Азот какая подгруппа: Азота подгруппа — Справочник химика 21

Содержание

Азота подгруппа — Справочник химика 21


    Сравнить физические и химические свойства водородных соединений элементов подгруппы азота, указав как изменяются а) температуры кипения и плавления б) термическая устойчивость в) окислительно-восстановительные свойства г) кислотно-основные свойства. Назвать причины, вызывающие эти изменения, [c.232]

    К подгруппе ванадия относятся элементы побочной подгруппы пятой группы ванадий, ниобий и тантал. Имея в наружном электронном слое атома два или один электрон, эти элементы отличаются от элементов главной подгруппы (азота, фосфора и др.) преобладанием металлических свойств и отсутствием водородных соединений. Но производные элементов обеих подгрупп в высшей степени окисленности имеют значительное сходство. [c.651]

    Элементы главной подгруппы V группы — азот Ы, фосфор Р, мышьяк Аз, сурьма 8Ь, висмут 81. Согласно электронным конфигурациям их атомов [c.

343]

    Дать сравнительную характеристику атомов элементов подгруппы азота, указав а) электронные конфигурации б) валентные возможности в) наиболее характерные степени окисленности. [c.228]

    Вышли следующие тома т. 1, 1956 (общие сведения, воздух, вода, водород, дей-теряй, тритий, гелий и инертные газы, радон) т. 3, 1957 (главная подгруппа I группы, побочная подгруппа I группы) т. 4, 1958 (бериллий, магний, кальсий, стронций, барий) т. 7, 1959 (скандий — иттрий, редкие земли) т. 10. 1956 (азот, фосфор) т. И, 1958 (мышьяк, сурьма, висмут) т. 12, 1958 (ванадий, ниобий, тантал, протактиний) т. 14, 1959 (хром, молибден, вольфрам) т. 15, 1960 (уран и трансурановые элементы) т. 16. 19(Ю (фтор, хлор, бром, марганец) т. 18, 1959 (комплексные соединения железа, кобальта. никеля) т. 19, 1958 (рутений, осмнй, родий, иридий, палладий, платина). [c.127]

    Подгруппа кислорода Подгруппа азота Подгруппа углерода [c.155]

    При переходе от легких элементов к более тяжелым внутри каждой данной подгруппы элементов ионизационные потенциалы уменьшаются. Таким образом, хотя азот, фосфор, мышьяк, сурьма и висмут обладают в наружной электронной оболочке одинаковым числом электронов, прочность связи последних в атоме постепенно убывает при переходе от азота к висмуту. Этим и объясняется давно установленное нарастание металличности самих элементов, ослабление кислотных свойств и нарастание основных свойств их однотипных окислов, гидроокисей, сульфидов и уменьшение устойчивости соединений с металлами или с водородом (например, соединений аммония, фосфония и т. д.). [c.43]


    ПОДГРУППА УА (АЗОТ, ФОСФОР, МЫШЬЯК, [c.392]

    Подгруппа VA (азот, фосфор, мышьяк, сурьма висмут) 

[c.4]

    Оксиды фосфора и кремния существуют в полимерном состоянии, а оксиды азота и углерода не обладают такой особенностью. Почему Как изменяется способность к полимеризации при переходе вниз по подгруппе  [c.153]

    Элементы пятой главной подгруппы (подгруппы азота) [c. 154]

    Водородная связь. Еще в XIX веке было замечено, что соединения, в которых атом водорода непосредственно связан с атомами фтора, кислорода и азота, обладают рядом аномальных свойств. Это проявляется, например, в значениях температур плавления и кипения подобных соединений. Обычно в ряду однотипных соединений элементов данной подгруппы температуры плавления и кипения с увеличением атомной массы элемента возрастают, Это объясняется усилением взанмиога притяжения молекул, чтб связано с увеличением размеров атомов и с ростом дисперсионного взаимодействия между ними (см. 48). Так, в ряду H I—НВг—HI температуры плавления равны, соответственно, 

[c.154]

    Иначе говоря, галогены являются окислителями. Они соединяются с очень многими химическими элементами, образуя галогениды. Галогены реагируют с подавляющим большинством металлов и неметаллов непосредственно, за исключением кислорода, углерода, азота и благородных газов. Фтор реагирует даже с ксеноном. Связи галогенов с металлами главных подгрупп I и II групп носят преимущественно ионный характер, с остальными — в основном ковалентный. [c.102]

    Подгруппа азота. Подгруппу азота составляют 5 элементов азот, фосфор, мышьяк, сурьма и висмут (см. периодическую систему элементов Д. И. Менделеева). [c.235]

    Атомы элементов главной подгруппы V группы периодической системы имеют во внешних электронных оболочках 5 электронов. В соответствии с этим для азота и его аналогов должны быть характерны отрицательная валентность —3 и высшая положительная валентность 4-5. Однако если предположение о высшей положительной валентности, равной +5, в полной мере обосновано для аналогов азотафосфора, мышьяка — сурьмы и висмута, то для самого азота оно может быть принято лишь условно. В самом деле, свою высшую положительную валентность элементы проявляют обычно в соедине- 

[c.77]

    ЭЛЕМЕНТЫ ПОДГРУППЫ АЗОТА [c.228]

    При обычных температурах в основном стандартном состоянии водород, кислород, азот, фтор, хлор и элементы подгруппы гелия являются газообразными, бром и ртуть — жидкими, а остальные элементы — кристаллическими.[c.24]

    Водородные соединения элементов подгруппы азота общей формулы ЭНз представляют собой бесцветные газообразные вещества с характерными резкими запахами. Непосредственным синтезом из элементов получить гидриды азота и его аналогов довольно трудно, их обычно получают путем разложения соответствующих нитридов, фосфидов или арсенидов металлов водой 

[c.80]

    Элементы подгруппы азота в количествах до 10 % существуют в дистиллятах и остатках перегонки нефти в виде мышьяк, сурьма- и фосфор -органических соединений со связями типа Э-С, Э-S, Э-Н, Э-0-S, 3=0. Предполагается, что низкомолекулярная фракция соединений As и Sb представлена их алкил- или арилпроизводными, а высокомолекулярные соединения как производные от внедрения их в молекулы асфальтенов по механизму замещения серы. [c.17]

    Какие наиболее характерные валентности имеют элементы подгруппы азота  [c.152]

    При комнатной температуре газообразный азот не взаимодействует с такими активными металлами, как Na, К, Rb и s.

Несмотря на то что при переходе вниз по подгруппе металлические свойства усиливаются, азот реагирует с литием уже при комнатной температуре. Как это объяснить  [c.154]

    Физические и химические свойства элементов подгруппы азота зменяются с увеличением порядкового номера в той же пееледо-ательности, которая наблюдалась в ранее рассмотренных fpyn-lax. Но так как неметаллические свойства выражены у аэот ла-iee, чем у кислорода и тем более фтора, то ослабление йтия войств при переходе к следующим элементам влечет за собой ио-(вление и нарастание металлических свойств. Последние заметны [c.397]

    Оксиды элементов главных подгрупп со значительным парциальным зарядом на атоме кислорода являются ионными соединениями (НагО, СаО). Соединения с немного меньшим парциальным зарядом на атоме кислорода имеют полимерное строение, причем связь элемент — кислород в них приобретает в значительной степени ковалентный характер (В2О3, SiOj). И наконец, оксиды с атомами кислорода, на которых сосредоточен очень небольшой отрицательный заряд, представляют собой молекулярные вещества (Р4О10, СО2, оксиды азота, серы и некоторые оксиды галогенов).

[c.472]

    Еще в XIX веке было замечено, что соединения, в которых атом водорода непосредственно связан с атомами фтора, кислорода и азота, обладают рядом аномальных свойств например, температур плавления и кипения. Обычно в ряду однотипных соединений элементов данной подгруппы температуры плавления и кипения с увеличением атомной массы элемента возрастают. Это объясняется усилением взаимного притяжения молекул, с увеличением размеров атомов и с ростом дисперсионного взаимодействия между ними. Так, в ряду [c.155]


    Вторая группа может быть разделена на три подгруппы отходы, содержащие токсичные вещества неорганического происхождения в газо- или парообразном состоянии (например, HF, НС1 и др.) отходы, находящиеся в газо- или парообразном состоянии, содержащие токсичные вещества органического происхождения, в состав которых не входят галогены, фосфор, сера, азот отходы, находящиеся в газо- или парообразном состоянии, содержащие токсичные вещества органического происхождения, в состав которых входят галогены, азот, фосфор, сера.
[c.357]

    Почему азот при обычных условиях — газ, остальные р-элементы подгруппы азота — твердые кристаллические вещества  [c.126]

    Пятая группа состоит из типических элементов (азот, фосфор), элементов подгруппьс мышьяка (мышьяк, сурьма, висмут) и подгруппы ванадия (ванадий, ниобий, тантал). [c.389]

    Помимо а-связей, элементы главной подгруппы пятой группы способны к образованию л-связей. В случае азота —это главным образом ря—ря-связи. Особые свойства молекулы азота частично обусловлены ротационной симметрией обеих л-свя-зей. У других элементов, особенно у фосфора, возможно образование Ря—dn-связей. Это обычно имеет место в соединениях со связями Р—F и Р—О. 

[c.529]

    ПОДГРУППА АЗОТА 52. ОБЩИЕ СВЕДЕНИЯ [c.118]

    Элементарные вещества по их отногнению к титану разделяют на четыре группы Г) галогены и халькогены, образующие с титаном соединения ковалентного или ионного характера, нерастворимые или ограниченно растворимые в титане 2) водород, бериллий, эле 1ентарные вещества подгрупп бора, углерода, азота и большинство металлов В-подгрупп, образующие с титаном соединения интерметаллидного характера и ограниченные твердые растворы 3) налоги и ближайшие соседи титана по 1ер Юдической системе, образующие с титаном непрерывные ряды твердых растворов 4) благородные газы, щелочные, ще.

лоч го-земельные и редкоземельные (кроме скандия) металлы, не образующие с титаном ни соединении, ни твердых растворов. [c.262]

    Для всех элементов подгруппы азота известны окислы двух типов состава Э2О3 и Э-аОв. [c.82]

    Поскольку, помимо формальной валентности +3, элементы подгруппы азота могут проявлять и более высокие (например, +5) и более низкие (О и —3) валентности, окислы Э2О3, а также соответствующие им кислоты и соли могут, в зависимости от условий, выступать и как восстановители, и как окислители. Наиболее ярко выражены окислительные свойства у азотистой кислоты и ее солей—нитритов. Так, азотистая кислота окисляет йодиды до свободного йода, а сероводород — до серы, причем кислота восстанавливается до окиси азота N0 [c.83]

    При нагревании металлы подгруппы И1Б реагируют с кислородом, образуя Э2О3, азотом, давая ЭЫ, и многими другими веществами. [c.498]

    Атомы элементов главной подгруппы IV группы содержат во внешней электронной оболочке четыре электрона. Тенденция к отдаче электронов у свободных атомов углерода и его аналогов ныражена слабее, чем у соседей слева по периоду, а тенденция к приему электронов — слабее, чем у соседей справа. Вместе с тем обе эти тенденции выражены приблизительно в равной степени. Поэтому, если можно говорить о том, что атомам галогенов, кислорода или азота присущи электроотрицательные свойства, а атоллам щелочных и щелочноземельных ме- [c.92]

    Занимая промежуточное положение между типичными металлами и типичными неметаллами, элемент подгруппы углерода проявляют большое разнообразие в свойствах и образуют значительное число различных соединений. В соединениях с галогенами, кислородом, серой, азотом углерод и его аналоги выступают в роли восстановителей, т. е. проявляется их металлическая природа С + 2С1г = ССЦ 51 + Оз = 5102 Ое + 25 = = СеБз 2С + О2 = 2С0 35п + N3 = [c.96]

    Как низшим, так в еще большей степени высшим окислам элементов подгруппы азота присуща нреимуще- [c. 82]

    В целом металлы подгруппы И.Д химически активны при нагревании они взаимодействуют с галогенами и серой с образн-ванием соответствующих солей, соединяются с молекулярным азотом. [c.128]

    Сила всех высших кислот элементов подгруппы азота выше, чем у соответс1вующих …истых кислот низших валентностей, поскольку накопление электроотрицательных атомов кислорода в кислотных остатках приводит к более сильному оттягиванию электронной пары связи Н О—КОа в сторону атома кислорода, т. е. связь Н—О в высших кислотах более полярна и легче рвется под действием дипольных молекул воды. [c.85]


Подгруппа азота

ОБЩАЯ ХАРАКТЕРИСТИКА
 
Общая характеристика элементов главной подгруппы V группы
(подгруппы азота)
 
Таблица. Электронное строение и физические свойства

Поряд-
ковый

Элемент

Относит.
атомная
масса

Электронная
конфигурация

Атомный
радиус,
нм

ПИ
эВ

ЭО

Степени
окисления

t°пл.
°С

t°кип.
°С

r
г/см3

7

Азот (N)

14,01

[He] 2s22p3

0,075

14,5

3,0

-3, -2, -1, +1,
+2, +3, +4, +5

-210

-196

 

15

Фосфор (P)

30,97

[Ne] 3s23p3

0,110

10,5

2,1

-3, +1, +3,  +5

44,1

280

1,83

33

Мышьяк (As)

74,92

[Ar] 3d104s24p3

0,121

9,8

2,0

-3, +3, +5

613

 

5,7

51

Сурьма (Sb)

121,75

[Kr] 4d105s25p3

0,141

8,6

1,9

-3, +3, +4, +5

630,7

1750

6,68

83

Висмут (Bi)

208,98

[Xe] 4f145d106s26p3

0,152

7,8

1,9

+3, +5

271,3

1560

9,78


  В ряду  –N – P – As – Sb – Bi ® увеличиваются размеры атомов, ослабляется притяжение валентных электронов к ядру, ослабляются неметаллические свойства, возрастают металлические свойства, ЭО уменьшается.
 
N, P — типичные неметаллы
As, Sb — проявляют неметаллические и металлические свойства
Bi — типичный металл
P, As и Bi существуют в твердом состоянии в нескольких модификациях.
 
Химические свойства
 

      1.      Основной характер оксидов R2O5 увеличивается, а кислотный – ослабевает с увеличением порядкового номера.
      2.      Гидроксиды всех элементов в пятивалентном состоянии имеют кислотный характер.
      3.      Основной характер гидроксидов R(OH)3 увеличивается, а кислотный – ослабевает с увеличением порядкого номера.

 
RO33- + 3H+ « R(OH)3 « R3+ + 3OH- (R – элемент)
 

      4.      As, Sb, и Bi плохо растворимы в воде.
      5.      Восстановительные свойства водородных соединений Rh4 усиливаются, а устойчивость уменьшается с увеличением порядкого номера.

 

 

 

 

 

Общая характеристика элементов V группы главной подгруппы. Азот

Схема конспекта открытого урока по теме «V группа главная подгруппа»

Тип урока: урок изучения нового материала

Цели урока: Организация усвоения новых знаний и применение ранее приобретенных навыков и умений

Задачи:

Образовательные: способствовать усвоению новых знаний на основе имеющихся. Формирование умений и навыков составлять схему строения атома азота с указанием числа электронов в электронных слоях; определять характерную валентность и степени окисления азота; рассматривать химические свойства азота в свете окислительно-восстановительных возможностей атома.

Развивающие: способствовать развитию самостоятельного мышления, памяти, умения сравнивать.

Воспитательные: создать условия для формирования личностных качеств обеспечивающих ответственность и добросовестность учащегося, его критичность и самокритичность, активность и внимательность при выполнении мыслительных процессов.

Методы проведения: объяснительно-иллюстративный, репродуктивный, частично-поисковый

Методика проведения: методика разноуровневого и дифференцированного обучения приём нахождения аналогии.

Дидактические материалы:

  1. Справочный материал:

  1. Материал к уроку

  1. Технические средства:

Этап урока. Задачи на каждый этап урока

Содержание этапа урока. Деятельность учителя

Деятельность ученика

I.Организационный момент

Настраиваю на успешную работу.

Способствую воспитанию самоконтроля

Приветствие обучающихся и гостей урока. Отмечаю отсутствующих. Поверяю готовность к уроку.

Приветствие гостей и учителя, подготовка к уроку

II.Актуализация имеющихся знаний 1.Подвожу к теме урока.

На фоне ролика ведётся описание вещества с опорой на прошлый опыт (природоведение, 8 класс) не упоминая его названия

Смотрят, слушают. Предполагают тему урока после окончания ролика

2.Определяю основные задачи урока

  • Должны научиться давать характеристику элементам V группы главной подгруппы

  • Должны знать основную валентность азота

  • Должны знать основные степени окисления азота

  • Должны знать химические и физические свойства азота

Запись темы урока. Слушают и анализируют

3.Выбор дифференцированной цели

Первая цель – жёлтая требует только передачу тех знаний, которые Вы узнаете.

Вторая цель потребует умения логически мыслить. Умения объяснить те факты, которые узнает на уроке.

Третья цель потребует мобилизации всех Ваших знаний и не только по химии

Жёлтая цель (базовый уровень)- А

Зелёная цель (продвинутый уровень) — В

Красная цель (повышенный уровень)- С

Уметь давать характеристику элементов главной подгруппы, знать основную валентность и степени окисления азота. Знать физические и химические свойства азота.

А + Уметь объяснять изменения

свойств элементов в главной

подгруппе. Уметь объяснять окислительно-восстановительные свойства азота.

В + Уметь предполагать свойства

азота, давать обоснования своим выводам, применять знания на практике.

III.Изучение нового материала

Развиваю навыки работы с периодической системой Д. И. Менделеева, навыки логического мышления, умение сравнивать.

Воспитываю внимательность, аккуратность

1.Работа с учебником и справочным материалом (периодической системой элементов). Ответ на вопрос. Вопросы выводятся на экран и прочитываются. Ответы дублируются на экране для сверки.

Отвечают на вопрос и запись в тетрадях: 1.Какие элементы ходят в V группу главную подгруппу?.

2. Как изменяются свойства элементов в группе относительно друг друга сверху вниз?

Запись в тетрадях. Отвечают на вопрос: 1.Каково строение внешней электронной оболочки атомов V группу главную подгруппу? Ученик отвечает у доски.

2.Как ещё можно назвать элементы V группы главной подгруппы?

3.Почему увеличивается заряд ядра элементов в группе от азота к висмуту?

4.Почему увеличивается радиус атомов в группе от азота к висмуту?

Запись в тетрадях. Отвечают на вопрос: 1.Что объединяет все элементы данной группы? Ученик отвечает у доски.

2. Почему увеличивается атомная масса элементов в группе от азота к висмуту?

3.Почему увеличиваются металлические свойства элементов в группе от азота к висмуту?

4.Почему уменьшается электроотрицательность элементов в группе от азота к висмуту?

Активизация внимания, познавательной деятельности, любопытства. Межпредметная связь

Краткий очерк о открытии азота и его названии

Запись в тетрадях, слушают.

Запись в тетрадях, слушают. Отвечают по вопросу валентности и степени окисления азота

Запись в тетрадях, слушают. Отвечают на противоречивость названия и свойств азота

Активизация познавательного интереса. Развиваю навыки работы с учебником, умение самостоятельного получения обучающимися необходимой информации, путём создания минимальных условий развития индивидуальной наблюдательности, способствую развитию навыка логического мышления, умение сравнивать.

