAAGTTCAA 3′, rv 5′ CAGCCAGCTACCAAATAGGTGTCTC 3′), villin 1 (fw 5′ GACGTTTTCACTGCCAATACCA 3′, rv 5′ CCCAATACCA 3′, rv 5′ CCGCTGGGTTATTTCAAGTTCAA 3′, rv 5′ и виментин (fw 5′ AACACCCGCACCAAC 3′, rv 5′ TCCGGTACTCGTTTGACT 3′).

2.11. Оценка органоидов/энтероидов и статистический анализ

Пролиферацию и рост органоидов можно оценить in vitro несколькими способами; здесь мы применили определение диаметра и окружности органоидов за проход и сравнили средние значения на временной шкале. Органоиды кардии измеряли на 7-й и 10-й день с использованием программного обеспечения Axio Vision (Zeiss) и ImageJ. Оценку роста кишечных крипт в органотипической системе культивирования клеток проводили на основе анализа окрашивания гематоксилин-эозином: измеряли диаметр крипт через 2 и 7 дней культивирования.Статистический анализ проводили с помощью GraphPad Prism. Сравнение двух групп проводили с помощью непарного двустороннего -критерия. Стандартное отклонение было статистически значимым.

3. Результаты
3.1. D Системы культивирования клеток для изучения ниши стволовых клеток в желудочно-кишечном тракте

Чтобы проанализировать нишу стволовых клеток in vitro , мы проанализировали три различных системы культивирования in vitro , чтобы идеально имитировать ситуацию in vivo и при этом оставаться в состоянии понять воздействие различных клеточных и бесклеточных факторов.

Система культуры ткани ex vivo основана на внедрении фрагментов цельной ткани в матрицу. Здесь мы модулировали ранее опубликованную систему культуры ткани ex vivo [15], используя дополнительный бесклеточный слой и слой, содержащий клетки, которые были подготовлены в соответствии с протоколом для первоначально опубликованной системы OTC [14] (рис. 1 (а). ). Культивирование проводили в трансвеллах, как описано выше. Сначала заливали бесклеточный слой, имитирующий базальную мембрану.Затем наливали клеточный слой, содержащий фрагменты тканей. Среду добавляли только во внешнюю чашку, что создавало границу раздела воздух-жидкость и приводило к лучшей оксигенации культуры. Следует отметить, что в добавлении R-спондина (который имеет решающее значение для органоидной культуры) не было необходимости; однако мы наблюдали повышение эффективности роста эпителия после добавления R-спондина (не показано), как и ранее сообщалось [15]. Хотя этот тип культуры сохраняет нативную стромальную нишу (указана стрелкой на рис. 1(а)) и может быть проанализирован после фиксации формалином и заливки парафином с помощью иммуногистохимии, он не представляет собой прямого инструмента для анализа эпителиально-стромального взаимодействия in vitro. без использования моделей генетически модифицированных мышей и уж точно не на человеческом материале.


В отличие от тканевой культуры ex vivo , как OTC, так и органоидная культура позволяют комбинировать и, следовательно, анализировать различные типы клеток. В системе OTC эпителиальные и стромальные клетки встроены в отдельные слои матрикса. Поскольку многослойные и многоклеточные системы OTC [14], по-видимому, обеспечивают градиент питательных веществ (питание снизу) и, по-видимому, имитируют структуру органа намного лучше, чем органоидные культуры, мы проверили пригодность OTC в качестве новой модели для изучения Ниша кишечных стволовых клеток с мышиными кишечными криптами, выделенными из мышей B6 WT.Мы культивировали кишечные крипты в многослойной системе OTC (рис. 1(b)) аналогично культуре ткани ex vivo ; культуру проводили в трансвелле. Сначала заливали бесклеточный слой; затем добавляли клеточный слой с кишечными миофибробластами. Сверху помещали еще один клеточный слой, содержащий крипты. Среду добавляли только во внешнюю чашку (подача снизу), что обеспечивало взаимодействие воздух-жидкость с криптами, время от времени направленными на открытую поверхность.

