4 впр сайт: ВПР-2022 — 19 Августа 2021

Содержание

МБОУ «СОШ № 5» г. Усинска

Официальный сайт ВПР (ФИОКО) — https://fioco.ru/ осуществляет информационное сопровождение всероссийских проверочных работ под руководством Рособрнадзора.

На сайте размещены образцы и описания всероссийских проверочных работ по всем предметам с ответами и критериями оценивания, различная информация о ВПР: план графики, порядок проведения, официальные документы.

Кроме того, в разделе «Услуги ФГБУ «ФИОКО»» представлены издательства, получившие положительную экспертную оценку по тематике ВПР.

ДОРОЖНАЯ КАРТА

Приказ № 721 Об организации участия во Всероссийских проверочных работах

Расписание ВПР 2022

График проведения ВПР 2022

Приказ Рособрнадзора №1139 о проведении ВПР в 2022 году

Что такое ВПР

ВПР – это новый вид проверки знаний по различным предметам учеников средних и старших классов.

Впервые тестирование провели в 2015 году. С тех пор, работа проводится ежегодно.

С каждым годом количество участников ВПР возрастает.

Участниками Всероссийских проверочных работ (ВПР), которые прошли весной 2018 года, стали более 4,7 миллиона школьников из 40,5 тысяч школ всех регионов России; всего в течение марта-мая ими было написано более 16 миллионов проверочных работ по различным предметам. 

Цели проведения ВПР

Цель ВПР – обеспечение единства образовательного пространства Российской Федерации и поддержки введения Федерального государственного образовательного стандарта за счет предоставления образовательным организациям единых проверочных материалов и единых критериев оценивания учебных достижений.

Всероссийские проверочные работы не являются итоговой аттестацией

 обучающихся, а представляют собой аналог годовых контрольных работ, традиционно проводившихся ранее в школах. Они позволяют определить количество и уровень знаний, которые были получены в течение учебного года.

Как использовать результаты ВПР

Результаты ВПР ни в коей мере не влияют на перевод в следующий класс и на получение аттестата.

Результаты ВПР нужны для:

— самооценки школ;

— выявления пробелов в знаниях учащихся;

— помощи учителям и родителям в организации работы с каждым школьником;

— мониторинга уровня образования в стране.

Помимо предметных умений, все задания ВПР предполагают проверку различных видов универсальных учебных действий: регулятивных (адекватно самостоятельно оценивать правильность выполнения действия и вносить необходимые коррективы) и 

познавательных (осуществлять логические операции, устанавливать причинно-следственные связи).

Для обучающихся и их родителей ВПР будут полезны с точки зрения определения уровня их подготовки, выявления проблемных зон, планирования индивидуальной образовательной траектории обучающегося.

Для школы ВПР может быть инструментом самодиагностики, основой для проведения регулярной методической работы.

Как узнать результаты ВПР и на что они влияют

Проверка работ ВПР начинается с создания комиссии из учителей, работающих в общеобразовательной организации в других классах.

Используя критерии оценивания, присылаемые в учебное заведение с официального сайта, комиссия проверяет каждую работу и выставляет общее количество первичных баллов каждому ученику. После этого заполняются таблицы без указания фамилии участника ВПР. Каждому ученику присвоены идентификационные номера. Сводная ведомость отправляется на официальный сайт.

Примерно через неделю в образовательное учреждение присылается ведомость с указанием оценки за ВПР в соответствии с общим количеством набранных баллов. Результат выполнения своей работы можно узнать в образовательной организации, куда приходят результаты.

Таким образом, зная свой идентификационный номер, можно узнать отметку, выставленную за проверочную работу.

ПАМЯТКА ДЛЯ РОДИТЕЛЕЙ

Всероссийские проверочные работы – это контрольные работы по различным учебным предметам.

Цель проведения ВПР – определение уровня подготовки по учебным предметам школьников во всех регионах России вне зависимости от места нахождения школы, от статуса школы.

Задания и критерии оценивания ВПР едины для всех школьников страны. Уровень сложности – базовый, то есть не требует специальной подготовки, достаточно ходить в школу на уроки.

ВПР проводятся на школьном уровне, продолжительность от одного до двух уроков.

Проверка работ участников ВПР осуществляется в день проведения работы учителями школы. После проверки результаты вносятся в единую информационную систему, с данными которой могут работать эксперты.

ВПР пройдут в апреле, они не будут пересекаться по срокам с проведением ЕГЭ.

ВПР не проводятся во время каникул или после уроков.

Что дадут ВПР

Ежегодное тестирование в результате:

  • позволит проверить объем и качество знаний, полученных в течение года
  • поставит перед необходимостью школьников систематически заниматься на протяжении всего учебного процесса, а не только в выпускных классах
  • поможет увидеть недостатки учебной программы по экзаменационным дисциплинам
  • позволит родителям понять общую картину знаний ученика
  • поможет усовершенствовать региональную систему образования
  • создаст целостную картину уровня подготовки школьников в стране.

Важно знать, что результаты ВПР не повлияют:

  • на итоговые годовые оценки
  • получение аттестата
  • перевод в следующий класс.

Как подготовиться к ВПР

  • главная задача родителей – убедить ребенка, что если не запускать учебу на протяжении всего учебного года, то не будет проблем с подготовкой к ВПР
  • обратить внимание на предметы, которые оказались самыми трудными предметами Всероссийских проверочных работ: русский язык, история, биология, география, физика, химия
  • поинтересоваться результатами своего ребенка, постараться получить информацию об имеющихся у него проблемах и планах школы по устранению этих проблем
  • не оставлять подготовку к ВПР на последние месяцы зимы. Если вы не уверены в знаниях детей, лучше открыть демоверсию ВПР на сайте ФИОКО и познакомиться с заданиями
  • соблюдение правильного режима труда и отдыха поможет ученику физически и психологически подготовиться к проведению ВПР

 

ВПР (всероссийские проверочные работы) | МОБУ СОШ № 89 г. Сочи имени Героя Советского Союза Жигуленко Е.А.

ВПР в 2021 году будут проходить в обязательном порядке во всех российских школах. Всероссийские проверочные работы введены на территории России с 2015-го года, и на данный момент их пишет подавляющее большинство учеников. ВПР призваны выявлять и оценивать не только знания школьников, но и качество подачи материалов, квалификацию преподавателей и особенности образовательного процесса. Ниже рассматриваются все нюансы проведения работ в 2021 учебном году.

График проведения ВПР в 2021-2022

Классы Предметы
4-е Математика, окружающий мир, русский язык.
5-е Русский язык, биология, математика, история.
6-е Русский язык, история, математика, биология, обществознание, география.
7-е Русский и иностранный языки, история, физика, биология, география, математика, обществознание.
8-е Такие же предметы, как и в 7-х классах, но вместо ВПР по иностранному языку проводятся проверки по химии.
9-е Пока информация отсутствует, так как решение об обязательном написании ВПР девятиклассниками на 2021 год еще не принято.
10-е Всего один предмет – география. А в некоторых школах ВПР по данному предмету пишутся в 11-х классах.
11-е Химия, биология, физика, история, иностранный язык, география.