2.Определение валентностей и степени окисления азота на основе графической записи строения внешней электронной оболочки

Запись в тетрадях

Работа у доски. Запись в тетрадях

Работа с учебником. Пояснение и запись в тетрадях

Создаю условия для развития памяти, способствую развитию навыка логического мышления, умение сравнивать, умение делать выводы и обосновывать их.

3.Первичное закрепление пройдённого материала

  • Какие элементы входят в VА группу?

  • Какова основная валентность азота?

  • Каковы основные степени окисления азота?

  • Что означает запись N-3?

  • Что означает запись N +3?

  • Что означает запись N0?

Создаю условия для развития памяти, способствую развитию навыка логического мышления, умение сравнивать, умение делать выводы и обосновывать их.

строение молекулы простого вещества азот.

Разрешается хоровой ответ

Запись в тетрадях

Запись в тетрадях

Запись в тетрадях

Создаю условия для развития памяти, способствую развитию навыка логического мышления, умение сравнивать, умение делать выводы и обосновывать их.

Химические свойства азота

Азот окислитель.

Азот восстановитель

Запись в тетрадях

Запись в тетрадях

  • С какими элементами будет вступать в реакции азот как окислитель?

  • С какими элементами будет вступать в реакции азот как окислитель?

Запись в тетрадях

Создаю условия для развития памяти (уроки природоведения, повторение материала 8 класса), способствую развитию навыка логического мышления, умение сравнивать, делать выводы и обосновывать их.

Физические свойства азота

Запись в тетрадях. Ответ на вопрос о физических свойствах азота на основе просмотренного опыта и ленного опыта

Запись в тетрадях

Запись в тетрадях

IV.Закрепление материала

Создаю условия для развития памяти, для формирования личностных качеств обеспечивающих ответственность и добросовестность учащегося, его критичность и самокритичность. Способствую развитию навыка логического мышления, умение сравнивать.

  • Как проявляет себя азот в химических реакциях?

  • С чем вступает азот в реакции как окислитель?

  • С чем вступает азот в реакции как восстановитель?

Помогают жёлтой команде при ответах

V. Подведение итогов

Напутственное слово. Создание условий для самооценки своей работы на роке

Кто набрал три жетона одного цвета?

Кто набрал больше трёх жетонов?

У кого есть жетоны другого цвета?

На обратной стороне своих жетонов напишите фамилию и сдайте в конце урока.

Сдают жетоны после звонка с уроке

Сдают жетоны после звонка с уроке

Сдают жетоны после звонка с уроке

VI.Домашнее задание

Создаю условия для развития познавательной деятельности учащихся, памяти

Здание выводится на экран

Запись Д/З

§ 15 стр.52 №1

Письменно ответить на два вопроса:

  1. Что я узнал на пройдённой теме?

  2. Что я бы хотел узнать (на какой вопрос не получил ответ на уроке)?

Запись Д/З

§ 15 стр. 52 №1 составить кроссворд по теме урока из 5 слов

Запись Д/З

§ 15№1

Составить пять реакций превращения азота

VII.Рефлексия

Определение эмоционального настоя класса после урока

Дерево «осень-весна»

Оформление дерева «осень-весна»

Оформление дерева «осень-весна»

Оформление дерева «осень-весна»

Общая краткая характеристика подгруппы азота

Подгруппа азота занимает пятую группу (главную подгруппу) в таблице Дмитрия Ивановича Менделеева. В нее входит несколько элементов, каждый из которых заслуживает детального изучения и рассмотрения.

Краткая характеристика

Азот является важнейшим составным элементом земной атмосферы (78% от объема). В биосфере он входит в состав белковых молекул, считается основным элементом для образования жизни на нашей планете. В литосфере элементы подгруппы азота встречаются в виде нитратов, фосфатов.

Природный азот представляет собой совокупность двух изотопов:

  • 99,635% массы составляет 14 N;
  • 0,365% массы включает 15 N.

Фосфор считается составным компонентом живых организмов. В природе он находится в виде фосфатов (минералов).

Висмут, сурьма, мышьяк широко встречаются в природе в составе сульфидных руд. Мышьяк – это важный элемент, отвечающий за рост волос. Его соединения ядовиты, в небольших дозах применяются в ветеринарии и медицине.

Фосфор востребован в авиации, сельском хозяйстве, медицине.

Особенности строения атомов

Подгруппа азота содержит на последнем энергетическом слое пять валентных электронов. Представители данной группы могут отдавать их в ходе химических взаимодействий либо принимать от других атомов три электрона, завершая внешний энергетический уровень. Именно поэтому подгруппа азота имеет степени окисления от -3 до +5. Высшие оксиды проявляют кислотный характер, имеют общую формулу R2 O5.

Подгруппа азота образует летучие водородные соединения состава RH3.

Изменение свойств

Элементы анализируемой подгруппы проявляют неметаллические свойства. Их способность притягивать электроны ниже, чем у представителей подгруппы халькогенов и галогенов. Чем еще отличается подгруппа азота? Свойства металлического характера (восстановительная способность) возрастают от азота к висмуту, так как возрастает радиус атома.

Физические свойства

Фосфор и азот являются типичными неметаллами, сурьма и мышьяк проявляют двойственные свойства, а висмут – это типичный металл. Практическая подгруппа азота имеет типичные физические свойства. Азот – газообразное вещество молекулярного строения, без вкуса, запаха, хорошо растворим в воде. Фосфор, обладающий тетраэдрическое строение, является мягким твердым веществом, имеющим несущественную растворимость в воде.

Мышьяк – это твердое вещество, обладающее на изломе металлическим блеском. Данное соединение нерастворимо в воде, обладает несущественной проводимостью электрического тока.

Висмут – розово-белое, кристаллическое, хрупкое вещество, которое обладает несущественной электропроводностью.

Характеристика азота

Именно этим химическим элементом начинается подгруппа азота. Общая характеристика данного элемента должна начинаться с того, что он проявляет ярко выраженные неметаллические свойства. Только азот не способен увеличивать свои валентности. У него семь электронов, которые располагаются на двух энергетических уровнях. На внешнем уровне располагается пять электронов, поэтому азот способен проявлять следующие степени окисления: — 3,+5,-2,-1,+1,+2,+3,+4.

При нормальных условиях азот является молекулярным, малоактивным, газообразным веществом. Эта двухатомная молекула не вступает в реакцию с кислородом, чуть легче воздуха. При сжатии азот превращается в снегообразную массу. Данный газ не поддерживает горения, дыхания. При комнатной температуре он способен взаимодействовать только с литием, образуя его нитрид.

Чтобы разорвать молекулу азота, нужно потратить 942 кДж/моль энергии. Все химические взаимодействия, участником которых становится молекулярный азот, связаны с изменением степеней окисления, причем азот способен проявлять свойства и восстановителя, и окислителя.

При нагревании он способен взаимодействовать с металлами. При высокой температуре он реагирует с некоторыми неметаллами.

Если бы азот вступал во взаимодействия при комнатной температуре, он бы образовывал с кислородом воздуха окислы, что сделало бы невозможным существование на земле живых организмов.

Использование азота

В промышленности его получают из воздуха, применяя отличие температур кипения кислорода и азота. Это вещество используется в химической промышленности для синтеза аммиака, получения мочевины. Он нужен и для создания электрических ламп, сушке взрывчатых соединений, перекачке горючих жидкостей. Подгруппа азота и фосфора характеризуется соединениями, востребованными в разных отраслях промышленности. Остановимся на некоторых из них.

Аммиак

Его можно считать важнейшим водородным соединением азота, имеющим большое практическое значение. Бактерии перерабатывают молекулы азота в аммиак. Это бесцветный газ, который обладает резким запахом. Он существенно легче воздуха, отлично растворяется в воде. В окислительно-восстановительных процессах он проявляет восстановительные свойства. Аммиак взаимодействует с кислородом, образуя чистый азот или оксид азота (2), а с неорганическими кислотами образует соли аммония. Они нужны для изготовления взрывчатых веществ, электробатарей.

Его применяют для изготовления азотной кислоты и минеральных азотосодержащих соединений. В жидком виде он используется в холодильной промышленности. В медицине он необходим для изготовления нашатырного спирта, а в быту служит отличным средством для выведения пятен.

Оксиды азота

Пятая группа и подгруппа азота характеризуется возможностью образовывать сразу несколько видов оксидов. К примеру, азот образует целую группу соединений с кислородом.

Бурый газ (оксид азота IV) – это газообразное соединение, обладающее специфическим запахом. Вещество растворяется в воде, имеет свойства кислотного оксида, при нагревании распадается, ядовито.

Азотный ангидрид (оксид азота V) – это кристаллическое соединение белого цвета. При нагревании вещество разлагается, проявляет ядовитые свойства.

Азотная кислота и ее соли

Подгруппа азота, подгруппа углерода характеризуются образованием гидроксидов, которые имеют кислотные свойства.

В молекуле азотной кислоты находится три элемента, между которыми существуют ковалентные полярные связи. Данное молекулярное соединение, в котором азот проявляет максимальную степень окисления (+5) при валентности IV, является бесцветной жидкостью, дымящейся на воздухе, обладает едким запахом.

У концентрированной азотной кислоты желтый цвет. Ее плотность составляет 1,51 г/см3. Она растворяется в воде, проявляет свойства сильного электролита.

В разбавленном виде у азотной кислоты такие же химические свойства, что и у других минеральных кислот. При комнатной температуре азотная кислота распадается на бурый газ и воду, поэтому хранят соединение в прохладном темном месте.

Концентрированная кислота разрушает органические вещества, она способна вступать во взаимодействие даже с металлами, которые располагаются в ряду напряжений металлов после водорода.

Нитраты (соли азотной кислоты) получают при взаимодействии кислоты с металлами, основаниями, основными оксидами, аммиаком. Они являются твердыми веществами, имеющими хорошую растворимость в воде, являются сильными электролитами.

При повышении температуры происходит разложение нитратов. Качественной реакцией на нитрат-ион является взаимодействие с медными стружками (в присутствии концентрированной серной кислоты). Признаком процесса является выделение бурого газа.

Твердые соли определяют путем внесения их в пламя спиртовки. Яркая вспышка является подтверждением присутствия нитрата, так как являются взрывчатыми соединениями.

Заключение

Среди элементов, входящих в подгруппу азота, интерес представляет и фосфор. У него больший радиус атома, поэтому неметаллические свойства проявляются слабее. Данный химический элемент проявляет степени окисления 3,+3,+5. В свободном виде фосфор способен образовывать несколько аллотропных модификаций: красный, белый, черный. В химических взаимодействиях он проявляет и окислительные, и восстановительные свойства. Например, у белого фосфора молекулярная кристаллическая решетка, это вещество светится в темноте, является сильным ядом.

Красный фосфор не растворяется в воде, при нагревании до температуры плавления, он переходит в другую аллотропную модификацию.

Черный фосфор обладает полупроводниковыми свойствами, он тяжелее других аллотропных форм, внешне схож с графитом.

Среди соединений, которые образует фосфор, интерес представляют его оксиды.

Так, оксид фосфора (V) обладает гигроскопичностью, поэтому применяется в химической промышленности для осушки газообразных соединений.

При этом он превращается в аморфную массу — HPO3. В случае кипячения из оксида фосфора (V) образуется фосфорная кислота. H3PO4 является белым кристаллическим веществом, хорошо растворимым в воде. Данное соединение относится к сильным электролитам.

Большое количество фосфора расходуется на изготовление зажигательных снарядов, бомб, дымовых шашек. Соли фосфорной кислоты применяются в сельском хозяйстве в качестве минеральных удобрений. У всех элементов пятой группы (главной подгруппы) на внешнем уровне содержится одинаковое количество электронов, что можно считать общим признаком.

Контрольная работа №4: Подгруппа азота

Категория: Химия.

Контрольная работа №4: Подгруппа азота

Вариант 1

Выпишите номер правильного ответа (1 балл за каждый правильный ответ).

1. Физические свойства азота при комнатной температуре:

1 – бесцветный газ;

2 – бесцветный газ, без запаха;

3 – бесцветный газ, без запаха, малорастворим в воде;

4 – бесцветный газ, без запаха, малорастворим в воде, тяжелее воздуха.

2. Промышленный способ получения азота:

1 – разложение оксида ртути;

2 – перегонка жидкого воздуха;

3 – разложение бертолетовой соли;

4 – разложение нитрита аммония.

3. Места нахождения газообразного азота:

1 – воздух;

2 – воздух, море;

3 – воздух, море, почва;

4 – воздух, море, почва, растения и животные.

4. Условия, смещающие равновесие в системе:

2NO + O2 ↔ 2NO2 + Q влево:

1 – повышение давления и повышение температуры;

2 – повышение давления и понижение температуры;

3 – понижение давления и повышение температуры;

4 – понижение давления и понижение температуры.

5. Формула соединения, массовая доля азота в котором максимальна:

1 – NO;

2 – NO2;

3 – N2O3;

4 – N2O5

6. Физические свойства аммиака (при н. у. ):

1 – бесцветный газ;

2 – бесцветный газ с резким запахом;

3 – бесцветный газ с резким запахом, ядовит;

4 – бесцветный газ с резким запахом, ядовит, тяжелее воздуха.

7. Способ собирания аммиака – вытеснение:

1 – воды;

2 – воздуха.

8. Признак, по которому обнаруживают аммиак:

1 – запах;

2 – запах, посинение лакмуса;

3 – запах, посинение лакмуса, белый дым с HClконц;

4 – запах, посинение лакмуса, белый дым с HClконц, обесцвечивание фенолфталеина.

9. Установите правильную последовательность.

Водородная связь —

1 – и атомами

2 – между

3 – элементов

4 – связь

5 – сильно электроотрицательных

6 – атомами водорода

Установите соответствие (2 балла за каждый правильный ответ).

10. Определяемый ион: Реактив, содержащий ион:

1. NH4+ а) OH-;

2. CO32- б) Ag+;

в) H+;

г) SO42-

11. Сокращенное ионное уравнение:

1. 2H+ + CO32- = CO2↑ + H2O;

2. NH4+ + OH = NH3↑ + H2O

Молекулярное уравнение реакции:

а) (NH4)2SO4 + BaCl2 = BaSO4↓ + 2NH4Cl;

б) NH4Cl + NaOH = NaCl + NH3↑ + H2O;

в) (NH4)2CO3 + 2HCl = 2NH4Cl + CO2↑ + H2O;

г) NH4NO3 + NaOH = NaNO3 + NH3↑ + H2O.

Выпишите номер правильного ответа

12. Качественная реакция на соли аммония:

1 – взаимодействие со щелочами;

2 – взаимодействие со щелочами, разложение при нагревании;

3 – взаимодействие со щелочами, разложение при нагревании, реакции по анионам

13. Области применения солей аммония:

1 – сельское хозяйство;

2 – сельское хозяйство, производство взрывчатых веществ;

3 – сельское хозяйство, производство взрывчатых веществ, кондитерское дело;

4 – сельское хозяйство, производство взрывчатых веществ, кондитерское дело, паяние.

14. Пара металлов, которые не пассивирует концентрированная азотная кислота:

1 – медь и цинк;

2 – цинк и алюминий;

3 – алюминий и железо;

4 – железо и медь.

15. Установите соответствие.

Схема реакции: Продукты реакции:

1. Cu + HNO3 конц → а) Сu(NO3)2 + H2↑;

2. Fe + HNO3 конц → б) Сu(NO3)2 + NO2↑ + H2O;

в) реакция не идет;

г) Сu(NO3)2 + NO↑ + H2O;

д) Fe(NO3)2 + N2O + H2O.

16. Дополните (полный ответ 3 балла).

Масса азотной кислоты, полученной из оксида азота (IV) массой 23 кг при массовой доле выхода 0,95, равна … кг.

Установите соответствие.

17. Аллотропная модификация фосфора:

  1. Белый
  2. Красный

строение и свойства:

а) молекулярная кристаллическая решетка, ядовит;

б) не растворяется в воде и сероуглероде;

в) атомная кристаллическая решетка, не ядовит;

г) светится в темноте.

18. Продукты реакции: Исходные вещества:

1. Ag3PO4↓; а) Ag+ и H2PO4;

2. 2PH3 + 3Mg2+ б) 3Ag+ и PO43-;

в) P2O5 и Mg(OH)2;

г) Mg3P2 и 6H+

Решить задачи (3 балла за каждую задачу).

19. Масса 80%-й фосфорной кислоты, полученной из фосфора массой 62 кг, равна … .

20. Масса хлорида аммония, полученного при взаимодействии аммиака массой 34 т с раствором, содержащим 36,5 т хлороводорода, равна . . т.

Вариант 2

Выпишите номер правильного ответа (1 балл за каждый правильный ответ).

1. Роль азота в реакциях с металлами:

1 – окислитель;

2 – восстановитель.

2. Лабораторный способ получения азота:

1 – разложение оксида ртути;

2 – перегонка жидкого воздуха;

3 – разложение бертолетовой соли;

4 – разложение нитрита аммония.

3. Условия, смещающие равновесие в системе:

2NO + O2 ↔ 2NO2 + Q вправо:

1 – повышение давления и повышение температуры;

2 – повышение давления и понижение температуры;

3 – понижение давления и повышение температуры;

4 – понижение давления и понижение температуры.

4. Формула соединения, массовая доля азота в котором минимальна:

1 – NO;

2 – NO2;

3 – N2O3;

4 – N2O5

5. Дополните. Коэффициент перед формулой окислителя в реакции, схема которой Li + N2 → , равен … .

Выпишите номер правильного ответа.

6. Реагенты для аммиака:

1 – вода;

2 – вода, кислоты;

3 – вода, кислоты, кислород;

4 – вода, кислоты, кислород, щелочь

7. Направление дна сосуда для собирания аммиака

1 – вниз;

2 – вверх

8. Влияние водородной связи на физические свойства веществ:

1 – повышение температуры кипения и повышение температуры плавления;

2 – повышение температуры кипения и понижение температуры плавления;

3 – понижение температуры кипения и повышение температуры плавления;

4 – понижение температуры кипения и понижение температуры плавления.

9. Установите правильную последовательность.

Донорно – акцепторный механизм образования ковалентной связи –

1 – свободной

2 – образование

3 – из атомов

4 – за счет

5 – имеющейся

6 – связи

7 – электронной пары

8 – у одного

Установите соответствие (2 балла за каждый правильный ответ).

10. Определяемый ион: Реактив, содержащий ион:

1. Cl а) OH-;

2. NH+ б) Ag+;

в) H+;

г) SO42-

11. Сокращенное ионное уравнение:

1. NH4+ + OH = NH3↑ + H2O;

2. Ba2+ + SO42- = BaSO4

Молекулярное уравнение реакции:

а) (NH4)2SO4 + BaCl2 = BaSO4↓ + 2NH4Cl;

б) NH4Cl + NaOH = NaCl + NH3↑ + H2O;

в) (NH4)2CO3 + 2HCl = 2NH4Cl + CO2↑ + H2O;

г) NH4NO3 + NaOH = NaNO3 + NH3↑ + H2O.

12. Выпишите номер правильного ответа.

Химические свойства солей аммония:

1 – разложение при нагревании;

2 – разложение при нагревании, взаимодействие со щелочами;

3 – разложение при нагревании, взаимодействие со щелочами, реакции на анионы.

13. Установите соответствие.