Напротив, в культуре энтероидов/органоидов клетки помещают в матригель и культивируют в «капли матригеля» (рис. 1(с)). Культуральная среда содержит факторы роста, такие как R-спондин, EGF и Noggin, которые необходимы для поддержания роста и структуры крипт. Было определено, что крипты из кишечника следует называть энтероидами, как только они образуют почкующуюся «минигут», и только сочетание этих клеток с другими типами клеток позволяет называть их органоидами. Сочетание других типов клеток, таких как фибробласты и нервы, с энтероидной системой имитирует специфическую ситуацию in vivo и может быть названо органоидом [25].Хотя органоидная культура представляет собой физиологически значимую систему культивирования клеток, и было показано, что крипты тонкого кишечника в системе органоидной культуры содержат домен крипты и ворсинок [11], она имеет ограничения. Система культивирования органоидов, например, не повторяет градиент питательных веществ, который присутствует вдоль оси крипта-ворсинка in vivo .

3.2. Характеристика органоидов тонкой кишки и миофибробластов тонкой кишки

Для характеристики органоидов тонкой кишки культуру фиксировали в формалине, заливали в парафин и окрашивали.Окрашивание H&E показало, что кишечный органоид состоит из монослоя поляризованных столбчатых эпителиальных клеток (рис. 2(а), слева). Кроме того, органоиды тонкой кишки содержат просвет и характеризуются наличием зачатков. Окрашивание PAS выявило наличие клеток, продуцирующих слизь, и секрецию слизи в просвет (рис. 2 (а), середина). Помимо дифференцированных зон, характеризующихся, например, наличием клеток, продуцирующих слизь, в органоидах тонкого кишечника можно выделить пролиферативные зоны, что видно по окрашиванию Ki-67 (рис. 2(а), справа).Клетки с пролиферативной активностью, по-видимому, не были распределены случайным образом, а скорее накапливались в областях, где росли почки (рис. 2 (а), справа). Кроме того, органоиды тонкого кишечника экспрессировали Lgr5, маркер стволовых клеток кишечника (рис. 2(b)), и мы демонстрируем Lgr5-позитивные клетки, выделенные из мыши Lgr5 CreTM, у которых все клетки, экспрессирующие LgR5, также имеют экспрессию GFP в органоидах кишечника ( Рисунок 2(б)). Миофибробласты, выделенные из тонкой кишки и культивированные in vitro , были удлиненными и веретенообразными (рис. 2(с)).Чтобы подтвердить идентичность происхождения органоидов и миофибробластов тонкой кишки, была проведена ОТ-ПЦР для маркеров эпителиальных клеток E-кадгерин и виллин, а также маркеров мезенхимальных клеток, таких как α -SMA и виментин. Данные показали, что органоиды тонкого кишечника были положительными в отношении E-кадгерина и виллина и отрицательными в отношении α -SMA и виментина, что подтверждает идентичность их эпителиального происхождения (рис. 2(d)). Миофибробласты тонкой кишки экспрессировали α -SMA и виментин и были отрицательными в отношении маркеров эпителиальных клеток, что подтверждает их идентичность стромальным клеткам (рис. 2(d)).