Такие дисциплины стандартные и единые для всех школ, то есть ученики и руководства общеобразовательных учреждений никак не влияют на выбор.

Формат ВПР в 2022-ом году останется прежним. Каждому ученику будут выдаваться задания на бумажных носителях, количества задач зависят от дисциплины и класса. В начале обычно прописываются правила написания работы и рекомендации для учеников. Потом идут непосредственно задания с описаниями условий и полями для ответов, а также для решений (если они требуются и должны быть подробными).

На написание отводится определенное время: для учеников младших классов – один полный урок (45 минут), для школьников среднего звена – час (60 минут), а для старшеклассников – полтора часа, то есть 90 минут. По прошествии данного временного периода все должны сдать работы.

Учащиеся пишут ВПР в стенах своих школ, за ними наблюдают педагоги, контролирующие соблюдение правил выполнения заданий и выявляющие попытки списывания, подсказок или использования литературы либо смартфонов. На столах могут присутствовать только непосредственно задания, канцелярские принадлежности, черновик и иногда дополнительные приспособления (измерительные и вычислительные приборы – калькуляторы, линейки).

Критерии оценивания также остаются прежними: за каждое верно выполненное задание присваиваются баллы. В некоторых школах они переводятся в стандартные привычные оценки. Но результаты ВПР никоим образом не влияют на итоговые четвертные и годовые показатели, также они не учитываются в аттестатах.

К сведению! Для ознакомления можно посмотреть варианты заданий за прошлые годы или даже опробовать демо-версии для самостоятельной предварительной проверки собственных знаний (примеры есть на сайте 

4vpr.ru).

Все же некоторые корректировки в ход проверочных всероссийских работ вноситься будут, и они касаются состава заданий. Теперь для всех школ начнут подготавливаться отдельные персональные комплекты, которые будут генерироваться случайным образом непосредственно перед проведением. Это исключит возможность выяснения правильных ответов у учащихся других общеобразовательных учреждений, написавших работы ранее.

Определены временные интервалы для разных классов:

  • 4-е классы сдают математику и окружающий мир с 13-го по 24-е апреля, а русский язык – с 30-го марта по 10-е апреля.
  • Учащиеся пятых классов будут писать работы по биологии с историей в период с 30-го марта по 10-е апреля, а по русскому с математикой – с 13-го по 24-е апреля.
  • В шестых классах аттестации по биологии, географии и истории пройдут в период с 30-го марта по 10-е апреля, а по русскому языку, обществознанию и математике – с 13-го апреля по 24-е.
  • Ученики из 7-х классов в промежуток между 30-м марта и 10-м апреля напишут ВПР по обществознанию, биологии, а также иностранному и русскому языкам. А с 13-го по 24-е апреля будут проходить тестирования по остальным дисциплинам – истории, химии, математике и физике.
  • В 8-х классах работы пройдут в определенные фиксированные даты, которые пока не известны.
  • Для 9-х классов расписание пока не определено.
  • Учащиеся 10-х классов будут сдавать географию со второго марта по шестое.
  • Выпускникам 11-х классов предложат сразу три временных интервала: со 2-го по 6-е марта – для географии и иностранного языка, с 10-го по 13-е марта – для химии и истории, с 16-го по 20-е марта – для биологии и физики.

Некоторые интервалы охватывают сразу несколько дисциплин, и ВПР по разным предметам могут писаться как в один день, так и в разные. Расписания с точными числами определяются на местах, и выяснять их следует непосредственно в школах в течение 2021-2022 учебного года.

Официальный сайт ВПР 2021 для 4, 5, 6, 7, 8 классов — сайт института оценки качества образования ФИОКО.

Здесь размещены демонстрационные задания с ответами и критериями оценивания, различная информация о ВПР: план графики, порядок проведения, официальные документы и др.

Официальный сайт ВПР  (СтатГрад) — www.eduvpr.ru — осуществлял информационное сопровождение всероссийских проверочных работ под руководством  Рособрнадзора в период с 2015 — 2018 год.

Здесь, пока можно найти материалы прошлых лет: образцы, описания и д.т.

На сайте ФИОКО размещена информация для 4, 5, 6, 7, 8 классов.

Задания ВПР для 11 классов размещены на сайте ФИПИ.

МБОУ СОШ № 4 г.Рассказово

Всероссийские проверочные работы


ВПР 2022

Порядок проведения ВПР в 2022 году

График проведения ВПР в 2022 году

Образцы и описания проверочных работ для проведения ВПР в 2022 году

Приказ №121 от 28.02.2022 г. «Об утверждении Порядка проведения всероссийских проверочных работ в 2022 году»

Приказ №122 от 28.02.2022 г. «Об утверждении Графика проведения всероссийских проверочных работ в 2022 году»

joomlamodniyportal. ru

ВПР 2021

Что нужно знать родителям, чтобы не волноваться перед ВПР:

https://obraz.tmbreg.ru/component/k2/item/6678-chto-nuzhno-znat-roditelyam-chtoby-ne-volnovatsya-pered-vpr-rasskazala-elena-saltsberg-nachalnik-otdela-otsenki-kachestva-obrazovaniya-togku-tsentr-ekspertizy-obrazovatelnoj-deyatelnosti.html

Календарь ВПР 2021

Буклет для родителей о ВПР 2021

Особенности проведения ВПР 2021

  • Приказ Рособрнадзора от 11.02.2021г. №119
  • О проведении всероссийских проверочных работ в4-8, 10-11 классах в 2021 году
  • Порядок проведения ВПР в МБОУ СОШ №4 в 2021 году
  • График проведения ВПР в МБОУ СОШ №4 в 2021 году

  • ВПР 2020

    Федеральной службой по надзору в сфере образования и науки определен период проведения всероссийских проверочных работ. Планируется проведение ВПР по программе предыдущего года обучения с 14 сентября по 12 октября 2020 года.

    Образовательные организации сами составляют график проведения проверочных работ в рамках данного периода. Для обучающихся 5-8 классов проверочные работы являются обязательными, в 9 классах ВПР проводятся в режиме апробации по решению образовательной организации.

    Проведение ВПР осенью позволит определить, как повлияло на уровень подготовки школьников дистанционное обучение и досрочное окончание занятий в учебном году. Полученные результаты определят имеющиеся дефициты и позволят выстроить работу школы по учебным предметам с учетом того, какой материал надо повторить.

    Варианты работ по всем предметам и классам будут генерироваться автоматически из банка оценочных средств ВПР. Таким образом, для каждой школы варианты станут индивидуальными.

    Результаты ВПР важны для школ, учителей и родителей школьников, чтобы понять, какие пробелы есть в подготовке учащихся и с чем нужно дополнительно поработать. Поэтому проведение такого мониторинга осенью сохранит свою актуальность. Не предполагается оценивание ВПР по 5-балльной шкале.

  • Приказ Рособрнадзора №821 от 05.08.2020г.
  • Приказ МБОУ СОШ №4 №285 от 28.08.2020г.Об участии в проведении ВПР
  • Важная информация: ВПР для 4–8 классов переносятся на осень.

    В начале учебного года их напишут ученики, перешедшие в 5–9 классы.