Формула соли: Область применения:

1. NH4NO3 а) кондитерское дело;

2. NH4Cl б) сельское хозяйство;

3. (NH4)2CO3 в) производство взрывчатых веществ;

г) паяние.

14. Пара металлов, которые пассивирует концентрированная азотная кислота:

1 – медь и цинк;

2 – цинк и алюминий;

3 – алюминий и железо;

4 – железо и медь.

15. Установите соответствие.

Схема реакции: Продукты реакции:

1. Al + HNO3 конц → а) Сu(NO3)2 + H2↑;

2. Cu + HNO3 конц → б) Сu(NO3)2 + NO2↑ + H2O;

в) реакция не идет;

г) Сu(NO3)2 + NO↑ + H2O;

д) Al(NO3)3 + N2 + H2O.

16. Дополните (полный ответ 3 балла).

Масса азотной кислоты, полученной из оксида азота (IV) массой 92 кг при массовой доле выхода 0,90, равна … кг.

17. Выпишите номер правильного ответа.

Строение и свойства красного фосфора:

1 – молекулярная кристаллическая решетка, ядовит;

2 – не растворяется в воде и сероуглероде;

3 – атомная кристаллическая решетка, не ядовит;

4 – светится в темноте.

18. Установите соответствие.

Продукты реакции: Исходные вещества:

1. = H2O а) H+ и OH=;

2. = 2PO43- 3H2O б) O2 и 2H+ =;

в) P2O5 и 6OH=;

г) P2O3 и 6OH =.

Решить задачи (3 балла за каждую задачу).

19. Масса 70%-й фосфорной кислоты, полученной из фосфора массой 124 кг, равна …кг.

20. Масса хлорида аммония, полученного при взаимодействии аммиака массой 17 т с раствором, содержащим 73 т хлороводорода, равна . . т.

Ответы

Вариант 1

1 2 3 4 5 6 7 8 9 10

2 балла

3 2 3 3 1 3 2 3 5247163 1а 2в
11

2 балла

12 13 14 15

2 балла

16

3 балла

17

2 балла

18

2 балла

19

3 балла

20

3 балла

1в 2бг 1 4 1 1б 2в 29,9 кг 1аг 2бв 1б 2г 157 кг 53,5

Вариант 2

1 2 3 4 5 6 7 8 9 10

2 балла

1 4 2 4 1 3 2 1 41836257 1б 2а
11

2 балла

12 13 14 15

2 балла

16

3 балла

17

2 балла

18

2 балла

19

3 балла

20

3 балла

1бг 2а 3 1бв 2г 3а 3 1в 2б 113,4 кг 3 1а 2в 274 кг 53,5

Максимальное количество баллов – 31

«5» более 26 баллов

«4» 21 – 25 баллов

«3» 13 – 20 баллов

Л. К. Исаева, ФГБОУ кадетская школа «Вторая Донская Императора Николая II кадетская школа», г. Ростов-на-Дону

Метки: Химия

Разработка урока химии «Подгруппа азота»; 9 класс — К уроку — Химия

Обобщающий урок по теме:

«Подгруппа азота»

(нестандартный тип урока – химический обед)

9 класс

Составитель:

учитель химии

МБОУ СОШ № 10

МО Темрюкский район

Краснодарского края

Холодкова Валентина Александровна

Повторение по теме « Подгруппа азота»

Цель урока: повторить и закрепить знания, умения и навыки, полученные при изучении темы «Подгруппа азота». Уметь писать уравнения, решать задачи по данной теме. (Урок проводится в нетрадиционной форме – «ХИМИЧЕСКИЙ ОБЕД». )

ХОД УРОКА.

  1. Вступительное слово учителя.

Урок мы начнем с того, что вспомним технику безопасности при работе в хим. кабинете. Одним из пунктов там записано, что нельзя принимать пищу в химическом кабинете и из химической посуды. А на сегодняшнем уроке мы это правило нарушим и устроим себе «ХИМИЧЕСКИЙ ОБЕД».

На этот урок я вам предлагаю МЕНЮ из следующих блюд:

  1. На первое у нас будет азот, а съесть его надо полностью, но чтобы первое блюдо лучше усвоилось, мы дадим характеристику жителям данной подгруппы

  2. Вторым блюдом у нас будут самые интересные свойства азота, фосфора и их соединений.

  3. А на третье у нас – десерт с изюминками, будем доставать и съедать изюм с удовольствием.

И если в течении урока мы все это съедим, то выполним то, что написано в нашем лозунге: «Усваивается хорошо то, что принимается с аппетитом».

Приступим к первому блюду

  1. Дать общую характеристику элементам подгруппы азота по положению их в периодической

системе химических элементов Д. И. Менделеева. Строение их атомов.

(Ответ учащихся)

Главная подгруппа V группы периодической системы химических элементов Д.И. Менделеева включает 5 элементов: N, P, As, Sb, Bi. Каждый из этих элементов на внешнем энергетическом уровне имеет 5 электронов (конфигурация S2 P3)

С увеличением порядкового номера свойства простых веществ образованных атомами элементов этой подгруппы закономерно изменяются: — увеличивается плотность,

— усиливается окраска,

— уменьшается электроотрицательность.

Особенно большое значение из них имеют АЗОТ и ФОСФОР

7N )2 )5 1S2 2S2 2P3 степени окисления: -3, +1, +2, +3, +4, +5.

Примеры: NH3 N2O NO N2O3 NO2 N2O5

N2O- веселящий газ, имеет сладковатый запах, без цвета,

Обладает анестезирующим свойством

NO — N2 +O2 = 2NO (в природе)

N2O3 – соответствует азотистая кислота НNO2

NO2 -бурый газ с резким удушливым запахом, токсичен.

N2O5 – бесцветное, твердое, летучее вещество, неустойчиво

2 N2O5 = 4NO2 + O2

15Р )2 )8 )5 1S2 2S2 2P6 3S2 3P3 3d0

степень окисления: -3, +3, +5

в возбужденном состоянии 3S1 3P3 3d1 Примеры: PH3 ;Ca3P2P2O3P2O5

Тесты на экране (или печатные таблицы на доске)

1) N2O — P2O3 — As2O3 — Sb2O3 — Bi2O3

С ростом порядкового номера элемента кислотные свойства оксидов в ряду…

а) усиливаются

б) ослабевают

в) остаются неизменными

2) Азот в природе встречается преимущественно в виде соединения:

а) Mg3 N2 в) NH3

б) KNO3 г) KNO2

(Отвечает учащийся у доски с использованием таблиц)

3) Электронная конфигурация атома азота представлена следующим образом :

а) N б) N в) N г) N

4) Отрицательная степень окисления азота проявляется в соединении:

а) N2O б) NO в) NO2 г) Na3N

ответы:

С первым блюдом мы справились.

Переходим ко второму блюду.

Перейдем к наиболее интересным свойствам азота, фосфора и их соединений.

Молекула АЗОТА очень устойчива (3 ковалентных связи) , следовательно обладает низкой реакционной способность.

? что происходит с АЗОТОМ во время грозы?

(ответ учащихся у доски):

В воздухе 78% азота и 21% кислорода. При грозе высокая to— электрической дуги 30000 С.

N2 – восстановитель N2 + O2 = 2 NO – Q О2 — О3 — озоновый слой

NO – NO2 – HNO3 — нитраты ( в почве)

500 p k

N2окислитель N2 + 3 H2 ==== 2 NH3

с активными металлами а) при комнатной температуре только с Li

6Li + N2 = 2Li3N-3

(нитрид лития)

б) при нагревании:

3Ca + N2 = Ca3N2

(нитрид кальция)

Ой, а знаете ли вы, что пшеница при среднем урожае из почвы берёт в год — 72 кг АЗОТА и 30 кг ФОСФОРА. Что, плохо стало, закружилась голова?

Приведем Вас в чувства, получим АММИАК.

(ученик получает аммиак)

(В 1 v воды растворяется 700v аммиака!!!)

Получение аммиака. 1.Нагреть смесь хлорида аммония и гидроксида кальция.2.Определить выделение газа по влажной фенолфталеиновой бумажке. 3.Правильно нюхать выделяющийся газ.

При растворении в воде аммиак реагирует с ней. Образуя гидраты аммиака и в небольшой концентрацииионы аммония и гидроксид-ионы ОН¯:

NH3+H2O↔ NH3 ∙H2O↔ NH3 +H+— OH¯ ↔NH4++OH¯

Поэтому аммиак обладает свойствами слабого растворимого основания. Его раствор в воде имеет щелочную среду (рН˃7).

Тест ( на знание способа собирания аммиака.)

На доске вывешены таблицы с тестами-рисунками, учащиеся находят верный рисунок и объясняют свой выбор. (1 моль возд =29; 1 моль аммиака =17)

О чем стихами Вам расскажу. (учащиеся слушают стихотворение и дают ответ)

Чтоб растения росли,

Вещества изобрели.

Хорошо бы нам такие,

Чтобы выросли большие.

В этом нет теперь сомненья,

Воздух стал теперь не тот.

Стал он пищей для растений,

??? что он нам теперь даёт?

(удобрения даёт)

Работа по вариантам для учащихся всего класса

Получено письмо от молодого фермера, где он просит помочь в выборе удобрений более богатых АЗОТОМ И ФОСФОРОМ.

1- вариант 2 — вариант

Какое из удобрений богаче АЗОТОМ

какое из удобрений богаче ФОСФОРОМ

А) KNO3 Б) NH4NO3 В) NaNO3

А) Ca3(PO4)2 Б) Ca(H2PO4)2

Сделав в тетради расчеты, учащиеся помогают фермеру в выборе удобрений.

Перейдем к десерту ( кто не любит вкусненькое?)

ЗАЙМЁМСЯ ФИЗКУЛЬТУРОЙ, КТО ШУСТРЕЕ И БЫСТРЕЕ

Осуществить превращения, 1 вариант против 2 варианта по очереди выбегают и пишут уравнения.

(у горы 2 склона кто быстрее выполнит свою цепочку превращений, та команда устанавливает флаг на вершине горы как победитель)

1 вариант

P Mg3 P2  PH3 P2O5  H3PO4  Ca3(PO4)2

2 вариант

N2 NH3 NO NO2 HNO3  NH4NO3

1) 2P +3Mg t= Mg3P2 1) N2 + 3H2 =2NH3

2) Mg3P2 + 6H2O =3Mg(OH)2+ 2PH3 2) 4NH3 +5O2 k= 4NO +6H2O

3)2PH3 + 4O2 = P2O5 + 3 H2O 3) 2NO + O2 = 2NO2

4) P2O5 + 3H2O = 2 H3PO4 4) 4NO2 + 2H2O + O2 = 4HNO3

5) 2H3PO4 + 3Ca(OH)2 = Ca3(PO4)2 +6H2O 5) HNO3 + NH3 = NH4NO3

Задача – шарада.

  1. Соль имеет состав NH5SO4 2)Карбонат аммония получают смешиванием

Как следует изменить формулу, 3-х веществ каких именно?

Чтобы было видно, о какой соли Составить уравнение.

Идет речь, назвать её. Ответ: 2NH3 + CO2 + H2O =(NH4)2CO3

Ответ:(NH4HSO4 –гидросульфат аммония.)

Любителям опытов.

Экспериментально доказать, что выдано вещество: ( NH4)2SO4

(учащиеся выполняют практически)

на ион NH4+ + NaOH = NH3(газ)

на ион SO42- + BaCI2 = BaSO4 ( белый осадок)

Какой любитель химии не любит решать задачи.

Задача. 10,5 г хлорида аммония смешали с 6 г гидроксида кальция, смесь нагрели. Какой газ и сколько его по массе и объёму выделится.

(учащиеся решают задачу, проверяем у доски. Ответ: 2,76 г; 363 л аммиака)

Рефлексия.

Выводы по уроку, оценки.

.

Урок-семинар в 9-м классе по теме «Подгруппа азота»

Девиз урока: « Мало знать, надо и применять. Мало хотеть, надо и делать» (Гёте)

Цели урока:

Образовательные.

  1. В занимательной форме обобщить, закрепить, систематизировать и проверить степень усвоения знаний о свойствах азота, фосфора и их соединений;
  2. Умение в составлении ионных уравнений, окислительно-восстановительных реакций;
  3. Навыки в решении расчётных и экспериментальных задач.

Развивающие.

  1. Развивать умение рационально планировать свою деятельность, работать в группах и индивидуально.
  2. Продолжить формирование умений применять приёмы систематизации, обобщения.

Воспитательные.

  1. Воспитывать у учащихся интерес к учению, стремление добиваться успехов в учёбе.
  2. Формировать умение, с одной стороны, самостоятельно принимать решение, а с другой – чувство взаимопомощи и сотрудничества.

Тип урока: урок-семинар контроля и коррекции знаний, умений и навыков.

Форма проведения: урок-игра. Класс делится на 4 команды. Для оценки команды готовятся жетоны учёта – «таланты». У каждой команды сигнальный флажок для ответа.

Оборудование и реактивы:

  1. на столах учащихся — таблицы элементов Д. И. Менделеева, растворимости солей, кислот и оснований в воде, карточки с заданиями, тесты с дифференцированными заданиями, учебник, справочная литература;
  2. наборы химических реактивов: растворы Na2SO4, NaCl, NH4Cl, Na3PO4, AgNO3, BaCl2, спиртовка, спички, фенолфталеиновая бумага, стаканчик с водой, пробирки.

Ход урока-семинара.

Ребята, мы закончили изучение темы: «Подгруппа азота». И вы в очередной раз убедились, что химия элементов – самое увлекательное при изучении неорганической химии. Цель нашего урока-семинара – обобщить и проконтролировать ваши знания по теме. Но самое интересное сегодня — командная игра. Итак, сегодня соревнуются четыре команды.

Попрошу капитанов команд путём жеребьёвки определить название команды:

  • команда «Азот»;
  • команда «Аммиак»;
  • команда «Азотная кислота»;
  • команда «Фосфор».

1 конкурс – «Презентация команд». За три минуты вам необходимо придумать девиз и сделать сообщение о веществе, которым названа ваша команда, рассказать об интересных моментах его открытия и физических свойствах. Правильность ответов я буду оценивать с помощью «талантов»– желтеньких фишек. За один балл – один «талант». Какая команда в конце урока заработает больше талантов – та и победит.

Оценка конкурса

1 балл за сообщение;

1 балл за девиз. (10 мин.)

Азот – бесцветный газ без запаха и вкуса. В воде растворяется хуже кислорода. Является основным компонентом воздуха (содержание азота в воздухе составляет 78%). В 1756 г. англичанин Даниэль Резерфорд установил, что воздух, оставшийся под колоколом, где жила несколько дней мышь, освобожденный от углекислого газа, не поддерживает горение и дыхания. Этот газ он назвал « ядовитым воздухом». В 1773 г. Карл Щееле. Шведский аптекарь установил, что воздух состоит из двух газов. Газ, не поддерживающий горение и дыхание, он назвал «испорченным воздухом». В 1776 г. известный французский учёный Антуан Лавуазье, подробно исследуя «ядовитый» и «дурной» воздухи, установил, что это одно и то же вещество, и предложил назвать его азотом, что в переводе с греческого означает безжизненный.

Фосфор – в поисках эликсира молодости и попытках получения золота немецкий алхимик Геннинг Бранд в 1669 г. получил вещество, обладающее необычными свойствами: оно светилось в темноте, а брошенное в кипящую воду, выделяло пары, загоравшиеся на воздухе с выделением густого дыма, который растворялся в воде с образованием кислоты. Химический элемент фосфор образует несколько аллотропных модификаций. Например:

белый фосфор — имеет молекулярную решётку, состоящую из молекул Р.;. Он обладает типичным запахом, очень ядовит, самовоспламеняется на воздухе, нерастворим в воде, хранят под водой, растворим в сероуглероде. При окислении на воздухе светится в темноте, так как происходит непосредственное превращение химической энергии в световую;

красный – представляет собой порошок темно-малинового цвета, не ядовит, не воспламеняется на воздухе, не светится в темноте. При нагревании свыше 240С0 воспламеняется.

Аммиак – бесцветный газ с резким запахом, почти в два раза легче воздуха. Аммиак нельзя вдыхать продолжительное время, так как он ядовит. Он легко сжижается при температуре – 34 градуса. А при испарении жидкого аммиака из окружающей среды поглощается много теплоты, поэтому аммиак используют в холодильных установках. Аммиак хорошо растворим в воде: при 200С в одном объёме её растворяется около 700 объёмов аммиака. Аммиак собирают методом вытеснения воздуха в перевёрнутый вверх дном сосуд.

Азотная кислота. «Возьми фунт кипрского купороса, полтора фунта селитры и четверть фунта квасцов, подвергни всё перегонке, и ты получишь жидкость, которая обладает высоким растворяющим действием». Так описан первый способ получения азотной кислоты в книге арабского алхимика Джибара. Могущество этой жидкости так велико, что, будучи смешанной с соляной кислотой, она расправляется с царём металлов – золотом. Азотная кислота – жидкость, бесцветная, с едким запахом, хорошо растворяется в воде, смешиваясь с ней в любых соотношениях. На свету и при нагревании желтеет вследствие окисления и образования бурого газа.

Объявляю следующий конкурс:

2 конкурс – «Ты — мне, я — тебе». Каждая из команд задаёт по 2 -3 заранее подготовленных вопроса для команд-соперников. Команда, ответившая первой, за правильный ответ получает 1 балл.

  1. Почему Даниэль Резерфорд назвал открытый им газ «зловредным», а Антуан Лавуазье дал ему общее название — азот, т.е. «безжизненный»?
  2. Чем обусловлена химическая инертность азота?
  3. В какое соединение превращается азот в верхних слоях атмосферы во время грозовых разрядов?
  4. Как получают азот в промышленности?
  5. Почему азот называют «элементом жизни»?
  6. Что такое «нашатырный спирт»? Для чего его используют?
  7. Какие свойства аммиака лежат в основе его применения в холодильных установках?
  8. Каким способом следует собирать аммиак? Почему?
  9. Как можно распознать аммиак?
  10. Что такое нашатырь? Для чего его используют?
  11. Какое применение находит карбонат и гидрокарбонат аммония?
  12. Какие вещества называют селитрами?
  13. Какой газ называют «бурым»?
  14. Что такое «ляпис»?
  15. Что такое «царская водка»?
  16. Какая из модификаций фосфора светится в темноте?
  17. На каком свойстве основано применение оксида фосфора (V) в химической промышленности в качестве осушителя?

(7 мин. )

3 конкурс – «Теоретический».

Во время этого конкурса мы повторим химические свойства азота и фосфора, важнейших соединений азота. Капитанов прошу выбрать конверты с вопросами для своих команд:

— составить уравнения реакций, характеризующие химические свойства азота и фосфора;
— описать кислотно-основные и окислительно-восстановительные свойства аммиака;
— описать химические свойства азотной кислоты;
— написать уравнения реакций, отражающие химические свойства солей аммония и нитратов.

По одному представителю от команды у доски отвечают на вопросы. Остальным членам команд предлагаю разгадать кроссворд. Команда, первая отгадавшая кроссворд оформляет ответы на слайде и проецирует на экран. (3 балл).