3.3. Фибробласты улучшают выживаемость органоидных культур

Для изучения роли фибробластов как нишевого фактора для ISC крипты тонкого кишечника культивировали вместе с миофибробластами кишечника в безрецептурной системе (рис. 1(b)) и сравнивали с монокультурой крипт. Для монокультуры использовали тот же матрикс, но с той лишь разницей, что миофибробласты не добавляли к клеточному слою. Через 7 дней культивирования мы наблюдали увеличение макроскопической видимости сокультуры по сравнению с монокультурой (рис. 3(а)).Как монокультура крипт OTC, так и кокультура крипт OTC содержали клетки, продуцирующие слизь, и пролиферирующие клетки, как показано окрашиванием PAS и Ki-67 (рис. 3(b)). Пролиферирующие клетки не были распределены гомогенно, но можно было различить пролиферирующие компартменты, особенно в сокультуре. Окрашивание α -SMA подтвердило наличие лежащих в основе веретенообразных миофибробластов в сокультуре крипт OTC (рис. 3(b), при ближайшем увеличении). Чтобы проверить, влияют ли миофибробласты на рост крипт с течением времени, диаметр крипт на 2-й и 7-й день измеряли в культурах, которые фиксировали в формалине, заливали в парафин и окрашивали на H&E.Хотя мы не обнаружили существенных изменений в размере крипт между монокультурой и совместной культурой на 2-й день, мы заметили, что на 7-й день диаметр крипты в монокультуре составлял ~100  мкм м, тогда как в совместной культуре он составлял ~400  мкм м ( Рисунок 3(с)), предполагая, что миофибробласты улучшают рост крипт. Для дальнейшего изучения влияния миофибробластов на крипты был проведен анализ выживаемости органоидов, основанный на количественном определении жизнеспособных крипт на основе окрашивания H&E.Жизнеспособная крипта была определена как крипта с неповрежденным монослоем эпителиальных клеток, а нежизнеспособная крипта была определена как скопление клеточного детрита (рис. 3 (г), ниже). В монокультуре крипт OTC жизнеспособными были 30% крипт, тогда как в кокультуре крипт OTC жизнеспособными были 90% крипт (рис. 3 (d), вверху), что указывает на то, что миофибробласты улучшают выживаемость органоидной культуры, и, таким образом, подтверждает гипотезу о том, что миофибробласты обеспечивают некоторые нишевые факторы для ISC.


3.4. Коллаген модулирует фенотип кишечных крипт

Интересно, что крипты, культивированные в системе ОТЦ, почти не имели зачатков, что является характерным признаком 3D-культур кишечной ткани, о чем свидетельствуют крипты, культивированные в органоидной системе (рис. 4). (а)). Поскольку было показано, что внеклеточный матрикс изменяет фенотип нормального эпителия молочной железы [26] и учитывая, что состав матрикса ОТЦ отличается от того, который используется в органоидной культуре кишечных крипт, мы предположили, что внеклеточный матрикс может способствовать формированию фенотипа эпителия молочной железы. нормальный кишечный эпителий.Чтобы проверить эту гипотезу, мы использовали систему культивирования органоидов и встроенные крипты в клеточный матрикс OTC. Для исключения потенциального влияния воздушно-жидкостной границы и влияния сыворотки культивирование проводили в 24-луночном планшете (идентично культуре органоидов) [11, 27] и без добавления сыворотки в клеточный матрикс. В контрольных условиях (крипты, засеянные матригелем) примерно 70% крипт содержали почки, в то время как в клеточном матриксе OTC только 40% крипт почковались (рис. 4(c)), что свидетельствует о том, что коллаген снижает образование почек.Хотя крипты в клеточном матриксе OTC показали уменьшенное количество зачатков, они содержали пролиферирующие клетки, как показало окрашивание Ki-67 (рис. 4(b)).

3.5. Выделение различных нейронов из кишечной нервной системы для
In Vitro Культура

Как описано выше, считается, что нервная система играет важную роль в регуляции эпителиальных стволовых клеток кишечника и в развитии неоплазии [12, 28, 29]. При хирургической или фармакологической денервации желудка наши сотрудники и мы недавно продемонстрировали, что канцерогенез в денервированной части желудка зависит от иннервации [17].В то же время это коррелировало с подавлением Wnt3a в нише стволовых клеток денервированной части желудка.

Недавно мы создали линию трансгенных мышей ВАС, которая экспрессирует конститутивную Cre-рекомбиназу под контролем локуса гена Dclk1 [12]. Затем мы скрестили мышей Dclk1-Cre с репортерной линией мышей Tomato/GFP (B6.129S4-Gt(ROSA)26Sortm4(ACTB-tdTomato-EGFP)Luo/J), в которой Tomato с направленным на мембрану (RFP) заменен на нацеленный на мембрану Зеленый флуоресцентный белок (GFP) при Cre-опосредованной рекомбинации.Интересно, что в этой линии мышей с конститутивной активной экспрессией Cre, начиная с эмбриогенеза, мы наблюдали прослеживание клонов в нервоподобных структурах по всему кишечнику (рис. 5(a)-5(d)). В линии Dclk1 мы часто наблюдали кишечные глиальные клетки GFAP+ и нервы и ганглии PGP9.5+ (рис. 5(e)–5(f)), что позволяет предположить, что линия Dclk1 маркирует части кишечной нервной системы (ЭНС), которые было показано, что он модулирует реакцию на травму [30].