    Образцы всероссийских проверочных работ 2020


  • Советы психолога для родителей
  • Презентация «Общешкольное родительское собрание»
  • МБОУ СОШ №120 Нижний Новгород

    Всероссийские проверочные работы  (ВПР)

    Всероссийские проверочные работы (ВПР) проводятся ежегодно для 4-11 классов.

    Работы пройдут в 4-10 классах с 15 марта по 21 мая по решению образовательной организации, в 11 классе с 1 по 26 марта.

    Всероссийские проверочные работы (ВПР) – это комплексный проект в области оценки качества образования, направленный на развитие единого образовательного пространства в Российской Федерации, мониторинг введения Федеральных государственных образовательных стандартов (ФГОС), формирование единых ориентиров в оценке результатов обучения, единых стандартизированных подходов к оцениванию образовательных достижений обучающихся. Указанные цели достигаются за счет проведения ВПР в единое время по единым комплектам заданий, а также за счет использования единых для всей страны критериев оценивания.

    Цели проведения ВПР
    ВПР проводятся в целях:
    -осуществления мониторинга системы образования, в том числе мониторинга уровня подготовки обучающихся в соответствии с федеральными государственными образовательными стандартами, федеральным компонентом государственного
    стандарта общего образования;
    -совершенствования преподавания учебных предметов и повышения качества образования в образовательных организациях.

    Участники ВПР
    Участниками ВПР по каждому учебному предмету являются все обучающиеся соответствующих классов всех образовательных организаций Российской Федерации, реализующих программы начального общего, основного общего и/или среднего общего образования.

    Официальный сайт поддержки ВПР

    Приказ Рособрнадзора №1139 от 16.08.2021«О проведении Федеральной службой по надзору в сфере образования и науки мониторинга качества подготовки обучающихся общеобразовательных организаций в форме всероссийских проверочных работ в 2022 году»

    План-график проведения всероссийских проверочных работ в 2022 году

    Порядок проведения ВПР в 2022 году

    Приказ МБОУ «Школа №120»  от 15.03.2021 №47-о «Об участии в проведении Всероссийских проверочных работ в 2020-2021 учебном году»

    Горячая линия по вопросам организации и проведения ВПР. По вопросам организации и проведения ВПР, по информационно-методическому сопровождению проведения всероссийских проверочных работ в 2021 году работает горячая линия: МБОУ «Школа №120» с понедельника по пятницу с 13.

    00 до 16-00 с 23 марта по 21 мая 2022 года

    252-89-91 Сабирова Юлия Николаевна 4-11 классы
    Региональная телефонная «горячая линия»  по телефону в период с 23 марта по 21 мая 2021 г. ежедневно с 9:00 до 17:00 кроме субботы, воскресенья и праздничных дней (тел. 8 (831) 274-69-73).

    Все демоверсии ВПР 2022 для 4-11 классов

    4 класс (демоверсия)

    5 класс (демоверсия)

    6 класс (демоверсия)

    7 класс (демоверсия)

    8 класс (демоверсия)

    11 класс (демоверсия)

    Материалы для подготовки к ВПР

    «Не волноваться!: как школам, ученикам и их родителям готовиться к ВПР»    (ссылка: https://ria.ru/sn_edu/20181011/1530355824.html ).

    МАОУ СОШ № 8 Ртищево

    Основное меню
    Учебная работа
    Воспитательная работа
    Категории раздела
    Статистика

    Онлайн всего: 1

    Гостей: 1

    Пользователей: 0

    Календарь

    Официальный сайт ВПР  для 4, 5, 6, 7 классов — сайт института оценки качества образования ФИОКО.   Здесь размещены демонстрационные задания с ответами и критериями оценивания, различная информация о ВПР: план графики, порядок проведения, официальные документы и др.

    2021 — 2022 учебный год

    Утверждено расписание Всероссийских проверочных работ на 2022 год.

    → Приказ №1139 от 16.08.2021

    В школах региона стартовали Всероссийские проверочные работы

    С 1 марта в школах Ртищевского района начинают писать ВПР. Начнется проведение ВПР в 2022 году с проверочных работ для 10 и 11 классов.

    С 1 марта по 25 марта десятиклассники будут сдавать географию. Одиннадцатиклассники – историю, биологию, географию, физику, химию и иностранные языки (английский, немецкий).

    В соответствии с утвержденным расписанием в штатном режиме с 15 марта по 20 мая 2022 года ученики всех классов каждой параллели 4-8 классов напишут проверочные работы по русскому языку и математике.

    В этот же период четвероклассники, помимо русского языка и математики, сдадут ВПР по предмету «Окружающий мир», а ученики 5-х классов  - по биологии и истории.

    С 1 апреля по 20 мая учащихся 7 классов ждет мониторинг качества подготовки по английскому и немецкому языкам. Также с 15 марта по 20 мая для параллелей 6,7 и 8 классов пройдут ВПР по истории, биологии, географии, обществознанию, 7 и 8 классов – по истории, биологии, географии, обществознанию и физике, 8 классов – по истории, биологии, географии, обществознанию.

    Новости от 22 марта 2022 года  

    В целях снижения рисков распространения новой коронавирусной инфекции COVID-19 Рособрнадзором по согласованию с Правительством Российской Федерации было принято решение о переносе сроков проведения всероссийских проверочных работ с весны на осень 2022 года.
     

    Их планируется провести с 19 сентября по 24 октября 2022 года. Новое расписание будет сформировано до 5 сентября этого года.
    «Всероссийские проверочные работы – мероприятие, в котором принимают участие очень большое число людей: школьников и учителей. Для предотвращения очередного увеличения числа заболевших, особенно среди детей и подростков, нами было принято решение о переносе этой процедуры. Отмечу, что те школы, что уже провели ВПР, не будут писать их повторно. Достаточно будет корректно внести их результаты в соответствующую систему» — отметил глава Рособрнадзора Анзор Музаев.
    ВПР, запланированные для проведения в компьютерной форме (иностранные языки в 7 классе, история, биология, география, обществознание в 5-8 классах), также переносятся на осень 2022 года.

    Информация о проведении ВПР осенью 2022 года будет направлена в органы исполнительной власти субъектов Российской Федерации, осуществляющие государственное управление в сфере образования, дополнительно.

    2020 — 2021 учебный год

    Документы:

    План мероприятий («дорожная карта) по реализации образовательных программ начального общего и основного общего образования в МАОУ «СОШ № 8» на основе результатов ВПР, проведенных в сентябре-октябре 2020 г.