Вопросы:

  1. Учёный, открывший фосфор. (Бранд)
  2. Какой элемент академик А. Е. Ферсман назвал «элементом жизни и мысли»? (Фосфор)
  3. Как называют нитраты щелочных и щелочноземельных металлов? (Селитры)
  4. Какой фосфор светится в темноте? (Белый)
  5. Газ, образующийся при разложении солей аммония. (Аммиак)
  6. Второе название хлорида аммония. (Нашатырь)
  7. Общее называние веществ, используемых в качестве подкормки для растений? (Удобрения)
  8. Газ, составная часть воздуха. (Азот)

Затем проверяются ответы у доски. Возможные ошибки при ответе исправляются членами команды или командой соперника (1 балл). Отвечающий получает индивидуальный балл: «5», «4», «3». Команда соответственно получает такое же количество баллов (5, 4, 3).

(20 мин.)

4 конкурс – «Реши задачу». По одному представителю от каждой команды выбирают конверт с условием задачи и решают её у доски. Правильно решённая задача оценивается в 5 баллов, за каждую ошибку снижается по 1 баллу.

Пока представители команд решают задачи, проводится конкурс для капитанов.

Конкурс капитанов: «Лови ошибку».

Игровая цель: кто из капитанов быстрее и больше заметит ошибок, допущенных в прочитанном учителем тексте: «…Азот образует несколько соединений с водородом, из них наибольшее значение имеет аммиак. Это бесцветный газ, без запаха, почти в два раза тяжелее воздуха, хорошо растворимый в воде. Водный раствор аммиака называется нашатырём. В химическом отношении аммиак довольно активен, он вступает во взаимодействие со многими веществами, проявляя при этом как окислительные, так и восстановительные свойства. Водный раствор аммиака в воде проявляет кислотные свойства и не изменяет окраску фенолфталеина. При взаимодействии аммиака с кислотами образуются соли аммония. Это твёрдые кристаллические вещества, плохо растворимые в воде. При нагревании они разлагаются с образованием кислорода. Соли аммония находят широкое применение в народном хозяйстве, большая часть из них используется для получения азотной кислоты»

Конкурс капитанов оценивается по 1 баллу за «пойманную» ошибку.

Затем проверяются решения задач у доски. (10 мин.)

5 конкурс – «Экспериментальный». Команды получают экспериментальное задание:

две команды должны доказать опытным путём, что в состав сульфата аммония входят ионы аммония NH4+ и сульфат-ионы SO42-;

двум другим командам предлагается распознать среди выданных веществ: фосфат натрия, сульфат натрия, хлорид натрия.

Реактивы: р-ры Na2SO4, NaCl, NH4Cl, Na3PO4, AgNO3, BaCl2, спиртовка, спички, фенолфталеиновая бумага, стаканчик с водой.

Команды, которые первые справились с заданием, сообщают результаты опытов, записывают на доске уравнения реакций, получают по пять баллов. (10 мин.)

6 конкурс – «Эстафета» — завершает испытания команд.

Командам предлагается для эстафеты выбрать цепочку превращений и приступить к её решению у доски. Члены команды могут исправлять ошибки у своих участников команды. Во время проверки за исправление ошибок у соперников команды получают дополнительный балл. Количество баллов определяется количеством правильно составленных уравнений.

В заключительной части урока проводится индивидуальная письменная работа (Приложение 1) или тестовая работа по вариантам (Приложение 2).

Подведение итогов, награждение команды-победителя.

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка браузера на прием файлов cookie

Существует множество причин, по которым файл cookie не может быть установлен правильно. Ниже приведены наиболее распространенные причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки браузера, чтобы принять файлы cookie, или спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файл cookie.
  • Ваш браузер не поддерживает файлы cookie. Попробуйте другой браузер, если вы подозреваете это.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы это исправить, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Предоставить доступ без файлов cookie потребует от сайта создания нового сеанса для каждой посещаемой вами страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в файле cookie; никакая другая информация не фиксируется.

Как правило, в файле cookie может храниться только та информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, если вы не решите ввести его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступ к остальной части вашего компьютера, и только сайт, создавший файл cookie, может его прочитать.

Круговорот азота и структура сообщества протеобактерий β-подгруппы, окисляющих аммиак, в отложениях загрязненных морских рыбоводных хозяйств осадки рыбоводческого хозяйства»,

аннотация = «Мультидисциплинарный подход был использован для изучения влияния загрязнения от морского рыбоводческого хозяйства на скорость нитрификации и на структуру сообщества аммиакокисляющих бактерий в нижележащих отложениях.Содержание органических веществ, концентрации аммония, скорость нитрификации и наиболее вероятное количество окислителя аммиака определяли в пробах донных отложений, отобранных из-под садка для рыбы и на разрезе в 20 и 40 м от садка. Данные свидетельствуют о том, что круговорот азота был значительно нарушен непосредственно под садком с ингибированием нитрификации и денитрификации. Хотя визуальный осмотр показал некоторые незначительные изменения во внешнем виде отложений на глубине 20 м, все остальные измерения были аналогичны измерениям, полученным на глубине 40 м, где отложения считались нетронутыми.Структуры сообщества протеобактериальных аммиакокисляющих бактерий β-подгруппы в местах отбора образцов сравнивали с помощью ПЦР-амплификации 16S рибосомной ДНК (рДНК) с использованием праймеров, нацеленных на эту группу. Продукты ПЦР анализировали с помощью денатурирующего градиентного гель-электрофореза (DGGE) и с использованием зондов гибридизации олигонуклеотидов, специфичных для различных окислителей аммиака. Дублет DGGE, наблюдаемый в продуктах ПЦР из сильно загрязненной пробы донных отложений из садков, присутствовал с меньшей интенсивностью в 20-метровой пробе, но отсутствовал в нетронутой 40-метровой пробоотборной станции.Миграция полос, гибридизация и секвенирование показали, что дублет соответствует морской группе Nitrosomonas, которая первоначально наблюдалась в библиотеках клонов 16S рДНК, приготовленных из тех же образцов донных отложений, но с другими праймерами для ПЦР. Наши данные свидетельствуют о том, что эта новая подгруппа Nitrosomonas была выбрана для использования в загрязненных отложениях рыбоводческих ферм, и что на относительную численность этой группы влияла степень загрязнения». Кэрол Дж.} и Стивен, {Джон Р.} и Ковальчук, {Джордж А.} и {Мартин Харви}, С. и Герберт, {Родни А.} и {Мартин Эмбли}, Т. и Проссер, {Джеймс И.}» ,

год = «1999»,

месяц = ​​январь,

день = «1»,

язык = «английский»,

объем = «65»,

страницы = «213—220»,

журнал = «Прикладная и экологическая микробиология»,

issn = «0099-2240»,

издатель = «Американское общество микробиологии»,

номер = «1»,

}

Кратковременное воздействие твердые частицы (PM10 и PM2.5), диоксид азота (NO2) и озон (O3), а также смертность от всех и конкретных причин: систематический обзор и метаанализ | Интернет-исследования в области здравоохранения и окружающей среды (HERO)

ПРЕДПОСЫЛКИ: Загрязнение воздуха является основной причиной смертности и заболеваемости во всем мире. Кратковременное воздействие (от одного часа до нескольких дней) отдельных загрязнителей воздуха связано со смертностью человека. Этот систематический обзор был проведен для анализа данных о последствиях кратковременного воздействия твердых частиц с аэродинамическими диаметрами меньше или равными 10 и 2.5 мкм (PM10, PM2,5), диоксид азота (NO2) и озон (O3) на смертность от всех причин, а PM10 и PM2,5 на смертность от сердечно-сосудистых, респираторных и цереброваскулярных заболеваний.

МЕТОДЫ: Мы включили исследования населения, подвергающегося воздействию загрязнения атмосферного воздуха из любого источника, за исключением профессионального воздействия. В качестве оценки эффекта использовались относительные риски (ОР) на 10 мкг/м3 увеличения концентрации загрязняющих веществ в воздухе. Неоднородность между исследованиями оценивалась с использованием 80% интервалов прогнозирования.Риск систематической ошибки (RoB) в отдельных исследованиях был проанализирован с использованием нового инструмента оценки на основе предметной области, разработанного рабочей группой, созванной Всемирной организацией здравоохранения, и предназначенного специально для оценки RoB в рамках подходящих исследований загрязнения воздуха, включенных в систематические обзоры. Мы провели анализ подгрупп и чувствительности по возрасту, полу, континенту, дизайну исследования, исследованиям в одном или нескольких городах, временному лагу и RoB. Достоверность доказательств оценивалась для каждой комбинации воздействие-результат. Протокол для этого обзора был зарегистрирован в PROSPERO (CRD42018087749).

РЕЗУЛЬТАТЫ: Мы включили 196 статей в количественный анализ. Все комбинации загрязняющих веществ и смертность от всех и конкретных причин были положительно связаны в основном анализе и в широком диапазоне анализов чувствительности. Единственным исключением был NO2, но при учете максимального воздействия в течение 1 часа. Мы обнаружили положительную связь между загрязняющими веществами и смертностью от всех причин для PM10 (ОР: 1,0041; 95% ДИ: 1,0034–1,0049), PM2,5 (ОР: 1,0065; 95% ДИ: 1,0044–1,0086), NO2 (среднее за 24 часа). ) (РР: 1.0072; 95% ДИ: 1,0059–1,0085) и O3 (RR: 1,0043; 95% ДИ: 1,0034–1,0052). PM10 и PM2,5 также были положительно связаны со смертностью от сердечно-сосудистых, респираторных и цереброваскулярных заболеваний. Мы обнаружили некоторую степень неоднородности между исследованиями в трех комбинациях воздействие-результат, и эту неоднородность нельзя было объяснить после анализа подгрупп. RoB был низким или умеренным в большинстве статей. Достоверность доказательств была оценена как высокая в 10 из 11 комбинаций и как умеренная в одной комбинации.

ВЫВОДЫ: В этом исследовании были обнаружены доказательства положительной связи между кратковременным воздействием PM10, PM2,5, NO2 и O3 и смертностью от всех причин, а также между PM10 и PM2,5 и сердечно-сосудистой, респираторной и цереброваскулярной смертностью. . Эти результаты были надежными благодаря нескольким анализам чувствительности. В целом уровень доказательности был высоким, а это означает, что мы можем быть уверены в ассоциациях, обнаруженных в этом исследовании.

Реакция кукурузы на азот зависит от состава почвы и погодных условий

Трембле, Николя; Буруби, Ясин М.; Белек, Карл; Маллен, Роберт Уильям; Кухня, Ньюэлл Р. ; Томасон, Уэйд Э.; Эбельхар, Стив; Менгель, Дэвид Б.; Раун, Уильям Р.; Фрэнсис, Деннис Д.; Вориес, Эрл Д.; Ортис-Монастерио, Иван

Известно, что свойства почвы и погодные условия влияют на доступность почвенного азота (N) и его поглощение растениями. Однако исследования, изучающие реакцию на азот в зависимости от почвы и погоды, иногда дают противоречивые результаты. Метаанализ — это статистический метод оценки эффектов лечения в серии экспериментов для объяснения источников неоднородности.В этом исследовании этот метод использовался для изучения влияния параметров почвы и погоды на реакцию кукурузы (Zea mays L.) на азот в рамках 51 исследования, включающего те же самые нормы внесения азота, которые проводились в различных регионах Северной Америки в период с 2006 г. и 2009. Результаты показали, что реакция кукурузы на добавление азота была значительно выше в почвах с мелкой текстурой, чем в почвах со средней текстурой. Обильные и хорошо распределенные осадки и, в меньшей степени, аккумулированные тепловые единицы кукурузы усиливали отклик на азот. Урожайность кукурузы увеличилась в 1,6 раза (по сравнению с неудобренным контролем) на почвах среднего гранулометрического состава и в 2,7 раза на почвах мелкого гранулометрического состава при высоких дозах азота. Анализы подгрупп проводились на классе мелкозернистых почв на основе погодных параметров. Характер осадков оказал важное влияние на реакцию азота в этом классе состава почвы, при этом урожайность увеличилась в 4,5 раза за счет внесения азотных удобрений в сезон в условиях «обильных и хорошо распределенных осадков». Эти результаты могут быть полезны для разработки алгоритмов внесения азотных удобрений, которые позволили бы вносить азот с оптимальными дозами, принимая во внимание режим выпадения осадков и структуру почвы, что привело бы к повышению прибыльности сельскохозяйственных культур и снижению воздействия на окружающую среду.

Описание:

Образец цитирования: Тремблей, Николя, Ясин М. Буруби, Карл Белек, Роберт Уильям Маллен, Ньюэлл Р. Китчен, Уэйд Э. Томасон, Стив Эбельхар и др. «Реакция кукурузы на азот зависит от структуры почвы и погоды». Агрономический журнал 104, вып. 6 (2012): 1658–71. https://doi.org/10.2134/agronj2012.0184.

Ключевые слова: почва; Погода; почвенный азот; Метаанализ

Журнал: Агрономический журнал, том: 104, выпуск: 6, стартовая страница: 1658, Конечная страница: 1671

Дата: 2012

Права: Разрешение на архивирование предоставлено Американским обществом агрономов, 27 июня 2013 г.Это статья в открытом доступе в соответствии с условиями лицензии Creative Commons Attribution-NonCommercial-NoDerivs, которая разрешает использование и распространение на любом носителе, при условии, что оригинальная работа правильно процитирована, использование является некоммерческим и не вносятся модификации или адаптации. .

Показать полную запись товара

Фактор GATA делящихся дрожжей, Gaf1, модулирует половое развитие посредством прямого подавления экспрессии ste11+ в ответ на азотное голодание

Abstract

Gaf1 является первым фактором транскрипции цинковых пальцев семейства GATA, идентифицированным в Schizosaccharomyces pombe . Здесь мы сообщаем, что Gaf1 функционирует как негативно действующий фактор транскрипции ste11 + , задерживая вступление клеток, подвергшихся временному азотному голоданию, в мейотический цикл. Штаммы gaf1Δ проявляли ускоренную G 1 -остановку при азотном голодании. Более того, мутация gaf1Δ вызывала повышенную частоту спаривания и спорообразования как в условиях голодания азота, так и в условиях его отсутствия, в то время как сверхэкспрессия gaf1 + приводила к значительному нарушению спорообразования.С помощью микрочипового анализа мы обнаружили, что примерно 63% (116 генов) из 183 генов, активация которых в не голодавших клетках gaf1Δ была активирована, были генами, реагирующими на азотное голодание, и, кроме того, что 25 генов среди генов активировались gaf1 Δ Мутация — это цели Ste11 (, например, , GPA1 + , STE4 + , SPK1 + , Ste11 + и Mei2 + ). Фенотип, вызванный мутацией GAF1Δ , был замаскирован мутацией STE11Δ , указывая на то, что Ste11 + + является Epistatic до GAF1 + по отношению к эффективности споруляции, а соответственно, что GAF1 + функции вверх по течению ste11 + в сигнальном пути, регулирующем половое развитие.Штаммы gaf1Δ проявляли ускоренную экспрессию ste11 + в условиях азотного голодания и увеличивали экспрессию ste11 + даже в нормальных условиях. Анализ сдвига электрофоретической подвижности показал, что Gaf1 специфически связывается с каноническим мотивом GATA (5′-HGATAR-3′), охватывающим диапазон от -371 до -366 в промоторе ste11 + . Следовательно, Gaf1 обеспечивает первичный пример негативной регуляции транскрипции ste11 + посредством прямого связывания с цис -действующим мотивом его промотора.

Образец цитирования: Kim L, Hoe KL, Yu YM, Yeon JH, Maeng PJ (2012) Фактор GATA делящихся дрожжей, Gaf1, модулирует половое развитие посредством прямого подавления экспрессии ste11 + в ответ на азот Голод. ПЛОС ОДИН 7(8): е42409. https://doi.org/10.1371/journal.pone.0042409

Редактор: Yong-Sun Bahn, Университет Йонсей, Корея, Республика

Поступила в редакцию: 3 мая 2012 г.; Принято: 4 июля 2012 г.; Опубликовано: 10 августа 2012 г.

Авторское право: © Kim et al.Это статья с открытым доступом, распространяемая в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания оригинального автора и источника.

Финансирование: Эта работа была поддержана грантом Национального исследовательского фонда Кореи (NRF), финансируемым Министерством образования, науки и технологий (MEST) (№ 313-2008-2-C00778). Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Делящиеся дрожжи Schizosaccharomyces pombe размножаются бесполым путем путем митоза при благоприятных условиях. Когда гаплоидным клеткам не хватает питательных веществ, особенно азота, они останавливают клеточный цикл в точке G 1 и подвергаются половой дифференциации [1]. Клетки противоположных типов спаривания, h + и h , сливаются, образуя диплоидную зиготу, которая подвергается мейозу с образованием четырех гаплоидных аскоспор, которые остаются в состоянии покоя, пока не встретятся с благоприятными условиями роста [2].Переход от митотического клеточного цикла к мейозу жестко регулируется сетью положительных и отрицательных факторов, которые контролируются на различных уровнях экспрессии генов, от инициации транскрипции [3]–[6] до модификации белков [7]–[11]. .

Одним из важных регуляторных компонентов полового развития S. pombe является Ste11. Ste11 положительно регулирует транскрипцию генов типа спаривания, matP и matM, и гена mei2 + , необходимого для коммитирования мейоза, путем связывания с вышестоящим цис -действующим элементом в условиях азотное голодание [12].Мутанты ste11Δ полностью дефектны в спаривании и спороношении, в то время как эктопическая экспрессия ste11 + приводит к половой дифференциации независимо от условий питания. Активность Ste11 регулируется двумя антагонистическими протеинкиназами, Pat1 и Spk1, через сигнальный путь феромона [13] и протеинкиназой TOR, Tor2, которая активируется в присутствии азота и подавляет половую дифференцировку, непосредственно вмешиваясь в функция Ste11 и Mei2 [11].Экспрессия ste11 + регулируется по крайней мере тремя различными путями передачи сигнала: передачей сигналов феромонов спаривания (путь RAS/MAPK), циклической АМФ (цАМФ)-зависимой протеинкиназой А (PKA) и стресс-активируемой протеинкиназой (PKA). SAPK) в сочетании с MAPKKK (Wis4 и Win1), MAPKK (Wis1) и MAPK (Sty1/Spc1/Phh2) [14], [15]. До сих пор были изучены только положительные регуляторные факторы экспрессии ste11 + , такие как Atf1 [6], [16], Pcr1 [5], Rst2 [4], Prr1 [17] и сам Ste11 [4]. сообщил.Кроме того, только Rst2 и Ste11 являются факторами транскрипции, которые непосредственно активируют экспрессию ste11 + . Фактор транскрипции, непосредственно подавляющий экспрессию ste11 + , не идентифицирован.

Здесь мы исследуем роль Gaf1, первого транскрипционного фактора GATA, идентифицированного в S. pombe [18], [19], в экспрессии ste11 + . Факторы транскрипции семейства GATA имеют широкий спектр функций, от терминальной дифференцировки у позвоночных [20]–[22] до метаболизма азота, биосинтеза сидерофоров, фотоиндукции и переключения типа спаривания у грибов [23].В S. pombe Ams2 представляет собой фактор GATA, регулируемый клеточным циклом, который необходим для функции центромеры [24], а Fep1/Gaf2 играет центральную роль в гомеостазе железа, координируя редуктивную и нередуктивную системы транспорта железа [25]. , [26]. Факторы GATA распознают консенсусную последовательность из шести пар оснований, 5′-HGATAR-3′ (где H может быть A/C/T, а R может быть A/G), содержащуюся в промоторах их генов-мишеней. Хотя было показано, что С-концевой фрагмент Gaf1 (Gaf1 565–855 ) специфически связывается с мотивом GATA DAL7 UAS, каноническим мотивом GATA Saccharomyces cerevisiae [18], мало что известно о функции Gaf1 в ю.ш.помбе . Мы представляем доказательства того, что Gaf1 подавляет транскрипцию ste11 + посредством прямого связывания со своим промотором и, следовательно, задерживает переход голодающих по азоту клеток от вегетативного цикла к мейотическому циклу.