Впоследствии мы создали модель совместной культуры нейронов и органоидов в качестве нового метода изучения роли нервов в нише кишечных стволовых клеток [12] в норме и при таких заболеваниях, как пищевод Барретта, для которого мы также недавно разработали новую мышиную модель. [13], что позволяет выделить эпителиальные органоиды мыши Барретта.Используя нашу надежную модель культуры органоидов, мы культивировали и совместно культивировали органоиды из эпителия Барретта мыши в различных средах, как описано выше.

Подобно характеристике культивируемых крипт тонкой кишки, окрашивание гематоксилин-эозином показало, что органоиды кардии состоят из монослоя поляризованных столбчатых эпителиальных клеток (рис. 6(а)). Кроме того, органоиды содержат просвет и характеризуются наличием клеток, продуцирующих слизь, и секрецией слизи в просвет (рис. 6 (а), окрашивание PAS).Помимо дифференцированных зон, характеризующихся, например, наличием клеток, продуцирующих слизь, в органоидах кардии также можно выделить пролиферативные зоны, что видно по окраске Ki-67 (рис. 6(а)). Клетки с пролиферативной активностью, по-видимому, не были распределены случайным образом, а скорее накапливались в расширяющихся областях органоидов (рис. 6(а)). Чтобы проверить чистоту выделенных органоидов кардии, α -SMA показал преимущественно отрицательный результат, за исключением лишь нескольких положительных фибробластов, прилегающих к пролиферативному эпителию (рис. 6(а)).Чтобы доказать наличие стволовых клеток в наших органоидах кардии, мы демонстрируем присутствие меченых Lgr5-CreTM-GFP эпителиальных клеток в условиях культивирования (см. Рисунок 6(b)).

Для выделения нейронов из кишечной нервной системы использовали детенышей в возрасте 7–10 дней от мышей Dclk1.Cre.GFP-Tom fl/fl GFP , как описано выше (рис. 6). (с)). Этот рисунок демонстрирует чистое выделение нейронных структур из кишечника, которые затем можно культивировать с органоидами кардии из модели Барретта.В качестве дополнительного доказательства наличия нервов, демонстрирующих положительное происхождение, было проведено окрашивание бета-III тубулином нейронов, культивированных in vitro , которые почти исключительно пометили нейроны (рис. 6(d)). Таким образом, используя репортер линии Dclk1, мы смогли специально выделить нейриты ENS и вырастить их в условиях трехмерной совместной культуры (рис. 6 (e)). Нейроны демонстрировали заметный отросток нейритов и были физиологически активны до 10-го дня культивирования, как показано с использованием Ca-визуализации (рис. 6 (f) и 6 (g)).Анализ RLI показал резкое увеличение при стимуляции нейронов никотином, а затем показал снижение RLI с течением времени в интересующих областях (ROI) в отсутствие никотина (рис. 6(g)).

3.6. Нейроны усиливают рост органоидов кардии мышей

Сравнивая различные условия культур органоидов с нейронами и без них и вариации культуральной среды, мы наблюдали значительные различия между культурами с нейронами и без них, как описано ранее [12].Мы сравнили органоидные культуры эпителия Барретта, выделенного из пищевода Барретта от мышей pL2-IL-1b [13], культивируемых с CM, Wnt-кондиционированным CaM и сокультурой с нейронами в NBM, при этом нормальные органоидные культуры в CM были контрольными группами в семь дней и десяти дней (состав сред см. в табл. 1). Сравнение органоидов кардии в среде, кондиционированной Wnt, и в кокультуре с нейронами остается особым интересом, поскольку роль нервов и передачи сигналов Wnt недавно интенсивно исследовалась в желудочно-кишечном онкогенезе [17].