    УТВЕРЖДЕНО РАСПИСАНИЕ ВПР НА 2021 ГОД 

    ВПР пройдут для обучающихся 4-8 классов в штатном режиме, для обучающихся 11 классов – по решению школы.
    Конкретные даты проведения ВПР для каждого класса и предмета школы определят самостоятельно в рамках установленного расписанием периода.
    Начнется проведение ВПР в 2021 году с проверочных работ для 11 классов. Они пройдут по истории, биологии, географии, физике, химии и иностранным языкам (английскому, немецкому или французскому) в период с 1 по 26 марта. ВПР по географии школы могут провести для 11 или 10 классов в зависимости от своего учебного плана. 
    С 15 марта по 21 мая пройдут ВПР для 4 классов (по русскому языку, математике и окружающему миру),
    5 классов (русский язык, математика, история, биология),
    6 и 8 классов (русский язык и математика),
    7 классов (русский язык, математика, история, биология, география, обществознание, физика).
    Эти проверочные работы пройдут для всех классов в параллели.
    Также в обязательном порядке все семиклассники напишут с 1 апреля по 21 мая ВПР по иностранному языку (английскому, немецкому или французскому).
    Обучающиеся 6 и 8 классов с 15 марта по 21 мая напишут ВПР еще по двум предметам на основе случайного выбора. Шестиклассникам могут встретиться ВПР по истории, биологии, географии или обществознанию, восьмиклассникам – по истории, биологии, географии, обществознанию, химии или физике. Информация о распределении предметов по классам в каждой параллели будет направлена школам через их личные кабинеты.
    ВПР рекомендуется проводить на 2-4 уроках. Время, отведенное на написание проверочной работы по разным предметам и классам, будет указано в инструкции по их выполнению.

    2019 — 2020 учебный год

    Проведение всероссийских проверочных работ (ВПР) для учащихся 4-8 классов перенесено

    на осень 2020 года, планируется, что они пройдут в сентябре-октябре (ссылка).

    Проведение Всероссийских проверочных работ будет перенесено с конца этого учебного года на осень.
    Об этом Министр просвещения Сергей Кравцов заявил сегодня в ходе брифинга, посвящённого изменениям в вопросах оценки качества общего образования в 2019/2020 учебном году.
    Решение о переносе сроков проведения ВПР было принято по итогам консультаций с педагогами, регионами, представителями образовательного сообщества и родительским сообществом. Министр просвещения подчеркнул, что ВПР – это не формальная аттестация самих школьников: их результаты нужны для корректировки образовательного процесса.
    Оценки за ВПР выставляться не будут. «Такая диагностика должна показать уровень знаний школьников и выявить возможные пробелы в знаниях.
    После проведения этих диагностических процедур школы, учителя получат соответствующие рекомендации, и будет выстроена необходимая методическая работа. К этой работе мы привлечём педагогические вузы, институты повышения квалификации, методические службы. Она будет координироваться Министерством просвещения», – рассказал Министр.


    Задания ВПР для 11 классов размещены на сайте ФИПИ.

    Подготовка к ВПР 2020

    Решу ВПР


    Документы:

    Письмо Рособрнадзора от 22.05.2020 г. № 14-12 о проведении ВПР в 5-9 классах осенью 2020 года

    Приказ Рособрнадзора от 06.05.2020 г. № 567 О переносе сроков всероссийских проверочных работ

    Приказ от 17.03.2020 г. № 313 «О внесении изменений в приказ Рособрнадзора от 27 декабря 2019 г. № 1746 «О проведении Рособрнадзором мониторинга качества подготовки обучающихся школ в форме ВПР в 2020 г.»»

    Приказ от 18.12.2019 г. «Об осуществлении мониторинга системы образования в части результатов национальных и международных исследований качества образования и иных аналогичных оценочных мероприятий….»

    Приказ Рособрнадзора от 27.12.2019 г. № 1746 «О проведении мониторинга качества подготовки обучающихся общеобразовательных организаций в форме ВПР в 2020 году»


    В 2020 году всероссийские проверочные работы проводятся в 4-7 классах в штатном режиме, в 8, 11(10) классах — в режиме апробации (ссылка).

    Сроки проведения: 2 марта — 24 апреля 2020 года.

    Федеральная служба по надзору в сфере образования и науки (Рособрнадзор) утвердила график проведения мониторинга качества подготовки обучающихся общеобразовательных организаций в форме всероссийских проверочных работ в 2020 году.  Участие в ВПР учащихся 4,5, 6 и 7 классов обязательно.

    В 2020 году проверочные работы для 8 и 11 классов проводятся в режиме апробации.

    Варианты работ для всех классов (кроме восьмых) каждой школы будут формироваться автоматически из банка заданий ВПР.

    Всероссийские проверочные работы (ВПР) – это контрольные работы по различным предметам, проводимые для школьников всей страны. ВПР учащиеся пишут в своих школах.

    ВПР не являются государственной итоговой аттестацией. Они проводятся школами самостоятельно, с использованием единых вариантов заданий для всей Российской Федерации, разрабатываемых на федеральном уровне, которые должны дать возможность оценить учебные результаты обучающихся по единым критериям.

    ПУШКИНСКАЯ КАРТА
    Календарь новостей
    Архив записей
    ПДО

    Официальный сайт МБОУ СОШ №4 г.Сорочинск

    2021-2022 учебный год

    Приказ Федеральной службы по надзору в сфере образования и науки от 16.08.2021 году №1139 «О проведении Федеральной службой по надзору в сфере образования и науки мониторинга качества подготовки обучающихся общеобразовательных организаций в форме всероссийских проверочных работ в 2022 году»

    Рекомендации для родителей

    Образцы и описания проверочных работ для проведения ВПР в 2021 году

    Буклет для родителей

    ИНФОРМАЦИОННЫЙ БУКЛЕТ ДЛЯ ОБРАЗОВАТЕЛЬНЫХ ОРГАНИЗАЦИЙ 

    ИНФОРМАЦИОННЫЙ БУКЛЕТ ДЛЯ РОДИТЕЛЕЙ

    ИНФОРМАЦИОННЫЙ ПЛАКАТ ВПР

     

    Федеральная служба по надзору в сфере образования и науки информирует о проведении в марте-апреле 2021 года оценки качества образования — Всероссийских проверочных работ (далее — ВПР).

    ВПР проводятся в форме контрольных работ. Тексты ВПР разрабатываются в соответствии с требованиями ФГОС с учетом примерных образовательных программ. Проверочные работы приближены к традиционным контрольным работам без тестовой части.

    Результаты ВПР не будут учитываться при выставлении годовых отметок по предметам или при получении аттестата о среднем общем образовании.

    Демонстрационные материалы

    2020-2021 учебный год

    В целях исполнения поручений Президента Российской Федерации по итогам совещания от 10.06.2020 Пр-955 «О ситуации в системе образования в условиях распространения новой короновирусной инфекции», в соответствии с приказом Федеральной службы по надзору в сфере образования и науки от 05.08.2020 №821 «О внесении в приказ Федеральной службы по надзору в сфере образования и науки от 27.12.2019 №1746 «О проведении Федеральной службой по надзору в сфере образования и науки мониторинга качества подготовки обучающихся общеобразовательных организаций в форме всероссийских проверочных работ в 2020 году»,  для обучающихся 5-9 классов с 14 сентября по 12 октября 2020 года в образовательных организациях округа будут проведены Всероссийские проверочные работы.

    Даты проведения работ определяются образовательными организациями самостоятельно в рамках указанного периода. Работа по учебному предмету проводится на 2-4 уроках одновременно для всех классов в параллели. Варианты контрольных измерительных материалов формируются для каждой школы индивидуально из банка заданий ВПР. Передача КИМ ВПР из одной образовательной организации в другую запрещается.