Материалы и методы

Штаммы S. pombe , среды и общие процедуры Штаммы

S. pombe , использованные в этом исследовании, перечислены в таблице 1. Клетки поддерживали на полной среде (ДА), содержащей 0.5% дрожжевой экстракт, 3% глюкоза, 2% бактоагар, аденин (225 мкг мл -1 ), лейцин (225 мкг мл -1 ) и урацил (225 мкг мл -1 ). В качестве минимальной селективной среды использовали Эдинбургскую минимальную среду (EMM2) [27]–[29]. EMM-N (EMM2 без NH 4 Cl) использовали для голодания источника азота, а EMM-G (EMM2, содержащий 0,5% вместо 2% глюкозы) для экспериментов по ограничению глюкозы. Все минимальные среды были дополнены необходимыми ауксотрофными питательными веществами (аденином, лейцином и урацилом) в концентрациях по 225 мкг мл 90 109 -1 90 110 каждого, что привело к наличию в ЭММ-Н дефицита источника органического азота.К среде добавляли тиамин в конечной концентрации 20 мкМ для подавления экспрессии с промотора, репрессируемого тиамином nmt42 + (нет сообщения в тиамине). Трансформацию проводили по методике с ацетатом лития [27]. Для генетических манипуляций и анализа использовались стандартные методы [29].

Конструирование плазмид

Чтобы сконструировать pREP-Gaf1 с полноразмерной открытой рамкой считывания (ORF) gaf1 + ниже промотора nmt42 + , a 2. Фрагмент длиной 6 т.п.н. амплифицировали с помощью полимеразной цепной реакции (ПЦР) со следующими праймерами: P1 (5’AACCCGGGCCATGGATCTAAAGTTTTCC3′) и P2 (5’AACCCGGGCATAACGCTATACCAATC3′), в которых подчеркивание обозначает сайтов Sma I. Полученный продукт ПЦР клонировали в pGEM-T (Promega) с получением pGEM-Gaf1. После подтверждения отсутствия артефакта ПЦР с помощью анализа последовательности, ORF gaf1 + вырезали путем расщепления с помощью Sma I и лигировали с расщепленным Sma I экспрессионным вектором со средней копией pREP42 [30] с получением pREP- Гаф1.Для конструирования pGEX4T3-Gaf1, кодирующего Gaf1, меченный глутатион S -трансферазой (GST) (GST-Gaf1), ORF размером 2,6 т.п.н. и клонировали в рамке считывания в сайт Sma I pGEX4T3 (Amersham).

Репортерную плазмиду на основе lacZ , используемую для анализа промотора ste11 + , конструировали следующим образом. Во-первых, точку начала репликации S. pombe , ars1 + амплифицировали из pESP1 (Stratagene) с помощью ПЦР с использованием праймеров P3 (5’CCGAATTCAGGCCTGAGTCTAACTCCTTAACCACT3′; подчеркивание обозначает сайт Stu I) и P4 (5′ CCGATATCCAACCTTCCAATTCATTAAATC3′; подчеркивание обозначает сайт Eco RV).Фрагмент ДНК длиной 1,2 т.п.н. был клонирован в вектор pGEM-T Easy с получением pGEM-ars1. Фрагмент длиной 1,5 т.п.н., содержащий ген kanMX , амплифицировали из pFA6a-kanMX6 [31] с использованием праймеров для ПЦР P5 (5’CCGATATCGGGTTAATTAAGGCGCGCCAGA3′; подчеркивание означает сайт Eco RV) и P6 (5’CCGCATGCCACTGGATGACGGCGTTAGTAT3′; подчеркивание означает 9′; сайт I) и вставляли в вектор pGEM-T с получением pGEM-kanMX6. Фрагмент kanMX размером 1,5 т.п.н. затем вырезали путем двойного расщепления Eco RV- Sph I и субклонировали в расщепленный pGEM-ars1 Eco RV- Sph I.Из полученного вектора pGEM-ars1-kanMX6 фрагмент размером 2,7 т. п.н., содержащий как ars1 , так и kanMX , вырезали с помощью Sph I, фермента Кленова и Stu I. Полученный 2,7 т.п.о. Sph I (затупленный) — фрагмент Stu I затем лигировали с фрагментом плазмиды YEp353 Sna BI- Stu I размером 6,5 т.п.н. с получением pJLC-LacZ. Затем фрагмент Bam HI размером 1,4 т.п.н., содержащий промоторную область ste11 + от -834 до +575 (основной сайт начала транскрипции обозначен как позиция +1 для нумерации нуклеотидов) [4], был ПЦР-амплифицирован. с использованием праймеров Р7 (5’GGATCCGCATGCCATCTCCAGGGAT3′) и Р8 (5’GGATCCCAAAAGAACGTAGAGGCAA3′), в которых подчеркивание обозначает сайтов Bam HI.Репортерная плазмида pJLC-Ste11 (p) -LacZ была сконструирована путем субклонирования фрагмента 1,4 т.п.н. Bam HI, амплифицированного с помощью ПЦР, в сайт Bam HI pJLC-LacZ перед lacZ в правильной ориентации.

Нарушение гена

Конструирование штаммов gaf1Δ осуществляли путем прямой хромосомной интеграции, как описано ранее [28]. Геномные области размером 2,6 т.п.н., соответствующие полной ORF gaf1 + (855 аминокислот) штаммов дикого типа, 972, ED665, JY4 и ED668, несущих разные ауксотрофные маркеры или тип спаривания, были заменены на 1 .ПЦР-амплифицированная кассета делеции gaf1::kanMX размером 5 т.п.н., полученная из pFA6a-kanMX4 [32]. Стабильные трансформанты отбирали по устойчивости к G418, а нарушения подтверждали с помощью ПЦР с соответствующими праймерами (данные не показаны), что давало штаммы gaf1Δ , KL230, KL210, KL211 и KL216 соответственно. Штамм ste11Δ JZ396 [любезно предоставленный доктором Ямамото [12]] трансформировали кассетой делеции gaf1::kanMX с получением мутанта с двойной делецией gaf1Δ ste11Δ (KL213).Для конструирования штамма gaf1Δ , несущего маркер hphMX , аллель gaf1::kanMX штамма KL210 была заменена делеционной кассетой размером 1,6 т. п.н. gaf1::hphMX , амплифицированной из pFA6a-hphMX6 [33]. Стабильные трансформанты отбирали по устойчивости к гигромицину В и чувствительности к G418 (что указывает на потерю kanMX ), и нарушения подтверждали с помощью ПЦР (данные не показаны) с получением штамма KL240.

Тесты роста

Для анализа роста с помощью чашек, S.Клетки pombe , выросшие до средней экспоненциальной фазы в EMM2 в течение 18 ч, промывали и ресуспендировали в EMM2-N (для азотного голодания) или EMM-G (для ограничения глюкозы) до концентрации 5×10 6 клеток мл — 1 . Суспензии клеток серийно разбавляли в 5 раз, а затем аликвоту по 5 мкл каждого разведения наносили на чашки EMM, EMM-N и EMM-G. Планшеты инкубировали при 30°С и фотографировали через 3 дня.

Приготовление тотальной РНК

Для получения тотальной РНК штаммы дикого типа (ED668) и gaf1Δ (KL216) выращивали до средней логарифмической фазы в EMM2 в течение 18 ч при 30°C. Клетки собирали из культур со средней логарифмической фазой и использовали в качестве препаратов клеток без голодания (+N). Для приготовления образцов клеток, лишенных азота (-N), клетки, собранные из культур в средней логарифмической фазе в EMM2, промывали дистиллированной водой и переносили в EMM-N. Клетки, лишенные азота, используемые для анализа микрочипов, собирали после 4-часового культивирования в EMM-N. Для Нозерн-блоттинга аликвоты культуры, лишенной азота, отбирали через интервалы 90×106, т.е. 90×107, через 0, 3, 6, 9 и 18 часов после смены.Клетки дважды промывали дистиллированной водой и сразу же замораживали при -70°С для получения тотальной РНК. Образцы тотальной РНК экстрагировали примерно из 2×10 90 109 8 90 110 клеток с использованием бисерной мешалки, как описано ранее [12].

Микроматричный анализ

Тридцать микрограмм общей РНК каждого образца дополнительно очищали с использованием колонок RNeasy (QIAGEN) и отправляли на микрочиповый анализ в SeouLin Bioscience (Корея). Зонды были созданы и гибридизированы с GeneChip Yeast Genome 2.0 (Affymetrix), и данные анализировали с использованием программного обеспечения GeneSpring GX (Agilent).

Нозерн-блоттинг

Приблизительно 20 мкг общей РНК фракционировали на 1% агарозном геле, содержащем 18% формальдегида, переносили на мембрану Hybond-N + (Amersham) и фиксировали сшивкой УФ-излучением (Stratagene). ДНК-зонды генов ste11 + , gaf1 + и актина ( act1 + ) готовили с использованием ПЦР-фрагментов, амплифицированных со следующими парами праймеров: P12ATCCG’GATT: P11 (5CCAG’GATT) (5’CCAACAGCACTCTTGACGAA3′) для ste11 + ; P13 (5’TTACAACTTGCGTCCAGCA3′) и P14 (5’TGAATTCAGGAGCACCTTCC3′) для gaf1 + ; и Р15 (5’GAAGCACACCATGACGCTTA3′) и Р16 (5’CCTTGATCTCACCACAAGCA3′) для акт1 + .ДНК-зонды метили [α32p]-dCTP с использованием набора Random Primed DNA Labeling Kit (Amersham). Гибридизацию проводили при 42°С в течение ночи в растворе Rapid-hyb (Amersham). Сигнал визуализировали, подвергая мембрану воздействию рентгеновской пленки, и относительную интенсивность сигнала определяли количественно с помощью условно-бесплатной программы (Scion Image Beta 4.0.2).

Проточный цитометрический анализ

Для проточной цитометрии клетки, выращенные до средней логарифмической фазы (5×10 6 клеток мл -1 ), собирали и фиксировали в 70% этаноле, содержащем 50 мМ цитрата натрия, в течение ночи при 4°C.После кратковременного центрифугирования клеточный осадок дважды промывали 1 мл 50 мМ буфера цитрата натрия (рН 7) и обрабатывали РНКазой А (10 мкг мл -1 ) при 37°С в течение 2 часов. Клетки окрашивали йодидом пропидия (16 мкг мл -1 ) и анализировали с использованием проточного цитометра BD FACScalibur, как описано ранее [28]. Данные анализировали с помощью программного обеспечения WinMDI версии 2.8.

Анализ спаривания и спороношения

Для контроля эффективности спорообразования S. Клетки pombe , выращенные до средней логарифмической фазы, готовили двумя последовательными переносами молодых колоний на чашки с агаром EMM2. Затем клетки собирали и трижды промывали дистиллированной водой. Суспензии гомоталлических гаплоидных клеток ( H 90 ) или смеси сопрягающих пар ( H + и H ) были обнаружены в аликвотах 10 мкл (1,0 × 10 9 клетки) на EMM2 и чашки с агаром EMM-N. Культуры выращивали при 30°С и через определенные промежутки времени клетки наблюдали с помощью ДИК-микроскопии для определения частоты споруляции.Оценивали не менее 400 клеток из трех независимых экспериментов и рассчитывали частоты спаривания и спорообразования (F M ) по следующей формуле [34]: F M (%) = (2Z+2A+0,5S)×100 /(H+2Z+2A+0,5S), где Z обозначает количество зигот, A — количество асков, S — количество свободных спор и H — количество клеток, которые не спаривались. При необходимости спорообразование визуализировали путем окрашивания парами йода.

Репортерный анализ β-галактозидазы

С.Клетки pombe , содержащие репортерные плазмиды β-галактозидазы, предварительно выращивали до средней логарифмической фазы в жидкой среде EMM2 в течение 18 ч и переносили на среду EMM2 или EMM-N. Клетки через определенные промежутки времени собирали центрифугированием, промывали и ресуспендировали в концентрации 5×10 90 109 6 90 110 клеток мл 90 109 -1 90 110 . После пермеабилизации клеток 0,1% лауроилсаркозинатом натрия определяли активность β-галактозидазы путем измерения гидролиза хромогенного субстрата, о-нитрофенил-β-D-галактозида, как описано ранее [35].

Анализ сдвига электрофоретической подвижности

Для приготовления слитых белков GST и GST-Gaf1 для анализа сдвига электрофоретической подвижности (EMSA) клетки штаммов Escherichia coli BL21, несущих pGEX4T3 или pGEX4T3-Gaf1, культивировали в среде LB с 50 мкг мл -1 ампициллина при 30°С. °C до A 600 от 0,5. Добавляли изопропил-β-D-тиогалактопиранозид до конечной концентрации 1 мМ и клетки выращивали в течение 4 ч при 25°С. Собранные клетки ресуспендировали в буфере А (20 мМ трис, рН 7.6; 137 мМ NaCl), содержащий 0,1% Tween 20, 1 мМ фенилметилсульфонилфторида и 1 мкг мл -1 лизоцима. Ресуспендированные клетки лизировали ультразвуком, а лизат очищали центрифугированием при 24000×g в течение 20 мин при 4°C. Белковые экстракты очищали на колонке Glutathione Sepharose 4B (Amersham).

Для подготовки зондов EMSA и холодных конкурентов, передний сегмент 0,60 kb Sph I- Nde I (P A ) и нижний сегмент 0,25 kb Nde I- Eco RV (P B ) частичной промоторной области ste11 + [4] амплифицировали методом ПЦР из геномной ДНК S.pombe 972 с использованием следующих праймеров: P17 (5’GCATGCCATCTCCAGGGA3′) и P18 (5’ACATATGATGCGAAAGCATT3′) для P A ; и Р19 (5’CATATGTTACTTTAACCCCT3′) и Р20 (5’GGATATCCTTTTAATATATGCT3′) для P B . Специфические двухцепочечные олигонуклеотидные зонды для мотивов GATA дикого типа (P W ) и мутантных (P M ), соответствующие нуклеотидам от -385 до -352 промотора ste11 + , получали путем отжига комплементарных пар следующие одноцепочечные олигонуклеотиды: Р21 (5’CATTTTGCCTTGCGCTATCTCCCTCAACGAAAAG3′) и Р22 (5’CTTTTCGTTGAGGGAGATAGCGCAAGGCAAAATG3′) для P W ; и P10 и P9 для P M .Дуплексы ДНК метили на концах [γ- 32 P] АТФ с помощью T 4 -полинуклеотидкиназы и очищали с использованием колонки G-50 или G-25 (Amersham). Все реакции связывания проводили в 20 мкл буфера для связывания (10 мМ Трис, рН 7,5, 2 мМ MgCl 2 , 50 мМ NaCl, 1 мМ ДТТ, 5% глицерина), содержащего 2 мкг поли(dI·dC) в качестве неактивного вещества. -специфический конкурент, 0,1–1 мкг рекомбинантного белка GST-Gaf1 и 5 мкмоль 32 P-концевой двухцепочечный зонд, при комнатной температуре в течение 20 мин.В экспериментах по конкуренции реакциям связывания ДНК давали достичь равновесия и к реакционной смеси связывания добавляли 50- или 100-кратный избыток немеченой ДНК специфического конкурента. Для обнаружения специфического ДНК-белкового комплекса образцы наносили на 6% неденатурирующий полиакриламидный гель в 0,5×трис-глициновом буфере и подвергали электрофорезу при 10 В см 90 109 -1 90 110 при комнатной температуре. Гели выдерживали в течение 2 ч, сушили на сушилке для геля и подвергали авторадиографии при -70°C с использованием рентгеновской пленки Fuji.Предполагаемые сайты связывания факторов транскрипции искали с использованием программы TRANSFAC (http://gene-regulation.com/pub/databases.html).

Результаты

Удаление

gaf1 + вызывает ускоренную G 1 -остановку в условиях недостатка азота

Ранее мы предположили, что gaf1 + может функционировать как активатор транскрипции, хотя его биологическая значимость была неясна, поскольку делеционный мутант не обнаруживал существенных дефектов [18].Однако недавний анализ генома показал, что последовательность gaf1 + , о которой сообщалось ранее (инвентарный номер AAC35593), содержит только частичную ORF, соответствующую С-концевому 290-аминокислотному сегменту Gaf1, и что полный gaf1 + Последовательность содержит ORF длиной 2565 п. н., кодирующую белок из 855 аминокислот (номер доступа Q10280) [36].

В настоящем исследовании мы полностью удалили ORF gaf1 + из генома S.pombe (таблица 1) и оценили реакцию клеток gaf1Δ на азотное голодание и ограничение глюкозы с помощью анализа на чашках. Клетки штамма gaf1Δ не демонстрировали каких-либо дефектов роста на чашках EMM2 или EMM-G, что указывает на то, что ген gaf1 + незаменим для митотического роста в нормальных условиях и условиях с ограничением глюкозы (рис. 1А). Однако клетки gaf1Δ продемонстрировали значительно сниженный рост на EMM-N, в котором отсутствовал неорганический источник азота, NH 4 Cl, по сравнению с клетками дикого типа, которые росли в ограниченной степени за счет использования дополнительных ауксотрофных питательных веществ, аденина, лейцина. , и урацил, как источники органического азота.

Рисунок 1. Делеция gaf1 + вызывает снижение роста на среде с недостатком азота.

Клетки, выращенные до средней логарифмической фазы в EMM2 в течение 18 часов, серийно разбавляли в 5 раз и помещали на чашки с агаром. Планшеты инкубировали при 30°С в течение 3 дней. (A) Клетки штаммов WT (972) и gaf1Δ (KL230) были нанесены на чашки с агаром EMM, EMM-N и EMM-G. (B) Клетки штаммов WT(ED665)/pREP42, gaf1Δ (KL210)/pREP42, WT(ED665)/pREP42-Gaf1 и gaf1Δ (KL210)/pREP-Gaf1 наносили на чашки EMM-N с (+B 1 ) или без (-B 1 ) 20 мкМ тиамина.WT обозначает дикий тип ( gaf1 + ).

https://doi.org/10.1371/journal.pone.0042409.g001

Чтобы подтвердить, что чувствительность мутанта gaf1Δ к азотному голоданию обусловлена ​​скорее потерей активности Gaf1, чем приобретением аномальной активности, мы сконструировали система, в которой производство Gaf1 может быть отключено искусственно с помощью репрессируемого тиамином промотора nmt42 + . В отсутствие тиамина клетки gaf1Δ /pREP-Gaf1, несущие эктопические копии gaf1 + под контролем промотора nmt42 + , демонстрировали рост, сходный со штаммами дикого типа (WT/pREP42). и WT/pREP-Gaf1) на чашках EMM-N (рис. 1В).В присутствии тиамина клетки gaf1Δ /pREP-Gaf1 демонстрировали такой же плохой рост на среде EMM-N, как и клетки gaf1Δ /pREP42. Эти результаты позволяют предположить, что ген gaf1 + необязателен для митотического роста в нормальных условиях, но, по-видимому, играет значительную роль в поддержании роста, хотя и в ограниченной степени, в условиях недостатка азота.