Интересно, что средние значения ± SEM (стандартная ошибка среднего) групп показали очень значимые различия уже после семи дней культивирования (см. Таблицу 2), всего было проведено три эксперимента на группу и в определенный момент времени. Размер органоидов, культивируемых в CaM (среда с кондиционированием Wnt), по сравнению с CM показал значительно большие органоиды через семь и десять дней с применением обоих методов измерения размера органоидов (). Тот же результат показан для сравнения органоидов в CM по сравнению с органоидами в NBM с нейронами в совместной культуре (NBM + N) ().Органоиды в NBM, совместно культивированные с нейронами, по сравнению с органоидами, культивируемыми в CaM, не показали каких-либо существенных различий в размере как на 7-й, так и на 10-й день (рис. 6 (h) и 6 (i), примеры культивируемых и совместно культивируемых органоидов показаны на рис. 6 ( ж)). Интересно, что количество органоидов с течением времени достигло 1,5–2-кратного увеличения количества органоидов на лунку уже на 4-й день культивирования как в условиях CaM, так и при кокультуре с нервами по сравнению с контрольной группой, культивируемой в CM (данные не показаны), хотя количество органоидов сбалансировано на 10-й день культивирования для всех сравниваемых условий.Кроме того, судя по анализу диаметров и окружностей, последние можно рассчитать по диаметрам (табл. 2).

+ + +

Среднее ± SEM Среднее ± SEM
(диаметр) (Окружность) (Измерения)

Cardia in CM (7 d) 96.54 ± 4.316 318.5 ± 14.67 93 93
Cardia в камере (7 д) 183,3 ± 20.74 606.8 ± 66,98 79
99999945 169,7 ± 11,76 548,3 ± 37,37 96
Cardia в МС (10 г) 84,40 ± 3,850 275,8 ± 12,44 77
Cardia в СаМ (10 г) 279,9 ± 21.67 949.4 ± 94.87 60
Cardia + N в NBM (10 д) 269.1 ± 26.72 883,2 ± 90.80 79

SEM = стандартная ошибка среднего.
4. Выводы

Здесь мы описываем использование и модификацию различных методов 3D-культивирования, которые можно использовать для анализа роли и функции различных компонентов ниши стволовых клеток in vitro .Базовым элементом каждой трехмерной клеточной культуры является матрикс, играющий роль каркаса для клеток и тканей, подобно ВКМ, присутствующему в органах in vivo . Примеры матриц, используемых в трехмерной клеточной биологии, следующие: матригель, коллаген и гидрогель [31–35]. 3D-культуры клеток показали измененный профиль экспрессии генов по сравнению с 2D-культурами [36]. Здесь мы описываем модификацию и внедрение трех различных методов 3D-культуры клеток для изучения эпителия желудочно-кишечного тракта взрослых, чтобы оценить их потенциал для изучения нишевых факторов: (1) культура тканей ex vivo , (2) органотипическая культура клеток (OTC) и (3) органоидная культура (см. рисунок 1).Далее мы выполнили сокультуры с фибробластами взрослых мышей, коллагеном или нейронами взрослых мышей, и наши данные показывают, что клеточные компоненты ниши in vitro , представленные здесь миофибробластами и нейронами, поддерживают рост эпителиальных органоидов, содержащих стволовые клетки; однако точные механизмы взаимодействия могут быть предметом дальнейшего изучения.