    СОВЕТЫ ДЛЯ ДЕТЕЙ

    ПРИКАЗ министерства образования Оренбургской области №01-21/1208 от 08.09.2020 года «О проведении всероссийских проверочных работ в сентябре-октябре 2020 года»

    ПРИКАЗ управления образования №328 от 07.09.2020 года «О проведении всероссийских проверочных работ в сентябре-октябре 2020 года»

    ФИОКО опубликовал проект расписания ВПР-2021 (fioco.ru/ru/osoko/vpr/). В процедуру проведения ВПР в 2021 году внесли изменения.

    Рекомендации для родителей

    Образцы и описания проверочных работ для проведения ВПР в 2021 году

    Буклет для родителей

    ИНФОРМАЦИОННЫЙ БУКЛЕТ ДЛЯ ОБРАЗОВАТЕЛЬНЫХ ОРГАНИЗАЦИЙ 

    ИНФОРМАЦИОННЫЙ БУКЛЕТ ДЛЯ РОДИТЕЛЕЙ

    ИНФОРМАЦИОННЫЙ ПЛАКАТ ВПР

     

    Федеральная служба по надзору в сфере образования и науки информирует о проведении в марте-апреле 2021 года оценки качества образования — Всероссийских проверочных работ (далее — ВПР).

    ВПР проводятся в форме контрольных работ. Тексты ВПР разрабатываются в соответствии с требованиями ФГОС с учетом примерных образовательных программ. Проверочные работы приближены к традиционным контрольным работам без тестовой части.

    Результаты ВПР не будут учитываться при выставлении годовых отметок по предметам или при получении аттестата о среднем общем образовании.

     

     

    Демонстрационные материалы

    Всероссийские проверочные работы (ВПР)

         Что такое ВПР?

         Всероссийские проверочные работы (далее ВПР) — это контрольные работы, которые проводятся на территории всей страны по единым стандартизированным материалам, разработанным на уровне Российской Федерации.

         ВПР не является государственной итоговой аттестацией.

     

         Какими нормативными документами регламентируется проведение ВПР?

         Приказ Министерства образования и науки Российской Федерации от 20 октября 2017 года № 1025 «О проведении мониторинга качества образования».

         Документы размещены на официальном сайте Управления образования Ирбитского МО в разделе «Деятельность» (рубрика «Всероссийские проверочные работы»).

     

         Для чего проводится ВПР?

         ВПР позволяет осуществлять мониторинг результатов введения Федеральных государственных образовательных стандартов, а также послужит развитию единого образовательного пространства в Российской Федерации.

         Это диагностические работы, направленные на оценку индивидуальных достижений обучающегося.

         Результаты контрольной работы могут быть полезны родителям для определения образовательной траектории своих детей.

     

         Учитываются ли результаты ВПР при выставлении годовых отметок по предметам или при получении аттестата?

         Нет, не учитываются

     

         Где проводится ВПР?

         Обучающиеся принимают участие в ВПР в образовательной организации по месту их обучения. Продолжительность проведения проверочной работы в 2-9 классах — 45 минут, в 10-11 классах -90 минут.

     

         В каких классах будут проводиться ВПР в 2018 учебном году?

         Для обучающихся 4, 5, 6, 8,11 классов.

     

         По каким предметам будут проходить ВПР и в какое время?

         Обучающиеся 4 классов по учебным предметам: математика, окружающий мир, русский язык – с 17 по 26 апреля 2018 года.

         Обучающиеся 5 классов по учебным предметам: русский язык, математика, история, биология – с 17 по 26 апреля 2018 года.

         Обучающиеся 6 классов по учебным предметам: русский язык, математика, биология, география, обществознание, история – с 18 апреля по 15 мая 2018 года.

         Обучающиеся 11 классов по учебным предметам: иностранный язык, география, химия, биология, физика, история — с 20 марта по 12 апреля 2018 года.

     

         Где можно ознакомиться с образцами работ?

         Всероссийские проверочные работы. Информационный портал. СтатГрад https://vpr.statgrad.org/.

         Образцы контрольных работ для 4,5 и 11 классов.

         ФГБНУ «ФИПИ» www.fipi.ru/vpr — публикует описания и образцы вариантов для проведения в 11 классах Всероссийских проверочных работ (ВПР) по учебным предметам: биология, география, история, физика, химия.

     

         Запрещено ли обучающимся иметь при себе мобильный телефон? 
         Иметь при себе мобильный телефон не запрещено, однако пользоваться им нельзя.


    Мутационный анализ Vpr-индуцированной остановки G2, ядерной локализации и гибели клеток в делящихся дрожжах

    J Virol. 1999 апрель; 73(4): 3236–3245.

    , 1 , 1 , 1 , 2 , 3 , 3 , 4 и 1, 9000 и 1, 2, 5, *

    Mingzhong Chen

    Детский мемориальный институт образования и исследований 1 и отделения педиатрии 2 и микробиологии-иммунологии, 5 Медицинская школа Северо-Западного университета, Чикаго, Иллинойс 60614; Laboratoire de Génétique Moléculaire des Interactions Protéiques, INSERM U332, ICGM, Université Paris V, 75014 Paris, France 3 ; и Лаборатория коммуникационных исследований, Центр перспективных исследований Кансай, Кобе, Япония 4

    Роберт Т.

    Elder

    Детский мемориальный институт образования и исследований 1 и отделения педиатрии 2 и микробиологии-иммунологии, 5 Медицинская школа Северо-Западного университета, Чикаго, Иллинойс 60614; Laboratoire de Génétique Moléculaire des Interactions Protéiques, INSERM U332, ICGM, Université Paris V, 75014 Paris, France 3 ; Лаборатория коммуникационных исследований Кансайского центра перспективных исследований, Кобе, Япония 4

    Мин Ю

    Детский мемориальный научно-образовательный институт 1 и кафедры педиатрии 2 и микробиологии-иммунологии, 5 Северо-Западный медицинский университет Школа, Чикаго, Иллинойс 60614; Laboratoire de Génétique Moléculaire des Interactions Protéiques, INSERM U332, ICGM, Université Paris V, 75014 Paris, France 3 ; и Лаборатория коммуникационных исследований, Центр перспективных исследований Кансай, Кобе, Япония 4

    Морис Г.