У S. pombe , когда основные питательные вещества становятся ограниченными, клетки выходят из митотического цикла и вступают либо в стационарную фазу G 0 , либо в программу половой дифференцировки [37].Во время раннего азотного голодания клетки S. pombe претерпевают несколько раундов быстрого клеточного деления, а затем останавливаются в фазе G 1 [8], [13]. В этом исследовании штамм gaf1Δ накапливал клетки, задержанные G 1 , после 4 часов азотного голодания, но штамм дикого типа не накапливал какого-либо обнаруживаемого количества клеток G 1 , задержанных до тех пор, пока не прошло 6 часов после азотного голодания. сдвиг (рис. 2А). Соответственно, гомоталлический гаплоидный штамм h 90 gaf1Δ /pREP-Gaf1 начал накапливать G 1 -аррестированные клетки после 2 ч азотного голодания в присутствии тиамина, однако не проявлял признаков G . 1 — арест даже после 8-часового азотного голодания в отсутствие тиамина (рис. 2В).Таким образом, делеция gaf1 + вызывает ускоренный вход в G 1 в условиях недостатка азота. Соответственно, функция gaf1 + может заключаться в задержке перехода голодающих по азоту клеток от вегетативного цикла к мейотическому циклу, помогая поддерживать вегетативный цикл при временном голодании по азоту.

Рисунок 2. Делеция gaf1 + вызывает ускоренную G 1 -остановку в условиях недостатка азота.

Клетки, выросшие до средней логарифмической фазы в EMM2 в течение 18 часов, были перемещены в среду EMM-N, и содержание их ДНК периодически контролировалось с помощью анализа FACS. Данные FACS представляют собой типичные примеры трех независимых экспериментов. (A) Клетки гетероталличных ( h ) штаммов WT (972) и gaf1Δ (KL230) были перенесены на среду EMM-N. (B) Клетки гомоталличного штамма ( h 90 ) gaf1Δ (KL211)/pREP-Gaf1 были перенесены на среду EMM-N с (+B 1 ) или без (−B 1 ) 20 мкМ тиамина.WT обозначает дикий тип ( gaf1 + ).

https://doi.org/10.1371/journal.pone.0042409.g002

Эффективность спорообразования повышается за счет мутации

gaf1Δ и снижается за счет gaf1 + сверхэкспрессии

Чтобы оценить функцию gaf1 + в спорообразовании в условиях голодания по азоту, мы использовали суспензии предварительно выращенных гомоталличных гаплоидных клеток ( h 90 ) и смеси спаривающихся пар ( h + и h ) с gaf1Δ или без него на чашках с агаром EMM2 (+N) и EMM-N (-N) и оценили их эффективность спаривания и спорообразования (F M ) после 3-дневного культивирования. Гомоталличный гаплоидный штамм gaf1Δ показал значительно более высокое значение F M (24%), чем штамм дикого типа (7%), на чашках EMM2 (таблица 2). Кроме того, значение F M смеси сопряжения h + gaf1Δ×h gaf1Δ (63%) было примерно в 5 раз выше, чем у сопряжения h + ×h

10

пара дикого типа (13%) на чашках EMM2. Гомоталличный штамм gaf1Δ (85%) и смесь спаривания h + gaf1Δ×h gaf1Δ (80%) показали примерно на 10–15% более высокие значения F M , чем гомоталличный штамм дикого типа ( 69%) и ч + × ч смесь скрещивания штаммов дикого типа (71%) на чашках EMM-N.Эти результаты показывают, что мутация gaf1Δ повышает эффективность спаривания и спорообразования, делая клетки более чувствительными к азотному голоданию.

Мы также оценили роль gaf1 + в споруляции с использованием системы сверхэкспрессии gaf1 + под контролем промотора nmt42 + в гомоталлических штаммах. В жидкой среде EMM-N споруляция не наблюдалась среди ч 90 gaf1Δ/ pREP-Gaf1 и ч 90 клеток WT/pREP-Gaf1 даже после 18-часового воздействия азотного голодания, в то время как значительная часть клеток ч 90 gaf1Δ /pREP42 и ч 90 WT/pREP42 демонстрировала поведение спаривания после 3- и 18-часового воздействия соответственно (рис. 3А).На чашках EMM-N штаммы h 90 WT/pREP-Gaf1 и h 90 gaf1Δ /pREP-Gaf1 демонстрировали незначительные уровни окрашивания йодом и значение F M в отсутствие тиамина, но умеренные уровни окрашивания йодом и значения F M (23–25%) в присутствии тиамина (рис. 3В). Пятна штаммов h 90 WT/pREP42 и h 90 gaf1Δ /pREP42, напротив, окрашивались парами йода в темно-коричневый цвет и демонстрировали высокие значения F M (69–85%) через 3 -d культивирование независимо от присутствия тиамина, что указывает на обильное спороношение в условиях недостатка азота. Вместе эти результаты демонстрируют, что сверхэкспрессия gaf1 + приводит к значительному снижению эффективности споруляции.

Рисунок 3. Сверхэкспрессия gaf1 + приводит к снижению эффективности спорообразования.

Клетки и колонии гомоталлических ( h 90 ) штаммов, WT(JY4)/pREP42, gaf1Δ (KL211)/pREP42, WT(JY4)/pREP-L07 (KL211)/pREP42, WT(JY4)/pREP-L07 (1ΔKL07)10109 gaf1 и gaf1 /pREP-Gaf1 анализировали на предмет спорообразования с помощью ДИК-микроскопии и окрашивания йодом соответственно.(A) Клетки выращивали до средней логарифмической фазы в EMM2 в течение 18 часов и перенесли в среду EMM-N. Образцы брали из культур через определенные промежутки времени, и морфологические характеристики клеток наблюдали с помощью ДИК-микроскопии. Пруток, 10 мкм. (B) Клетки выращивали до средней логарифмической фазы в EMM2 в течение 18 ч и наносили на чашки EMM-N с (+B 1 ) или без (-B 1 ) 20 мкМ тиамина. Спорообразование контролировали путем окрашивания колоний парами йода после 3-дневной инкубации при 30°С. Значение F M , представленное под каждой панелью, определяли путем наблюдения за клетками под микроскопом ДИК.Значения представляют собой среднее значение по крайней мере трех независимых анализов, проведенных в трех повторностях. WT обозначает дикий тип ( gaf1 + ).

https://doi.org/10.1371/journal.pone.0042409.g003

Gaf1 контролирует как гены азотного голодания, так и гены, чувствительные к феромонам

Для поиска набора генов, экспрессия которых специфически изменена в ответ на потерю gaf1 + , был проведен анализ транскриптома на основе микрочипов с использованием образцов РНК из голодающих по азоту (-N) и не голодающих (+ N) клетки штаммов дикого типа ( gaf1 + , ED668) и gaf1Δ (KL216).Диаграмма Венна (рис. 4) была построена по группам генов с повышенной экспрессией (≥1,5 раза, p<0,05) в клетках gaf1Δ без голодания (группа -G), клетках дикого типа, голодающих по азоту (группа — N) и голодающих по азоту клеток gaf1Δ (группа -N/-G). Сто восемьдесят три гена были активированы в не голодающих клетках gaf1Δ (группа -G, таблица S1). В общей сложности 1301 и 1418 генов были активированы азотным голоданием в клетках дикого типа (группа -N, таблица S2) и клеток gaf1Δ (группа -N/-G, таблица S3).

Рисунок 4. Влияние мутации gaf1Δ и азотного голодания на глобальные профили экспрессии генов S. pombe .

Образцы РНК из голодающих по азоту (-N) и не голодающих (+N) клеток штаммов дикого типа ( gaf1 + , ED668) и gaf1Δ (KL216) использовали для анализа транскриптома с GeneChip Yeast Genome 2.0 Массив. Диаграмма Венна строится из списков генов с повышенной экспрессией (≥1,5 раза, p<0.05) в клетках gaf1Δ без азота (группа -G, таблица S1), клетках дикого типа, испытывающих недостаток азота (группа -N, таблица S2), и клетках gaf1Δ , испытывающих недостаток азота (группа -N/-G, таблица С3). Перекрывающиеся и неперекрывающиеся части трех групп (группа -G, -N и -N/-G) обозначаются как подгруппы от A до G. Списки генов, включенных в подгруппы A–G, представлены в таблицах S4. , S5, S6, S7, S8, S9 и S10 соответственно во вспомогательной информации.

https://дои.org/10.1371/journal.pone.0042409.g004

Перекрывающиеся и непересекающиеся части трех групп (группы −G, −N и −N/−G) обозначаются как подгруппы от A до G (рис. 4). , что позволяет более детально группировать интересующие гены. Приблизительно 63% (116 генов) членов группы -G были активированы как мутацией gaf1Δ , так и азотным голоданием (подгруппа B+G, таблицы S5 и S10), в то время как большинство остальных (61 ген) были активированы. -регулируется исключительно мутацией gaf1Δ (подгруппа А, таблица S4).Следовательно, предполагается, что Gaf1 снижает базовые уровни экспрессии генов, реагирующих на азотное голодание, включенных в подгруппу B+G. Хотя было показано, что большинство членов в группах -N и -N/-G активируются азотным голоданием как в клетках gaf1Δ , так и в клетках дикого типа (1043 гена, подгруппа D+G, таблицы S7 и S10), значительная часть из них была активирована азотным голоданием либо в gaf1Δ (375 генов, подгруппа E+F, таблица S8 и S9), либо в клетках дикого типа (262 гена, подгруппа B+C, таблица S5 и S6) .

Значительное количество генов подгруппы B+G активируются во время спаривания и спороношения (база данных Sanger Center; http://www.genedb.org/genedb/pombe) [38]: гены, участвующие в азоте и/ Или ответ на феромоне, такие как Mei2 + , STE11 + , SPK1 + , PPK33 + , STE4 + , GPA1 + , MFM1 + , карта1 + , карта2 + и карта3 + ; Функция генов в двойном прямом перерыве (DSB), мемотическая рекомбинация, а также / или ядерная сегрегация, такая как MUG8 + , MUG14 + , MUG24 + , MUG55 + , MUG112 + , MUG133 + , REC24 + , REC24 + , BQT2 + и MOA1 + [39]; гены, кодирующие пермеазы (5 генов) и переносчики (15 генов) аминокислот, сахаров, мочевины и других питательных веществ; и 5 генов wtf , принадлежащих последовательностям, содержащим транспозон Tf, которые транскрибируются во время мейоза. В совокупности предполагается, что делеция gaf1 + может привести к клеточной физиологии, сходной с физиологией, вызванной азотным голоданием, и, соответственно, что Gaf1 играет важную роль как в азотном голодании, так и в реакции спаривания.

Кроме того, сравнивая наши данные с результатами микрочипового анализа с использованием штаммов дикого типа, Ste11-сверхэкспрессирующих и ste11Δ [40], мы обнаружили, что 25 генов среди тех, которые индуцируются мутацией gaf1Δ , включены в список из 61 гена-мишени Ste11 (табл. 3).Среди генов, демонстрирующих повышенную экспрессию в клетках gaf1Δ , 10 генов, в том числе mei2 + , spk1 + и ste11 + , в то время как группа остальные (15 генов), включая ran1 + , tht1 + и ste6 + , индуцировались только в условиях азотного голодания (подгруппа D+E). Этот результат подтверждает предположение, что ste11 + , возможно, является прямой мишенью Gaf1, который негативно регулирует его экспрессию на уровне транскрипции.

ste11 + является эпистатическим к gaf1 +

Анализ эпистаза был выполнен, чтобы определить, функционирует ли Gaf1 по тому же пути, что и Ste11, ключевой фактор транскрипции для полового развития [12]. Предварительно выращенные клетки гомоталлических штаммов гаплоидов, H

10 Gaf1δ

, H , H 90 STE11Δ и H и H Gaf1δ Ste11Δ , были замечены как на тарелках EMM2, так и на EMM-N и эффективность споруляции наблюдали через 3 дня.Значение F M H 90 H 90 Gaf1δ достиг примерно на 85% на EMM-N и 24% на EMM2, но H 90 Ste11δ и H 90 Gaf1δ Ste11Δ клетки, а также h + ste11Δ × h gaf1Δ смесь для спаривания показала незначительный уровень эффективности спорообразования даже на EMM-N (таблица 2). Таким образом, фенотип мутации gaf1Δ , т. е. , ускоренная инициация спорообразования и повышенная эффективность спорообразования, маскируется мутацией ste11Δ , вызывающей нарушение спорообразования.Таким образом, ste11 + является эпистатическим по отношению к gaf1 + в отношении эффективности спорообразования, и, кроме того, gaf1 + функционирует выше ste17 + в развитии полового сигнального пути.

Экспрессия

ste11 + ускорена и повышена в клетках gaf1Δ

Чтобы проверить, отвечает ли gaf1 + за регуляцию транскрипции ste11 + , мы проанализировали экспрессию ste11 + как в условиях дефицита азота, так и в нормальных условиях у 6 gaf. типовые штаммы с помощью Нозерн-блоттинга.В нормальных условиях клеток gaf1Δ показали повышенный уровень ste11 + по сравнению с клетками дикого типа (рис. 5А). Когда клетки дикого типа подвергались азотному голоданию, уровень транскрипта gaf1 + значительно возрастал в течение первых 6 ч азотного голодания с последующим снижением. Неожиданно уровни транскрипта ste11 + как в клетках дикого типа, так и в клетках gaf1Δ , собранных из культур, лишенных азота, в момент времени 0 ч были значительно выше, чем в соответствующих клетках из неголодных культур. , что может быть связано с очень коротким экспонированием клеток в среде EMM-N с последующей промывкой дистиллированной водой.Этот результат аналогичен тому, который наблюдался в предыдущем исследовании, проведенном другой исследовательской группой [41]. Поэтому мы приняли данные от неголодных клеток соответствующих штаммов, культивируемых в EMM2 в течение 18 ч, а не от голодающих по азоту клеток, отобранных в момент времени 0 ч, в качестве эталонных. Как показано на рисунке 5A, количество транскриптов ste11 + увеличивалось гораздо медленнее, чем количество транскриптов gaf1 + , и оно не достигало своего максимального уровня, по крайней мере, через 9 часов после переноса. Однако уровень транскрипта ste11 + в клетках gaf1Δ резко повышался до плато в течение 3 ч и сохранялся в течение следующих 6 ч. Экспрессию ste11 + также контролировали путем анализа эктопической экспрессии гибридного гена Ste11 (p) -lacZ в штаммах дикого типа и gaf1Δ , несущих pJLC-Ste11 (p) Плазмида LacZ. В соответствии с результатом нозерн-блоттинга, экспрессия Ste11 (p) -lacZ была выше в клетках gaf1Δ , чем в клетках дикого типа в условиях отсутствия голодания (фиг. 5В).Когда клетки подвергали азотному голоданию, экспрессия Ste11 (p) -lacZ индуцировалась быстрее в клетках gaf1Δ , чем в клетках дикого типа. Эти результаты позволяют предположить, что делеция gaf1 + вызывает ускоренную индукцию экспрессии ste11 + в условиях голодания по азоту и увеличение экспрессии ste11 + даже в условиях отсутствия голодания.

Рис. 5. Делеция gaf1 + приводит к ускоренной индукции экспрессии ste11 + в условиях недостатка азота.

(A) Нозерн-блот-анализ мРНК ste11 + и gaf1 + из клеток дикого типа и gaf1Δ , подвергшихся азотному голоданию. Клетки штаммов дикого типа (972) и gaf1Δ (KL230), предварительно выращенные в среде EMM2 (+N), переносили в среду EMM-N (-N) и культивировали при постоянном встряхивании. В указанные моменты времени клетки собирали и дважды промывали дистиллированной водой, после чего из клеток выделяли тотальные РНК. РНК-блоты гибридизовали с 32 P-мечеными ПЦР-амплифицированными зондами gaf1 + и ste11 + .Для внутреннего контроля все блоты удаляли и затем регибридизировали с 32 P-меченым актин-специфическим зондом ( act1 + ). (B) Репортерный анализ β-галактозидазы для анализа экспрессии ste11 + в клетках дикого типа и gaf1Δ , подвергнутых азотному голоданию. Клетки штаммов дикого типа (ED665) и gaf1Δ (KL240), несущих pJLC-Ste11 (p) -LacZ, культивировали до средней логарифмической фазы в EMM2 (+N) и сдвигали в EMM-N (-N) .В указанные моменты времени клетки собирали и дважды промывали дистиллированной водой и оценивали уровень экспрессии ste11 + путем измерения активности β-галактозидазы в каждом образце. Значения представляют собой среднее значение ± стандартная ошибка трех независимых экспериментов, проведенных в трех повторностях, n  = 9, *, p <0,01; **, p <0,05 (двусторонний критерий Стьюдента, против дикого типа). WT обозначает дикий тип ( gaf1 + ).

https://doi.org/10.1371/journal.pone.0042409.g005

Белок Gaf1 связывается с промоторной областью

ste11 +

Мы провели EMSA, чтобы выяснить, может ли Gaf1 напрямую связываться с промоторной областью ste11 + . Вышележащий зонд (P A ), охватывающий область от -835 до -227 промотора ste11 + , был амплифицирован с помощью ПЦР и помечен по концам полинуклеотидкиназой Т4 (фиг. 6А).Комплекс ДНК-белок наблюдали в реакционной смеси, содержащей 32 P-меченый зонд P A и рекомбинантный GST-Gaf1 (рис. 6B, дорожки 2 и 5). Комплекс ДНК-белок специфически восстанавливался в присутствии 50- и 100-кратного молярного избытка холодного конкурентного зонда P A (рис. 6В, дорожки 3 и 4), но не в присутствии 50- или 100-кратного молярный избыток холодного конкурента P B (фиг. 6B, дорожки 6 и 7). Это свидетельствует о том, что белок Gaf1 специфически связывается с цис-элементом , содержащимся в верхней области (от -828 до -227) промотора ste11 + .

Рис. 6. Белок Gaf1 специфически связывается с GATA-связывающим мотивом ste11 + промотора in vitro .