Культура ткани ex vivo характеризуется самой высокой биологической сложностью из всех этих методов.Он сохраняет стволовые клетки и их нативную нишу, и любые манипуляции в культуре тканей ex vivo повлияют на всю единицу ниши стволовых клеток. Тем не менее, этот метод культивирования не позволяет проводить специфический анализ отдельных компонентов ниши стволовых клеток, и поэтому мы предлагаем здесь новый аспект разделения этих различных компонентов, таких как взрослые перикриптальные фибробласты, коллаген и взрослые нервы из ЭНС, на отдельные отдельные сокультуры. пробы. Этим критериям соответствуют как безрецептурные, так и органоидные культуры.Преимущество OTC по сравнению с органоидной культурой, однако, заключается в характеристике интерфейса воздух-жидкость, недавно описанной как фактор клеточной дифференцировки [37], и обработке для целей иммуногистохимии, даже с учетом того факта, что для OTC требуется много клеток. . В кишечнике взрослых мышей эпителий окружен слоем субэпителиальных миофибробластов [38], и, вероятно, гетерогенность миофибробластов коррелирует с градиентом критических нишевых факторов (например, лигандов Wnt, BMP), которые определяют зоны пролиферации и дифференцировки в клетках кишечника. единица крипта-ворсинка [39].На основании их анатомического расположения было высказано предположение, что субэпителиальные миофибробласты являются клеточным компонентом эпителиальной ниши кишечника и регулируют самообновление и дифференцировку ИСК [40]. Кокультуры, в которых использовались клетки человеческого происхождения, показали, что определенный тип младенческих фибробластов может увеличить продолжительность жизни культур человеческих органоидов/энтероидов [33, 34]. Здесь мы демонстрируем, что перикриптальные фибробласты взрослых мышей также влияют на размер крипт и выживаемость в условиях органотипической культуры с прямым контактом эпителиальных мезенхимальных клеток, снова предполагая, что фибробласты представляют нишевые клетки для кишечных стволовых клеток и их способности к дифференцировке.

В качестве другого примера мы демонстрируем, что нормальные кишечные крипты демонстрируют меньшее почкование при культивировании в матрице, состоящей из коллагена и матригеля (клеточная матрица, используемая для безрецептурных препаратов). Поскольку Matrigel уже содержит коллаген, клеточный матрикс для безрецептурных препаратов характеризуется повышенной концентрацией коллагена, что, вероятно, приводит к увеличению жесткости матрикса. Наши результаты подтверждают предыдущие выводы о том, что коллаген может модифицировать матрикс органоидной культуры [41], и предполагают, что повышенная концентрация коллагена оказывает большое влияние на условия роста кишечных органоидов, поскольку ограничивает образование зачатков и поэтому должна рассматриваться как предостережение в будущий анализ систем органоидной культуры.

Все больше исследований указывают на важность нервов в регуляции ниши кишечных стволовых клеток [12, 17, 42, 43]. Также постулируется роль нервов в развитии неоплазии [17, 28, 29]. Было показано, что нервные волокна поддерживают канцерогенез либо механическими аспектами, будучи анатомической структурой, используемой в качестве ориентира для роста опухоли при инвазии периневральной опухоли, либо функциональными аспектами, включающими нейротрансмиттеры, влияющие на локальную васкуляризацию, миграционную активность соседних клеток или сам неонейрогенез [29, 44, 45].Интересно, что при хирургической или фармакологической денервации желудка было показано, что денервированная часть желудка имеет заметно сниженную заболеваемость и прогрессирование опухоли в различных мышиных моделях рака желудка [17]. В то же время это коррелировало с подавлением Wnt3a в нише стволовых клеток денервированной части желудка. Здесь мы представляем новый метод выделения различных кишечных нервов из мышиной ЭНС, идентифицированной по линии Dclk1-Cre-Tom/GFP, и проводим кокультуры нервов с кардиальными органоидами in vitro (рис. 5 и 6).