    O’Gorman

    Детский мемориальный институт образования и исследований 1 и отделения педиатрии 2 и микробиологии-иммунологии, 5 Медицинская школа Северо-Западного университета, Чикаго, Иллинойс 60614; Laboratoire de Génétique Moléculaire des Interactions Protéiques, INSERM U332, ICGM, Université Paris V, 75014 Paris, France 3 ; Лаборатория коммуникационных исследований Кансайского центра перспективных исследований, Кобе, Япония 4

    Люк Селиг

    Детский мемориальный научно-образовательный институт 1 и кафедры педиатрии 2 и микробиологии-иммунологии, 5 Северо-Западный медицинский университет Школа, Чикаго, Иллинойс 60614; Laboratoire de Génétique Moléculaire des Interactions Protéiques, INSERM U332, ICGM, Université Paris V, 75014 Paris, France 3 ; Лаборатория коммуникационных исследований Кансайского центра перспективных исследований, Кобе, Япония 4

    Ричард Бенарус

    Детский мемориальный научно-образовательный институт 1 и кафедры педиатрии 2 и микробиологии-иммунологии, 5 Северо-западный медицинский университет Школа, Чикаго, Иллинойс 60614; Laboratoire de Génétique Moléculaire des Interactions Protéiques, INSERM U332, ICGM, Université Paris V, 75014 Paris, France 3 ; Лаборатория коммуникационных исследований Кансайского центра перспективных исследований, Кобе, Япония 4

    Аюму Ямамото

    Детский мемориальный научно-образовательный институт 1 и кафедры педиатрии 2 и микробиологии-иммунологии Медицинского университета Северо-Западного 5 90 Школа, Чикаго, Иллинойс 60614; Laboratoire de Génétique Moléculaire des Interactions Protéiques, INSERM U332, ICGM, Université Paris V, 75014 Paris, France 3 ; и Лаборатория коммуникационных исследований Кансайского центра перспективных исследований, Кобе, Япония 4

    Юци Чжао

    Детский мемориальный научно-образовательный институт 1 и кафедры педиатрии 2 и микробиологии-иммунологии, Северо-западный медицинский университет 5 9000 Школа, Чикаго, Иллинойс 60614; Laboratoire de Génétique Moléculaire des Interactions Protéiques, INSERM U332, ICGM, Université Paris V, 75014 Paris, France 3 ; и Лаборатория коммуникационных исследований Кансайского центра перспективных исследований, Кобе, Япония 4

    Детский мемориальный научно-исследовательский институт 1 и отделения педиатрии 2 и микробиологии-иммунологии, 5 Медицинская школа Северо-Западного университета, Чикаго, Иллинойс 60614; Laboratoire de Génétique Moléculaire des Interactions Protéiques, INSERM U332, ICGM, Université Paris V, 75014 Paris, France 3 ; и Лаборатория коммуникационных исследований, Центр перспективных исследований Кансай, Кобе, Япония 4

    * Автор, ответственный за переписку. Почтовый адрес: 2430 N. Halsted St., #218, Чикаго, Иллинойс 60614. Телефон: (773) 880-6608. Факс: (773) 880-6609. Электронная почта: [email protected]

    Поступило 11 августа 1998 г .; Принято 26 декабря 1998 г.

    Copyright © 1999, Американское общество микробиологии Эта статья цитировалась в других статьях PMC.

    Abstract

    Клеточный цикл G 2 Арест, ядерная локализация и гибель клеток, вызванные вирусом иммунодефицита человека типа 1, Vpr исследовали у делящихся дрожжей с использованием панели мутаций Vpr, которые ранее изучались в клетках человека.Эффекты мутаций на функции Vpr были очень похожи между делящимися дрожжами и клетками человека. В соответствии с исследованиями клеток млекопитающих, индукция остановки клеточного цикла G 2 с помощью Vpr оказалась независимой от ядерной локализации. Кроме того, было показано, что остановка G 2 не зависит от гибели клеток, которая происходит только тогда, когда мутантный Vpr локализуется в ядре. C-конец Vpr имеет решающее значение для ареста G 2 , N-концевая α-спираль важна для локализации в ядре, а большая часть белка Vpr отвечает за уничтожение клеток.Очевидно, что общая структура Vpr важна для этих клеточных эффектов, поскольку N- и C-концевые делеции влияют на все три клеточные функции. Кроме того, две одиночные точечные мутации (h43R и H71R), обе из которых расположены на концах каждой α-спирали, нарушили все три функции Vpr, указывая на то, что эти две мутации могут оказывать сильное влияние на общую структуру Vpr. Сходство мутантных эффектов на функцию Vpr в делящихся дрожжах и клетках человека предполагает, что делящиеся дрожжи можно использовать в качестве модельной системы для оценки этих функций Vpr в встречающихся в природе вирусных изолятах.

    Белок R (Vpr) вируса иммунодефицита человека типа 1 (ВИЧ-1) представляет собой белок с молекулярной массой 15 кДа, ассоциированный с вирионом, который консервативен среди ВИЧ-1, ВИЧ-2, вируса иммунодефицита обезьян (SIV) и других лентивирусов (35 , 45), что свидетельствует о важной роли Vpr в жизненном цикле вируса. Исследования ВИО макак (SIV mac ) с дефектным vpr также указывают на важность Vpr. У некоторых макак-резусов, инфицированных vpr -дефектным SIV mac , СПИД либо не прогрессирует, либо болезнь прогрессирует медленнее (11, 16, 22).Когда vpr и vpx , второй ген, гомологичный vpr в SIV mac , являются дефектными, инфицированные макаки-резус имеют низкий титр вируса и не прогрессируют до СПИДа (11, 45). У шимпанзе и одного человека, инфицированного штаммом ВИЧ-1, содержащим мутантный нефункциональный белок Vpr, белок Vpr вернулся к последовательности дикого типа в ходе инфекции, что указывает на сильный отбор Vpr во время ВИЧ-1. инфекции (12).

    При анализе в системах культивирования клеток Vpr проявляет множественную активность. Vpr активирует репликацию вируса (25, 26) и вызывает изменения морфологии клеток, которые имитируют клеточную дифференцировку (24). Он предотвращает пролиферацию клеток, останавливая трансфицированные клетки человека в фазе G 2 клеточного цикла (14, 19, 38, 39), когда репликация ВИЧ увеличивается (12, 48). Экспрессия Vpr ВИЧ в трансфицированных клетках человека в конечном итоге вызывает гибель клеток посредством апоптоза (1, 43) и/или цитопатических эффектов (48).Эти эффекты Vpr высоко консервативны среди эукариот, поскольку Vpr также вызывает остановку G 2 , изменения морфологии клеток и гибель клеток в клетках делящихся дрожжей ( Schizosaccharomyces pombe ) (50, 51, 55). Vpr также способствует транспорту прединтеграционного вирусного комплекса в ядро ​​и, таким образом, помогает ВИЧ-1 инфицировать неделящиеся клетки (4, 15, 46). Когда Vpr экспрессируется отдельно в клетках млекопитающих, он локализуется в ядре и часто обнаруживается преимущественно на ядерной мембране.В этом отчете мы показываем, что Vpr локализован в ядре клеток S. pombe , точно так же, как и в клетках млекопитающих с той же преобладающей локализацией на ядерной мембране (46).