(A) Схематическая диаграмма промоторной области ste11 + . Открытые и закрытые овалы представляют сайты связывания для Rst2 (UASst) и Ste11 (TR1 и TR2) соответственно. Основной сайт начала транскрипции (номер позиции +1) обозначен шарнирной стрелкой. Области, содержащиеся в верхнем по потоку зонде P A (-834~-225) и выходном зонде P B (-231~+10), показаны в виде полос.Темный квадрат представляет мотив GATA, охватывающий диапазон от -385 до -352, для которого были сконструированы двухцепочечные олигонуклеотидные зонды дикого типа (P W ) и мутантные (P M ). Сайты рестрикции: Sp, Sph I; N, Nde I; Дом на колесах, Эко Дом на колесах. (B) Поиск области связывания Gaf1 в промоторе ste11 + с помощью EMSA. Белок GST-Gaf1 (1 мкг) инкубировали с меченым зондом P A , содержащим 0,6 т.п.о. выше промотора ste11 + в отсутствие (дорожки 2 и 5) или в присутствии избытка холодового конкурента, P A (дорожка 3, 50-кратная, дорожка 4, 100-кратная) или P B (дорожка 6, 50-кратная, дорожка 7, 100-кратная). (C) Анализ связывания Gaf1 с мотивом GATA промотора ste11 + с помощью EMSA. Белок GST-Gaf1 (дорожка 3, 0,1 мкг; дорожки 4–6, 1 мкг) инкубировали с меченым зондом P A в отсутствие (дорожки 3 и 4) или в присутствии 100-кратного избытка холодового конкурента P M. (полосы 5) или P W (дорожки 6). (D) Мутационное рассечение Gaf1-связывающего мотива GATA промотора ste11 + с помощью EMSA. Различное количество белка GST-Gaf1 (дорожка 3, 0.1 мкг; дорожка 4, 0,2 мкг; дорожка 5, 0,5 мкг; дорожки 6, 7, 11 и 12, 1 мкг) инкубировали с меченым олигонуклеотидным зондом P W в отсутствие (дорожки 3 и 4) или в присутствии 100-кратного избытка холодового конкурента P M (дорожка 5) или P W (полосы 6). Имитационные реакционные смеси без GST-Gaf1 или с белком GST использовали в качестве отрицательного контроля в (B)–(D). Закрытые и открытые стрелки на (B)–(D) представляют собой сдвинутые полосы и свободные зонды соответственно.

https://дои.org/10.1371/journal.pone.0042409.g006

Мы также провели конкурентные эксперименты с использованием холодных олигонуклеотидных зондов, охватывающих пары оснований от -385 до -351: P W , содержащий канонический мотив GATA, и P M , содержащий мутации в GATA. мотив (рис. 6А). Комплекс ДНК-белок между 32 P-меченым зондом P A и белком GST-Gaf1 уменьшался при добавлении 100-кратного молярного избытка холодного P W (рис. 6C, дорожки 4 и 6), но не аналогичным количеством холодного P M (рис. 6C, дорожки 4 и 5).Соответственно, количество комплекса P W -GST-Gaf1 увеличивалось пропорционально количеству GST-Gaf1 (рис. 6D, дорожки 3–6) и снижалось до базового уровня при добавлении 100-кратного молярного избытка холода. P W (рис. 6C, дорожка 6). Зонд P M не продуцировал какого-либо обнаруживаемого количества ДНК-белкового комплекса с GST-Gaf1 (рис. 6D, дорожка 10) и не проявлял конкуренции с зондом P W по отношению к GST-Gaf1 даже при 100-кратном молярном избытке. (Рисунок 6D, дорожка 11).Эти результаты отражают, что канонический мотив GATA от -371 до -366 в промоторе ste11 + (рис. 6А) является целевой последовательностью белка Gaf1. Таким образом, предполагается, что мотив GATA в промоторе ste11 + функционирует как элемент cis , задерживая и ослабляя индукцию экспрессии ste11 + посредством взаимодействия с Gaf1.

Обсуждение

Белок Ste11 S. pombe , который активирует ряд генов, необходимых для спаривания и мейоза, является основным регулятором половой дифференциации, вызванной недостатком питательных веществ или экологическим стрессом [12].В настоящем исследовании мы идентифицировали Gaf1, фактор S. pombe GATA, как негативный регулятор экспрессии ste11 + .

Делеция gaf1 + не вызывала дефектов роста в нормальных условиях. Однако при азотном голодании это привело к снижению митотического роста (рис. 1), ускоренному входу в G 1 (рис. 2) и повышению эффективности спаривания и спорообразования (табл. 2). Сверхэкспрессия gaf1 + приводила к заметному снижению эффективности спорообразования в условиях недостатка азота (рис. 3).Кажется вероятным, что Gaf1 действует как модулятор перехода митоз-мейоз, задерживая вступление растущих клеток в мейотический цикл на начальных стадиях азотного голодания и сигнализируя об оптимальном времени для стимуляции полового развития. Задержка G 1 -остановки и последующая споруляция могут обеспечить механизм безопасности, позволяющий клеткам вернуться к вегетативному росту, когда доступность питательных веществ снова станет благоприятной [6], [16], [42], [43]. В соответствии с настоящим результатом сверхэкспрессия tor2 + , кодирующего протеинкиназу TOR Tor2, сильно подавляет эффективность спаривания, мейоза и споруляции, тогда как ее инактивация имеет противоположный эффект, приводя к дифференцировке клеток независимо от условий питания [11].На примере S. cerevisiae было показано, что киназа Tor и транскрипционный фактор GATA участвуют в репрессии азотного катаболита (NCR), регуляторном событии, при котором транскрипция определенных генов подавляется хорошим источником азота, таким как глутамин, но активируется бедным источником азота, таким как пролин [44]. Следовательно, участие киназы TOR и фактора транскрипции GATA в передаче сигналов азота может быть широко консервативным явлением среди различных организмов.

Микрочиповый анализ профилей глобальной экспрессии генов в клетках gaf1Δ и клетках дикого типа в условиях голодания и без азота позволил нам найти кластер генов, контролируемых действием Gaf1.Приблизительно 63% генов, индуцированных делецией gaf1 + в нормальных условиях (подгруппа B+G, рис. 4), перекрываются с генами, индуцированными азотным голоданием в клетках дикого типа. Кроме того, идентифицировано, что многие гены подгруппы B+G индуцируются во время спаривания и споруляции [38]. Таким образом, вполне вероятно, что Gaf1 играет важную роль не только в пути передачи сигналов азота, но также и в реакции спаривания. В соответствии с настоящим результатом недавний анализ микрочипов с использованием чувствительных к температуре мутантов tor2 показал, что в общей сложности 151 из 194 генов, индуцируемых потерей функции Tor2, включены в список примерно 1000 генов, которые, как было обнаружено, индуцируются азотным голоданием. в С.помбе [45]. Этот результат указывает на важную роль, которую Tor2 играет в азотном голодании и реакции спаривания. Интересно, что мы также обнаружили, что 13 генов среди генов, индуцированных делецией gaf1 + , перекрываются с генами, индуцированными потерей функции Tor2, что позволяет предположить, что два гена могут быть вовлечены в один и тот же сигнальный путь, активируемый азотным голоданием. Таким образом, было бы интересно определить родство между генов gaf1 + и генов tor2 + .

Сравнение данных нашего микрочипа с полногеномным обзором генов-мишеней Ste11, о котором сообщалось ранее [40], позволило нам предположить, что ste11 + является сильным кандидатом на роль прямой мишени транскрипции Gaf1 (таблица 3). Особенно следует отметить, что гены, участвующие в передаче сигналов RAS / MAPK, стимулировали феромон, такие как GPA1 + , STE4 + , SPK1 + , STE11 + и mei2 + транскрипционно индуцируются в ответ на потерю функции gaf1 + в нормальных условиях.Кроме того, это открытие согласуется с наблюдением, что делеция gaf1 + вызывает ускоренное вступление клеток в мейотический клеточный цикл (рис. 2) и повышенную эффективность спаривания и спорообразования при воздействии азотного голодания (таблица 2).

Согласно результатам микрочипового анализа, клетки штамма gaf1Δ ste11Δ были полностью дефектны в спаривании и спороношении (табл. 2), что указывает на то, что ste11 + является эпистатическим по отношению к gaf1 + .Делеция gaf1 + не только увеличивает экспрессию ste11 + в не голодающих клетках, но также ускоряет индукцию транскрипции ste11 + в голодающих по азоту клетках (рис. 5). Кроме того, результат EMSA предоставляет убедительные доказательства того, что Gaf1 связывается с каноническим мотивом GATA (5′-HGATAR-3′), охватывающим от -371 до -366 в промоторе ste11 + , чтобы ослабить и задержать его экспрессию. (Рисунок 5).Таким образом, становится очевидным, что Gaf1 функционирует как негативный регулятор транскрипции ste11 + посредством прямого взаимодействия с мотивом GATA в промоторе ste11 + . Экспрессия ste11 + регулируется непосредственно двумя транскрипционными факторами, Rst2 и Ste11, которые связываются с вышестоящей активирующей последовательностью (UASst; 5′-CCCCTC-3′) и Т-обогащенным блоком (TR блоком; 5 ′-TTCTTTGTTY-3′) в промоторе ste11 + соответственно [4].Других белков, активирующих или репрессирующих транскрипцию ste11 + за счет прямого связывания с его промотором, не выявлено. Наше исследование показывает, что Gaf1 представляет собой главный пример негативной регуляции транскрипции ste11 + посредством прямого связывания с цис -действующим мотивом его промотора.

На рис. 7 показано упрощенное представление предполагаемой роли Gaf1 в путях передачи сигналов азота, управляющих экспрессией ste11 + и последующей половой дифференцировкой у S.pombe вместе с цАМФ-зависимой PKA и активируемой стрессом путями MAPK, определенными ранее. В настоящем исследовании мы обнаружили, что азотное голодание вызывает индукцию экспрессии gaf1 + , а Gaf1, в свою очередь, репрессирует экспрессию ste11 + посредством прямого взаимодействия со своим промотором. Недостаток источника углерода или азота приводит к снижению уровня цАМФ и последующему падению активности PKA, что, следовательно, индуцирует экспрессию ste11 + посредством активации Rst2, который может связываться с промоторной областью ste11 + [4], [7], [46].Азотное голодание также вызывает активацию активируемого стрессом пути MAPK, включая Wis4, Win1, Wis1 и Sty1 [14], [15], что приводит к активации Atf1 путем фосфорилирования [16], [47], [48]. Активированный Atf1, в свою очередь, образует комплекс с другим белком Pcr1, связывающим элемент ответа цАМФ, с образованием гетеродимерного фактора транскрипции Atf1-Pcr1, который также необходим для экспрессии ste11 + [5], [6], [ 49]. Пока не установлено, регулирует ли комплекс Atf1-Pcr1 непосредственно экспрессию ste11 + или нет.Однако сообщалось, что гетеродимер Atf1-Pcr1 напрямую активирует экспрессию cgs2 + , кодирующих фосфодиэстеразу, которая играет важную роль в регуляции одного цАМФ-зависимого пути PKA [3]. Кроме того, фосфодиэстераза, скорее всего, стимулируется активностью PKA для создания механизма обратной связи [50]. Таким образом, существует прямая связь между путями МАРК и ПКА, опосредованная действием комплекса Atf1-Pcr1. Остается определить, контролируется ли экспрессия gaf1 + либо цАМФ-зависимым PKA, либо стресс-активируемым путем MAPK.

Рисунок 7. Схематическая диаграмма, показывающая предполагаемую функцию Gaf1 в путях передачи сигналов азота в S. pombe .

Азотное голодание вызывает индукцию экспрессии gaf1 + , а Gaf1, в свою очередь, репрессирует экспрессию ste11 + посредством прямого взаимодействия со своим промотором. Ранее было известно, что азотное голодание приводит к активации Rst2 через цАМФ-зависимый путь PKA [14], [15], а также Atf1-Pcr1 через путь Sty1 MAPK [3], [5], [6]. , [14]–[16], [47]–[49], что приводит к индукции экспрессии ste11 + .Кроме того, фосфодиэстераза, скорее всего, стимулируется активностью PKA для создания механизма обратной связи [50]. Путь, рассматриваемый в этом исследовании, показан жирными линиями, а другие ранее определенные пути показаны тонкими линиями. Активация и ингибирование обозначены стрелками и перекрещивающимися полосами соответственно. Пунктирные линии указывают пути, которые еще предстоит полностью определить.

https://doi.org/10.1371/journal.pone.0042409.g007

Вклад авторов

Идея и разработка экспериментов: LK KLH.Выполняли эксперименты: LK YMY JHY. Проанализированы данные: LK KLH PJM. Предоставленные реагенты/материалы/инструменты для анализа: KLH PJM. Написал статью: LK PJM.

Каталожные номера

  1. 1. Egel R (1973) Гены, участвующие в экспрессии типа спаривания у делящихся дрожжей. Мол Ген Генет 122: 339–343.
  2. 2. Дэйви Дж. (1998) Слияние делящихся дрожжей. Дрожжи 14: 1529–1566.
  3. 3. Davidson MK, Shandilya HK, Hirota K, Ohta K, Wahls WP (2004) Комплекс Atf1-Pcr1-M26 связывает активируемые стрессом пути MAPK и цАМФ-зависимой протеинкиназы посредством ремоделирования хроматина cgs2+.J Biol Chem 279: 50857–50863.
  4. 4. Kunitomo H, Higuchi T, Iino Y, Yamamoto M (2000) Белок цинковых пальцев, Rst2p, регулирует транскрипцию гена ste11+ делящихся дрожжей, который кодирует ключевой фактор транскрипции для полового развития. Мол Биол Ячейка 11: 3205–3217.
  5. 5. Watanabe Y, Yamamoto M (1996) Schizosaccharomyces pombe pcr1+ кодирует белок CREB/ATF, участвующий в регуляции экспрессии генов, отвечающих за половое развитие. Мол Селл Биол 16: 704–711.
  6. 6. Kanoh J, Watanabe Y, Ohsugi M, Iino Y, Yamamoto M (1996) Schizosaccharomyces pombe gad7+ кодирует фосфопротеин с доменом bZIP, который необходим для надлежащей остановки G1 и экспрессии генов при азотном голодании. Гены Клетки 1: 391–408.
  7. 7. Higuchi T, Watanabe Y, Yamamoto M (2002)Протеинкиназа A регулирует половое развитие и глюконеогенез посредством фосфорилирования транскрипционного активатора Zn-пальца Rst2p у делящихся дрожжей. Мол Селл Биол 22: 1–11.
  8. 8. Yamamoto M (1996) Регуляция мейоза у делящихся дрожжей. Функция клеточной структуры 21: 431–436.
  9. 9. Yamada H, Ohmiya R, Yamamoto E, Aiba H, Mizuno T (1997) Характеристика мультикопийных генов-супрессоров, которые дополняют дефект в каскаде киназ Wis1-Sty1 MAP, участвующем в стрессовых реакциях у Schizosaccharomyces pombe. J Gen Appl Microbiol 43: 209–215.
  10. 10. Yamamoto TG, Chikashige Y, Ozoe F, Kawamukai M, Hiraoka Y (2004)Активация MAP-киназы, чувствительной к феромонам, заставляет гаплоидные клетки подвергаться эктопическому мейозу с нормальной группировкой теломер и сегрегацией сестринских хроматид у делящихся дрожжей.J Cell Sci 117: 3875–3886.
  11. 11. Alvarez B, Moreno S (2006) Делящиеся дрожжи Tor2 способствуют росту клеток и подавляют дифференцировку клеток. J Cell Sci 119: 4475–4485.
  12. 12. Sugimoto A, Iino Y, Maeda T, Watanabe Y, Yamamoto M (1991) Schizosaccharomyces pombe ste11+ кодирует фактор транскрипции с мотивом HMG, который является важным регулятором полового развития. Гены Дев 5: 1990–1999.
  13. 13. Kjaerulff S, Lautrup-Larsen I, Trueelsen S, Pedersen M, Nielsen O (2005)Конститутивная активация пути, чувствительного к феромонам делящихся дрожжей, вызывает эктопический мейоз и выявляет ste11 как митоген-активируемую мишень протеинкиназы.Мол Селл Биол 25: 2045–2059.
  14. 14. Shiozaki K, Shiozaki M, Russell P (1997) Супрессор митотической катастрофы Mcs4 регулирует цикл делящихся дрожжевых клеток через каскад киназ Wik1-Wis1-Spc1. Мол Биол Ячейка 8: 409–419.
  15. 15. Shieh JC, Martin H, Millar JB (1998) Доказательства нового MAPKKK-независимого пути, контролирующего активируемую стрессом киназу MAP Sty1 / Spc1 у делящихся дрожжей. J Cell Sci 111 (Pt 18): 2799–2807.
  16. 16. Такеда Т., Тода Т., Коминами К., Кохносу А., Янагида М. и др.(1995) Schizosaccharomyces pombe atf1+ кодирует фактор транскрипции, необходимый для полового развития и вступления в стационарную фазу. Эмбо J 14: 6193–6208.
  17. 17. Ohmiya R, Yamada H, Kato C, Aiba H, Mizuno T (2000) Регулятор ответа Prr1 необходим для транскрипции ste11+ и для полового развития у делящихся дрожжей. Мол Ген Генет 264: 441–451.
  18. 18. Хоэ К.Л., Вон М.С., Чанг К.С., Пак С.К., Ким Д.У. и др. (1998)Молекулярное клонирование gaf1, фактора Schizosaccharomyces pombe GATA, который может функционировать как активатор транскрипции.Ген 215: 319–328.
  19. 19. Won M, Hoe KL, Cho YS, Song KB, Yoo HS (1999) ДНК-индуцированное конформационное изменение Gaf1, нового фактора GATA в Schizosaccharomyces pombe. Biochem Cell Biol 77: 127–132.
  20. 20. Charron F, Paradis P, Bronchain O, Nemer G, Nemer M (1999)Совместное взаимодействие между GATA-4 и GATA-6 регулирует экспрессию генов миокарда. Mol Cell Biol 19: 4355–4365.
  21. 21. Tsang AP, Visvader JE, Turner CA, Fujiwara Y, Yu C, et al.(1997) FOG, многотипный белок цинковых пальцев, действует как кофактор транскрипционного фактора GATA-1 в эритроидной и мегакариоцитарной дифференцировке. Ячейка 90: 109–119.
  22. 22. Perlman H, Suzuki E, Simonson M, Smith RC, Walsh K (1998) GATA-6 индуцирует экспрессию p21(Cip1) и остановку клеточного цикла G1. J Biol Chem 273: 13713–13718.
  23. 23. Scazzocchio C (2000) Грибковые факторы GATA. Curr Opin Microbiol 3: 126–131.
  24. 24. Chen ES, Saitoh S, Yanagida M, Takahashi K (2003)Фактор GATA, регулируемый клеточным циклом, способствует центромерной локализации CENP-A у делящихся дрожжей.Мол Ячейка 11: 175–187.
  25. 25. Pelletier B, Beaudoin J, Philpott CC, Labbe S (2003) Fep1 подавляет экспрессию системы транспорта сидерофор-железо делящихся дрожжей Schizosaccharomyces pombe. Nucleic Acids Res 31: 4332–4344.
  26. 26. Пеллетье Б., Тротт А., Морано К.А., Лаббе С. (2005)Функциональная характеристика фактора транскрипции Fep1, регулирующего железо, из Schizosaccharomyces pombe. J Biol Chem 280: 25146–25161.
  27. 27. Альфа С., Фантес П., Хайамс Дж., Маклеод М., Уорбрик Э. (1993) Эксперименты с делящимися дрожжами: лабораторное пособие.Плейнвью, Нью-Йорк: Лабораторное издательство Колд-Спринг-Харбор.
  28. 28. Форсбург С.Л., Райнд Н. (2006) Основные методы для делящихся дрожжей. Дрожжи 23: 173–183.
  29. 29. Морено С., Клар А., Медсестра П. (1991)Молекулярно-генетический анализ делящихся дрожжей Schizosaccharomyces pombe. Методы Enzymol 194: 795–823.
  30. 30. Maundrell K (1993)Репрессируемые тиамином векторы экспрессии pREP и pRIP для делящихся дрожжей. Ген 123: 127–130.
  31. 31. Сиам Р., Долан В.П., Форсбург С.Л. (2004)Выбор и использование плазмид Schizosaccharomyces pombe.Методы 33: 189–198.
  32. 32. Пирсон Б.М., Эрнандо И., Швейцер М. (1998)Конструирование ПЦР-лигированных длинных фланкирующих гомологических кассет для использования в функциональном анализе шести неизвестных открытых рамок считывания из левого и правого плеч хромосомы XV Saccharomyces cerevisiae. Дрожжи 14: 391–399.
  33. 33. Hentges P, Van Driessche B, Tafforeau L, Vandenhaute J, Carr AM (2005)Три новые кассеты с маркерами антибиотиков для разрушения генов и переключения маркеров у Schizosaccharomyces pombe.Дрожжи 22: 1013–1019.
  34. 34. Kunitomo H, Sugimoto A, Wilkinson CR, Yamamoto M (1995) Schizosaccharomyces pombe pac2+ контролируют начало полового развития посредством пути, независимого от каскада цАМФ. Карр Жене 28: 32–38.
  35. 35. Guarente L (1983) Дрожжевые промоторы и слияния lacZ, разработанные для изучения экспрессии клонированных генов в дрожжах. Методы Enzymol 101: 181–191.
  36. 36. Вуд В., Гвиллиам Р., Раджандрим М.А., Лайн М., Лайн Р. и др.(2002)Последовательность генома Schizosaccharomyces pombe. Природа 415: 871–880.
  37. 37. Li P, McLeod M (1996)Молекулярная мимикрия в развитии: идентификация ste11+ в качестве субстрата и mei3+ в качестве псевдосубстратного ингибитора киназы ran1+. Ячейка 87: 869–880.
  38. 38. Мата Дж., Лайн Р., Бернс Г., Бахлер Дж. (2002) Программа транскрипции мейоза и споруляции у делящихся дрожжей. Нат Жене 32: 143–147.
  39. 39. Мартин-Кастельянос С., Бланко М., Розален А.Е., Перес-Идальго Л., Гарсия А.И. и др.(2005) Крупномасштабный скрининг S. pombe идентифицировал семь новых генов, необходимых для критических мейотических событий. Курс Биол 15: 2056–2062.
  40. 40. Мата Дж., Бахлер Дж. (2006) Глобальная роль Ste11p, типа клеток и феромона в контроле экспрессии генов во время ранней половой дифференциации у делящихся дрожжей. Proc Natl Acad Sci U S A 103: 15517–15522.
  41. 41. Накашима А., Хасэгава Т., Мори С., Уэно М., Танака С. и др. (2006) Специфичный для голодания ген сериновой протеазы, isp6+, участвует как в аутофагии, так и в половом развитии у Schizosaccharomyces pombe.Курр Жене 49: 403–413.
  42. 42. Davey J, Nielsen O (1994) Мутации в cyr1 и pat1 обнаруживают индуцированную феромонами остановку G1 у делящихся дрожжей Schizosaccharomyces pombe. Карр Жене 26: 105–112.
  43. 43. Imai Y, Yamamoto M (1994) Феромон P-фактора спаривания делящихся дрожжей: его молекулярная структура, структура гена и способность индуцировать экспрессию генов и арест G1 у партнера по спариванию. Гены Дев 8: 328–338.
  44. 44. Купер Т.Г. (2002) Передача сигнала об избытке азота в Saccharomyces cerevisiae от белков Tor к факторам GATA: соединение точек.FEMS Microbiol Rev 26: 223–238.
  45. 45. Matsuo T, Otsubo Y, Urano J, Tamanoi F, Yamamoto M (2007)Потеря киназы TOR Tor2 имитирует азотное голодание и активирует путь полового развития у делящихся дрожжей. Mol Cell Biol 27: 3154–3164.
  46. 46. Mochizuki N, Yamamoto M (1992) Снижение уровня внутриклеточного цАМФ вызывает инициацию полового развития у делящихся дрожжей. Мол Ген Генет 233: 17–24.
  47. 47. Wilkinson MG, Samuels M, Takeda T, Toone WM, Shieh JC, et al.(1996) Фактор транскрипции Atf1 является мишенью для Sty1, активируемого стрессом киназного пути MAP у делящихся дрожжей. Гены Дев 10: 2289–2301.
  48. 48. Shiozaki K, Russell P (1996) Конъюгация, мейоз и реакция на осмотический стресс регулируются киназой Spc1 через транскрипционный фактор Atf1 у делящихся дрожжей. Гены Дев 10: 2276–2288.
  49. 49. Лоуренс С.Л., Маэкава Х., Уортингтон Дж.Л., Рейтер В., Уилкинсон С.Р. и др. (2007) Регуляция уровней белка Atf1 Schizosaccharomyces pombe с помощью Sty1-опосредованного фосфорилирования и гетеродимеризации с помощью Pcr1.J Biol Chem 282: 5160–5170.
  50. 50. Wang L, Griffiths K Jr, Zhang YH, Ivey FD, Hoffman CS (2005) Мутации супрессора аденилатциклазы Schizosaccharomyces pombe предполагают роль регуляции цАМФ-фосфодиэстеразы в контроле обратной связи передачи сигналов глюкозы / цАМФ. Генетика 171: 1523–1533.