Ранее мы показали, что кишечные [12] и желудочные [17] органоиды можно культивировать вместе с нейронами. Здесь мы демонстрируем, что при культивировании кардиальных органоидов, которые специфически зависят от передачи сигналов Wnt в системе 3D монокультуры, при совместном культивировании с нервами они, по-видимому, способны замещать передачу сигналов Wnt. Путь Wnt представляет собой фундаментальный сигнальный путь для ISCs, и нарушение регуляции этого пути приводит к раку кишечника [46]. Наш анализ культур и кокультур преимущественно круговых органоидов кардии из нашей мышиной модели пищевода Барретта демонстрирует некоторые интересные детали взаимодействия нейронов в кишечной нише.Органоиды, культивированные в среде, кондиционированной Wnt, по сравнению со стандартной средой для крипт уже показали значительную разницу в росте органоидов через семь и десять дней (см. для определения роста. Совместное культивирование с нейронами также показало весьма значительную разницу в росте органоидов по сравнению со стандартной средой крипт через семь и десять дней без какой-либо добавки Wnt. Тот же эффект отражен в 1.5–2-кратное увеличение количества органоидов на лунку как в Wnt-кондиционированной монокультуре, так и в совместной культуре нейронов по сравнению со стандартной монокультурой. Интересно, что не было существенной разницы в росте и количестве органоидов между органоидами, культивируемыми в кондиционированной Wnt среде или совместно культивируемыми с нейронами, ни на 7-й, ни на 10-й день. периода наблюдения, что подчеркивается этими значительными различиями в росте органоидов между контрольной и совместно культивируемой группой.

Судя по этим результатам, в отсутствие Wnt наиболее вероятно, что влияние нейронов на органоиды способствует росту органоидов, что может указывать на то, что нейроны и их передатчики замещают эффект передачи сигналов Wnt. Это свидетельствует в пользу передачи сигналов нейронами, которая создает пролиферативную среду и поддерживает рост органоидов сильнее, чем обычно применяемые факторы роста, используемые в стандартной среде крипт, которые уже были постулированы и продемонстрированы Чжао и коллегами [17].В их исследовании рост органоидов желудка заметно ускорялся при совместном культивировании с нейронами и без нейронов, но при стимуляции пилокарпином (неспецифическим агонистом мускариновых рецепторов), и были показаны гены-мишени Wnt, такие как Lgr5 , Cd44 и Sox9 . быть повышенным [17]. В будущих исследованиях еще предстоит выяснить, какие факторы приводят к увеличению роста органоидов в совместной культуре нейронов по сравнению со средой, кондиционированной Wnt. Нейроны являются богатыми источниками нейротрофических факторов, включая фактор роста нервов (NGF), семейство лигандов GDNF (таких как GDNF, артемин и нейтурин) или трансформирующий фактор роста бета 1 [47].Можно представить, что эти факторы могут существенно способствовать поддержанию и росту органоидов или ниш стволовых клеток в желудке. В наших экспериментах мы применяли NGF в нейробазальной среде, так что еще предстоит выяснить, обусловлен ли описываемый здесь эффект этим единственным нейротрофическим фактором или другими. Наши наблюдения также предполагают, что кишечные нейроны могут иметь сходные трофические функции в поддержании целостности эпителия в кишечнике, как это известно для клеток кишечной глии [48].Таким образом, мы решительно поддерживаем будущий акцент на изучении путей взаимодействия между нейронами и стволовыми клетками кишечника, чтобы охарактеризовать состав ниши раковых стволовых клеток, способствуя развитию терапевтических средств, направленных на возникновение злокачественных новообразований в качестве предполагаемых терапевтических мишеней.

В настоящее время доступен широкий спектр последующих методов анализа органоидов, например, иммуногистохимия и иммунофлуоресценция [11, 49], система CRISP-Cas9 [50, 51], трансдукция органоидов ретровирусной конструкцией [52] или анализ клоногенности [53] (см. рис. 7).В сочетании с культурой фрагментов кишечника ex vivo [15], в которой сохранена специфическая локальная ниша, мы предлагаем данные типы культур в качестве надежных физиологически значимых 3D-моделей для анализа мезенхимально-эпителиального перекрестного взаимодействия в стволовых клетках кишечника. нишу и определить основной механизм раннего онкогенеза. Хотя наши результаты до сих пор не позволяют делать каких-либо принципиальных выводов о специфической роли этих компонентов в нише стволовых клеток, представленные методы совместного культивирования указывают на важную функцию типов стромальных клеток в описанных условиях 3D-культивирования.


Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Author: alexxlab

Добавить комментарий

Ваш адрес email не будет опубликован.