    Процессы, на которые влияет Vpr, клеточный цикл, ядерная локализация и гибель клеток, высоко консервативны среди эукариот, и исследования дрожжевых клеток сыграли важную роль в молекулярном анализе этих процессов (rev. reference 53). Что касается клеточного цикла, циклин-зависимая киназа Cdc2, которая определяет начало митоза во всех эукариотических клетках, функционально взаимозаменяема между белками Cdc2 делящихся дрожжей и человека (23).Иллюстрацией консервации индуцированной Vpr остановки G 2 является то, что Vpr индуцирует остановку G 2 как в делящихся дрожжах, так и в клетках человека посредством ингибирующего фосфорилирования Cdc2 (8, 14, 19, 38, 50, 54). Сходным образом, ядерная локализация высоко консервативна между клетками млекопитающих и почкующимися дрожжевыми клетками с человеческими ядерными транспортными факторами, функционирующими у почкующихся дрожжей (9, 46). Классический путь ядерной локализации начинается со связывания последовательности ядерной локализации (NLS) с импортином α, также известным как кариоферин α.Комплекс NLS-импортин α взаимодействует с импортином β, и этот комплекс затем связывается с ядерными поринами, компонентами ядерной поры, для транслокации в ядро ​​(13). Vpr сам по себе не содержит NLS, но недавно было показано, что Vpr связывается с importin α либо из почкующихся дрожжей, либо из клеток человека, чтобы стабилизировать связывание NLS с другим сайтом на importin α (37, 46). Совсем недавно было высказано предположение, что некоторые аспекты апоптоза сохраняются между клетками млекопитающих и делящимися дрожжевыми клетками.Четыре белка (Bak, Bax, Ced4 и Vpr), которые индуцируют апоптоз в клетках млекопитающих или нематод, также индуцируют гибель делящихся дрожжевых клеток с характерными для апоптоза изменениями в ядерной морфологии (17, 18, 20, 55). Учитывая высокую степень консервативности G 2 -mitosis перехода клеточного цикла, ядерной локализации и гибели клеток, Vpr почти наверняка оказывает эти три эффекта, взаимодействуя с высококонсервативными компонентами клеточного аппарата. Тогда делящиеся дрожжи, вероятно, станут прекрасной модельной системой для изучения этих функций Vpr.

    В этом исследовании мы исследовали у делящихся дрожжей влияние набора мутаций vpr , которые ранее были охарактеризованы по их влиянию на остановку G 2 в клетках человека (2, 42). Одной из целей этого исследования было определить, оказывают ли мутации такой же эффект на остановку G 2 у делящихся дрожжей, как и в клетках человека. Если существует сильная корреляция между эффектами мутаций Vpr в клетках дрожжей и человека, это открытие будет способствовать использованию дрожжей в некоторых функциональных исследованиях Vpr.Вторая цель этого исследования состояла в том, чтобы определить, оказывают ли мутации vpr дифференциальные эффекты на многочисленные активности vpr , которые в дрожжах включают остановку G 2 , уничтожение клеток и локализацию в ядре. Обнаружение мутации с большим эффектом на одну функцию vpr с небольшим эффектом или отсутствием эффекта на другую предполагает, что Vpr использует разные пути для этих двух эффектов. Доступность этих мутаций затем поможет в анализе различных путей, используемых vpr для этих множественных функций.

    Одной из конечных целей этого исследования является вклад в развитие дрожжевой системы как средства изучения роли множественной активности Vpr во время ВИЧ-инфекции и патогенеза. Существование множественных активностей Vpr в анализах клеточных культур и многочисленных вариантов последовательностей Vpr у пациентов поднимает вопрос о том, имеют ли все эти активности одинаковое значение для вируса. Возможно, что при определенных условиях одна или несколько активностей не требуются для нормального жизненного цикла вируса и что большинство квазивидов Vpr в этих условиях не обладают этой активностью.Один из подходов к определению роли множественной активности Vpr в инфекциях человека заключается в разработке структурно-функциональной карты Vpr, позволяющей предсказать функцию по последовательности ДНК. Хотя ряд исследований был сосредоточен на определении функциональных доменов Vpr (7, 30–32, 49), большая степень изменчивости последовательности Vpr (квазивиды) у инфицированных пациентов делает эту характеристику утомительной и почти невозможной. Маловероятно, что в ближайшее время будет доступна достаточно подробная структурно-функциональная карта Vpr, позволяющая делать полные и точные прогнозы активности Vpr только на основе данных о последовательности. Сравнительная простота определения активности Vpr в дрожжах предполагает альтернативный подход клонирования вариантов Vpr пациентов в клетки дрожжей для определения активности каждого варианта Vpr. Исследование, представленное здесь, подтверждает осуществимость этого подхода.

    МАТЕРИАЛЫ И МЕТОДЫ

    Штаммы дрожжей и среды.

    S. pombe SP223 (h ade-216 leu1-32 ura4-294 ) использовали в качестве хозяина в этом исследовании. Все методы, используемые здесь для клеточных культур, индукции экспрессии гена vpr под контролем промотора nmt1 и посева клеток, были описаны ранее (51, 54, 55).

    Клонирование гена
    vpr в векторах экспрессии S. pombe pYZ1N и pYZ3N-GFP.

    Векторы pYZ1N и pYZ3N-GFP уже были описаны (52). Вкратце, эти два вектора являются производными вектора pREP1N, который мы использовали для экспрессии vpr в предыдущих исследованиях (51, 55). Все они содержат один и тот же nmt1 -индуцируемый промотор и были разработаны для обеспечения положительного отбора генных вставок (оба вектора) и слияния с геном, кодирующим зеленый флуоресцентный белок (GFP) (pYZ3N-GFP), для анализа экспрессии генов in vivo. .Экспрессия vpr в плазмиде pYZ1N дает такие же фенотипические изменения, как сообщалось ранее для экспрессии в векторе pREP1N (51, 52, 55). В этом исследовании использовали тринадцать независимых точечных мутаций vpr , которые были производными vpr LAI дикого типа и первоначально изучали их эффекты в клетках человека (42). Четыре делеционных мутанта, также производные vpr LAI дикого типа, были описаны ранее (2). Эти генов vpr были амплифицированы с помощью ПЦР, как описано ранее (51), с использованием праймеров для ПЦР VPRNde (GAGGCATATGGAACAAGCCCCAGAAGACC) и VPRBamWT (GGCGGATCCCTAGGATCTACTG).Расщепленный продукт ПЦР вставляли в сайты Nde I и Bam HI вектора pYZ1N. Гены vpr сливали в рамке считывания с GFP с помощью ПЦР-амплификации с использованием праймеров Sac I (ACAGACCGCGGATATGGAAAAGCCCCAGAAGACC) и VPRBam и вставкой расщепленного продукта ПЦР в сайты Sac II и Bam HI pYZ3N-GFP. Смеси лигирования трансформировали в Escherichia coli , и колонии, содержащие плазмиды со вставками vpr , идентифицировали как бесцветные колонии на 5-бром-4-хлор-3-индолил-β-d-галактопиранозиде (X-Gal)-содержащем Чашки с агаром Луриа-Бертани (6).Вставки первоначально идентифицировали расщеплением рестрикционными ферментами и ПЦР. Наличие правильной мутации в каждом клоне подтверждали полным секвенированием нуклеотидов вставки с использованием секвенатора ДНК ABI 377 (The Perkin-Elmer Corp., Norwalk, Conn.). Все плазмиды, содержащие vpr , экспрессировали в штамме делящихся дрожжей SP223 для исследования ареста G 2 , локализации в ядре и гибели клеток.

    Измерение клеточного цикла G
    2 арест.