Пищевой белок и азот в моче в связи с 6-летними изменениями жировой массы и безжировой массы

Датские исследования MONICA (Мониторинг тенденций и детерминант сердечно-сосудистых заболеваний) проводились под эгидой ВОЗ (Всемирной организации здравоохранения). и были подробно описаны ранее. 10 Первое обследование (под названием МОНИКА) было проведено в 1982–1983 гг. Стратифицированная по возрасту выборка лиц ( n =4807) в возрасте 30, 40, 50 и 60 лет была случайным образом отобрана из граждан, проживающих в 11 муниципалитетах западной части округа Копенгаген. Лица, не родившиеся в Дании, были исключены ( n = 226). Оставшиеся 4581 человек оказались достаточно репрезентативными для населения Дании, из которых 3608 человек (79%) приняли участие в медицинском осмотре.Оставшихся в живых лиц приглашали на два повторных осмотра, один из которых проводился в 1987–1988 гг. (под названием GENMONICA), а другой в 1993–1994 гг. (под названием MONICA10). Всего в GENMONICA за 1987–1988 гг. было обследовано 2987 человек (83%) в возрасте 35, 45, 55 или 65 лет, а в MONICA за 1993–1993–1993 гг. 1994. Рост и вес измерялись во время всех трех обследований, но BIA проводилась только в GENMONICA (1987–1988) и MONICA10 (1993–1994). Поэтому в настоящем исследовании использовалась GENMONICA (1987–1988 гг.) в качестве исходного уровня и MONICA10 (1993–1994 гг.) в качестве последующего наблюдения (см. рис. 1).Из 4807 участников MONICA (1982–1983) 552 случайных участникам было предложено принять участие в DHI в GENMONICA (1987–1988), которые были проведены у 498 и завершены у 435 участников. 11 Из них 338 субъектов также имели полную информацию о BIA как в GENMONICA (1987–1988), так и в MONICA10 (1993–1994). После исключения пищевых отклонений (> 25% энергии от алкоголя, N = 5; > 20  МДж общего потребления энергии, N = 1; <20% энергии от жира, N = 1) остался 331 человек; из-за того, что у одного человека отсутствовала информация о физической активности, в итоге для анализа данных DHI было доступно 330 человек.Из них 228 доставили проверенные и полные 24-часовые образцы мочи в GENMONICA (1987–1988), по которым можно было оценить потребление белка с пищей по азоту в моче. Один был признан выпадающим (> 20  МДж расчетный общий расход энергии (TEE)), оставив 227 субъектов для анализа потребления белка, оцененного по образцам мочи за 24 часа. Полную информацию в виде блок-схемы см. на рис. 2. Средний период наблюдения составил 5,6 года.

Рисунок 1

План исследования; обратите внимание, что второе и третье обследование когорты MONICA используются в качестве исходного уровня и последующего наблюдения, соответственно, в настоящем исследовании.

Рисунок 2

Блок-схема, показывающая выбор исследуемых популяций. BIA, анализ биоэлектрического импеданса; DHI, интервью по истории диеты.

Проект MONICA был одобрен Комитетом по этике округа Копенгаген и соответствует Хельсинкской декларации 1975 года, пересмотренной в 1983 году. Потребление белка оценивали либо по DHI, либо по образцу 24-часовой мочи.Один обученный диетолог проводил DHI всем людям. Интервью были основаны на потреблении за предыдущие 30 дней. Для получения данных о характере питания, блюдах и продуктах питания использовались предварительно закодированные формы интервью. Количество оценивалось с помощью пищевых моделей, серий фотографий, чашек и мер. Программа DANKOST, основанная на датских таблицах состава пищевых продуктов, использовалась для расчета питательных веществ. 11 Потребление белка рассчитывалось как процент энергии (E%) от общего потребления энергии, все оценивалось по DHI.Привычный рацион можно оценить, только спросив людей, что они едят, и поэтому он может быть необъективным, но среди методов оценки рациона DHI является одним из наиболее достоверных. 12

В качестве альтернативы самооценке потребления белка с пищей была проведена оценка экскреции азота с мочой. Суточная концентрация азота в моче была получена у подгруппы лиц, сообщавших о диетическом анамнезе. 11 П-аминобензойная кислота использовалась для контроля полноты и проверки образцов.Образцы мочи объемом 30 мкл анализировали на азот методом мгновенного сжигания (анализатор азота NA 1500, Ciba Corning, Медфилд, Массачусетс, США). 11 Расчетное 24-часовое потребление общего белка (грамм) (P г ) было рассчитано на основе 24-часового выхода азота в соответствии с формулой Исакссона, 13 , также использованной в предыдущем исследовании: 11

, где N – выход азота в 24-часовой пробе мочи.

Чтобы рассчитать E% белка, без использования диеты, о которой сообщали сами пациенты, был оценен TEE.Среднесуточная ТЭЭ может быть выражена как произведение базального расхода энергии (BEE) и уровня физической активности (PAL). BEE рассчитывали по формуле Garby et al. 14 , использованный в предыдущем исследовании: 11

, где BEE — базальный расход энергии (Дж/24 ч), BW — масса тела (кг) и FM — масса жира (кг). PAL оценивали по сочетанию пола, физической активности в свободное и рабочее время (см. Ковариаты): 1,55 (мужчины) и 1.56 (женщины) для тех, кто был безработным или с работой, классифицируемой как сидячая, и которые либо сидели большую часть времени, либо занимались легкой деятельностью в свободное время. Из них 1,78 (мужчины) и 1,64 (женщины) для тех, чья работа классифицировалась как легкая деятельность или ходьба/переноска и которые большую часть времени либо сидели, либо занимались легкой деятельностью в свободное время. Из них 2,10 (мужчины) и 1,82 (женщины) для тех, кто занимается тяжелым физическим трудом или активно занимается спортом не менее 3 часов в неделю, либо занимается тяжелым трудом в свободное время, либо несколько раз в неделю занимается спортивными состязаниями. 11

Для расчета доли энергии, получаемой за счет пищевого белка, от 24-часового азота мочи и общего расхода энергии ( P p), использовалась следующая формула:

, где P г Общее потребление белка за 24 часа (в граммах), TEE — это общий расход энергии (как объяснено выше), а P E — энергия от потребления белка за 24 часа (кДж). Энергетический эквивалент для сжигания белка составляет 17 кДж г -1 .

Дополнительную информацию о потреблении белка, полученном из DHI или 24-часового содержания азота в моче, и об общем расходе энергии см. в другом месте. 11

Исходы

Изменения BW, FM и FFM между исходным уровнем и последующим наблюдением использовались в качестве исходов настоящего исследования. Поскольку рост коррелирует с BW, FM и FFM, изменения индекса массы тела (ИМТ), индекса FM (FMI) и индекса безжировой массы (FFMI) также использовались в качестве исходов, каждый из которых рассчитывался путем деления на квадрат роста в метрах (ИМТ). : BW/H 2 , FMI: FM/H 2 , FFMI: FFM/H 2 ; единица измерения: кг м −2 ).Изменение рассчитывали путем вычитания исходного измерения из соответствующего последующего измерения. Поскольку время наблюдения у разных участников было разным, средние изменения за год (далее именуемые «годовые изменения») были рассчитаны для оптимизации сопоставимости. Годовые изменения были рассчитаны путем деления изменения между исходным уровнем и последующим наблюдением на время последующего наблюдения (МТ, FM и FFM, единица: кг в год; ИМТ, FMI, FFMI, единица: кг м -2 в год). .

Антропометрические измерения выполнены в соответствии со стандартами ВОЗ.Рост измеряли с точностью до 0,5 см, когда испытуемые стояли без обуви, пятки вместе, а голова находилась в горизонтальной Франкфуртерской плоскости. Масса тела измерялась с точностью до 0,1 кг, участники были одеты только в больничное белье. 10 BIA выполняли с субъектами, лежащими расслабленно на кушетке, конечности слегка отведены от тела, с использованием тетраполярного размещения электродов. Электроды помещали на дорсальные поверхности правой руки и стопы, на дистальные отделы пястных и плюсневых костей соответственно, а также между дистальными выступами лучевой и локтевой костей на запястье и медиальными и латеральными лодыжками на лодыжках. 11 Анализатор системы RJL BIA-103 (RJL-Systems, Детройт, Мичиган, США) использовали для измерения электрического импеданса в соответствии с инструкциями производителя. Точность BIA зависит от того, насколько точным является основное уравнение предиктора. Используемое прогностическое уравнение было специально разработано и проверено для использования в популяции MONICA: 15

, где FM — масса жира (кг), BW — масса тела (кг), I M — индикаторная функция для мужчина, A — возраст (г), H — рост (см) и R — сопротивление (Ом). 16 Затем FFM был оценен путем вычитания FM из BW (FFM=BW-FM).

Ковариаты

Физическая активность в свободное время (четыре группы: сидя большую часть времени; легкая активность не менее 4 часов в неделю; активный спорт не менее 3 часов в неделю или тяжелая работа во время отдыха; участие в спортивных соревнованиях несколько раз в неделю ) и на работе (пять групп: без работы, большую часть времени сидя, легкая активность, ходьба, ходьба и переноска большую часть времени, тяжелая физическая работа). 10 Эти две переменные были закодированы в одну переменную с тремя категориями: (1) отсутствие работы или работа, о которой сообщалось, что большую часть времени она сидит, а деятельность в свободное время, о которой сообщалось, либо сидела большую часть времени, либо занималась легкой деятельностью, (2 ) Работа, указанная как легкая активность, или ходьба/перенос одежды, а также деятельность в свободное время, указанная либо как сидячая большая часть времени, либо как легкая деятельность, (3) Работа, указанная как напряженная физическая работа, или деятельность в свободное время, указанная как активная деятельность в спорте не менее 3  га неделю или тяжелая работа в свободное время или активное участие в спортивных состязаниях несколько раз в неделю.

Информация о привычке к курению табака была включена в DHI. Курение измерялось в граммах табака, потребляемых в день, а некурящие кодировались как 0  г в день. Уровни школьного образования участников были получены за 5 лет до исходного уровня, первоначально охватывая 14 категорий и здесь закодированные в две группы: более 7 лет обучения или 7 лет обучения или менее.

Статистический анализ

Для изучения различий между подвыборками лиц, включенных в настоящее исследование, и остальной популяцией MONICA, не включенной в настоящее исследование, были изучены различия в доступных основных переменных исходных характеристик (возраст, ИМТ, вес, образование, пол и физическая активность).Точно так же подгруппа участников с образцами мочи и DHI сравнивалась с участниками только с DHI в отношении исходных характеристик. Критерии Стьюдента t использовались для непрерывных переменных, а х 2 -критерии использовались для категориальных переменных.

Для оценки корреляций между измерениями сообщаемого общего потребления энергии и расчетными общими расходами энергии, а также между измерениями потребления белка, сообщаемого DHI, и потребления белка, полученного из азота в моче, был проведен корреляционный анализ среди людей с образцами мочи и с DHI.

Множественный линейный регрессионный анализ был использован для изучения связи между потреблением белка и последующим ежегодным изменением состава тела с использованием моделей замещения энергии макронутриентами. Поскольку общее потребление энергии представляет собой сумму энергии макронутриентов (белков, углеводов, жиров и алкоголя), можно оценить потребление энергии одного макронутриента, если известно потребление энергии других макронутриентов, а также общее потребление энергии. . Точно так же можно оценить относительное потребление энергии (в процентах от общего потребления энергии) одного макронутриента, если известно относительное потребление энергии других макроэлементов.Исходя из этого, были получены модели замещения энергии макронутриентами путем включения в регрессионную модель относительного потребления энергии за счет белков, алкоголя и потребления жиров или углеводов. Интерпретация соответствующих оценочных коэффициентов регрессии может быть интерпретирована как результат замены 1 единицы соответствующего источника питания (здесь 1 E% белка) на 1 единицу пропущенного макронутриента. Кроме того, была проведена модель, в которой белок заменял другие макроэлементы без определения конкретного источника.Здесь белок как E% был включен в регрессионную модель, в то время как другие макроэлементы (алкоголь, жир и углеводы) были исключены. В дальнейшем это называется моделью неспецифического замещения. Для получения дополнительной информации о модели замещения см. Приложение 1 в дополнительных материалах. При анализе потребления белка, полученного из азота в моче, информация из DHI не была включена, поскольку в модели не было других макронутриентов, что привело к интерпретации, аналогичной описанной выше модели неспецифического замещения.

Чтобы скорректировать возможные искажения, в модели были включены следующие ковариаты: пол, возраст (непрерывно), PAL (три категории), уровень образования (две категории), курение (непрерывно) и исходный уровень исследуемого воздействия ( например, если исследовались ежегодные изменения FM, корректировались базовые значения FM).

Нелинейность подогнанных эффектов была протестирована путем включения квадратичного члена воздействия (белок из DHI и азот, полученный из мочи, соответственно).Соответствующие тесты оказались незначимыми для всех моделей (все P >0,17, дополнительная таблица S1), поэтому более простые модели были сохранены.

Поскольку участники исследования MONICA потребляли довольно много алкоголя, аналогичные анализы были проведены после исключения лиц, сообщивших о >10% энергии от алкоголя, чтобы проверить, повлияло ли это на результаты.

Используя метод расстояния Кука 17 , который учитывает как размер невязки, так и влияние на коэффициент регрессии, в множественном регрессионном анализе были идентифицированы кандидаты-выбросы.Чтобы исследовать влияние выбросов на результаты, все модели были снова проанализированы после исключения 5 и 10 кандидатов-выбросов соответственно.

В качестве субанализа взаимосвязь пола и потребления белка в отношении результатов также была исследована в моделях замещения неспецифических энергетических макронутриентов.

Проверка гипотезы была основана на двусторонних областях отклонения, и для объявления значимости был использован соответствующий пороговый критерий P P <0,05.Анализы проводились с помощью Stata 12.1 (StataCorp, Колледж-Стейшн, Техас, США; www.stata.com).

Анализ конвергенции загрязнения атмосферного воздуха диоксидом азота для 179 стран Ю Сан Чанг, Ю-Тэк Ли, Юнджи Ли :: SSRN

Серия рабочих документов Gachon Center of Convergence Research, 2018-06

37 страниц Опубликовано: 23 августа 2018 г.

Посмотреть все статьи Ю Сан Чанг