    Процедура проточной цитометрии, использованная для измерения остановки клеточного цикла G 2 , выполнялась по существу так же, как описано ранее (51), с некоторыми незначительными изменениями. Вкратце, для количественной оценки степени ареста G 2 , индуцированного Vpr ВИЧ-1, клетки брали из активной, логарифмической, содержащей тиамин культуры (в диапазоне от 1 × 10 7 до 5 × 10 7 клеток/мл), трижды промывали дистиллированной водой и использовали для получения безтиаминовой культуры с плотностью 2 × 10 5 клеток/мл при 30°С при встряхивании (200 об/мин). Клетки собирали через 40 ч после начала культивирования и определяли содержание ДНК в клетках с помощью FACScan с использованием программного обеспечения Cell-fit (Becton Dickinson). Степень ареста G 2 , индуцированного Vpr, выражали как процент клеток G 1 в клетках, экспрессирующих vpr , которые перешли в фазу G 2 клеточного цикла в клетках, экспрессирующих vpr . . Все данные, представленные здесь, являются средними (со стандартными отклонениями) трех независимых экспериментов и выражены как отношение ареста G 2 мутантного vpr к аресту vpr дикого типа.Отношения больше единицы указывают на повышенную индукцию ареста G 2 , а отношения меньше единицы указывают на снижение ареста G 2 по сравнению с Vpr дикого типа.

    Измерение выживаемости клеток.

    Способность к образованию колоний использовали в качестве количественного измерения гибели клеток, вызванной Vpr, как описано ранее (55). Вкратце, клеток S. pombe , содержащих конструкции pYZ1N:: vpr , готовили, как описано выше, для измерения ареста G 2 .Аликвоту каждой культуры, экспрессирующей vpr , или культуры, экспрессирующей vpr , собирали через 18 ч после индукции гена vpr и высевали на планшеты, содержащие тиамин для селекции (EMM). Числа КОЕ рассчитывали из числа колоний, выросших на чашках, в процентах от числа первоначально высеянных клеток, с поправкой на эффективность посева vpr -репрессированных клеток. Эффективность высева vpr -репрессированных клеток определяли для 18-часовых тиаминсодержащих культур путем посева на тиаминсодержащие селекционные планшеты EMM и составляла от 100 до 40%.

    Ядерная локализация.

    Культуры клеток с плазмидами, экспрессирующими GFP или гибрид GFP-Vpr, готовили, как описано выше, для измерения ареста G 2 . Клеточную локализацию определяли через 18–24 ч после индукции гена vpr с помощью флуоресцентной микроскопии на микроскопе Olympus Bh3-RFL с использованием комбинации синего фильтра с дополнительным возбуждающим фильтром EY-455.

    Анализ вторичной структуры Vpr.

    Вторичные структуры Vpr были проанализированы с помощью программного обеспечения nnpredict, которое предсказывает тенденцию вторичной структуры для каждого остатка в аминокислотной последовательности на основе двухслойной нейронной сети с прямой связью (21).Эти структурные предсказания в целом согласуются с третичной моделью, недавно предложенной для Vpr на основе данных о круговом дихроизме и ядерном магнитном резонансе (ЯМР) (28, 40). Диаграмма третичной структуры Vpr была создана с использованием программы RasMol v. 2.6 (41) по координатам, предоставленным Ziwei Huang (28).

    РЕЗУЛЬТАТЫ

    Белки Vpr из вирусных вариантов NL4-3 и LAI оказывают сходное действие на остановку и уничтожение клеток G
    2 .

    Vpr LAI дикого типа, который является родителем всех мутантных белков Vpr, используемых в этом исследовании, отличается четырьмя аминокислотами (Y15H, S28N, N41G и R85Q) от Vpr NL4-3 , который использовался в предыдущих исследованиях делящихся дрожжей. На рисунке показано, что Vpr LAI и Vpr NL4-3 оказывают сходное действие на делящиеся дрожжи в отношении задержания и уничтожения клеток G 2 . Индуцированную Vpr остановку клеточного цикла G 2 измеряли с помощью проточной цитометрии и определения индекса септации. Анализ с помощью проточной цитометрии измеряет процент клеток G 1 при репрессии vpr , которые переходят в фазу G 2 в клетках, экспрессирующих vpr . Это количественное измерение индуцированной Vpr остановки G 2 показало, что 74.4% ± 7,8% клеточной популяции Vpr LAI G 1 сместились на G 2 (рис. A) по сравнению с 71,5% ± 14,8% клеточной популяции Vpr NL4-3 (данные не показаны). ; 51). Таким образом, оба варианта Vpr индуцировали одинаково высокие уровни ареста G 2 у делящихся дрожжей. Анализ индекса септации также использовали для сравнения способности двух вариантов Vpr ингибировать клеточное деление. Этот анализ измеряет процент клеток в популяции, содержащих перегородки, что указывает на митотическое деление клеток (51).Обе vpr -репрессирующие культуры сохраняли нормальный индекс септирования (11,0% ± 0,5% и 11,5% ± 0,6% для Vpr NL4-3 и Vpr LAI соответственно), что указывает на нормальные и активно растущие клетки, но только 5,2. % ± 1,0% и 3,5% ± 0,5% перегородок наблюдали в культурах, экспрессирующих vpr , через 18 ч после индукции vpr .

    Влияние Vpr LAI на остановку G 2 , выживаемость клеток и локализацию в ядре у делящихся дрожжей.(A) Проточные цитометрические анализы через 40 ч после переноса в среду с ( vpr , репрессированные) или без ( vpr , экспрессированные) тиамином, показывающие сдвиг клеток G 1 в среде с тиамином (+T) к G 2 стадия клеточного цикла в среде без тиамина (-Т). (B) Качественный анализ уничтожения клеток с помощью Vpr. Чашка с тиамином наверху репрессирует промотор нмт1 , и после инкубации в течение 3-4 дней клетки образуют колонии нормального размера. Клетки с плазмидой Vpr NL4-3 (а) — слева, клетки с плазмидой Vpr LAI (б) — справа.На чашке без тиамина, показанной внизу, индуцируется ген vpr , и как Vpr NL4-3 , так и Vpr LAI предотвращают образование колоний нормального размера. (C) Морфологические изменения, вызванные Vpr LAI , несколько отличаются от таковых, вызванных Vpr NL4-3 . Культуры с тиамином как для Vpr NL4-3 (a), так и для Vpr LAI (b) показывают нормальную картину окрашивания Calcofluor со слабым общим окрашиванием клеточной стенки и интенсивным окрашиванием перегородки, образующейся в месте возможного деление клеток.Одна клетка на каждой панели показывает это сильное окрашивание перегородки. Обе культуры без тиамина в нижней части ( vpr экспрессированы) демонстрируют значительное усиление окрашивания хитином по сравнению с нормальными клетками. Однако для Vpr NL4-3 (a) это повышенное отложение хитина происходит на выступающих концах клеток, в то время как клетки с Vpr LAI имеют очень толстые отложения хитина вблизи центра клетки, где обычно формируется перегородка. (D) Гибридный белок GFP-Vpr NL4-3 локализуется вокруг края ядра и показывает небольшое перекрытие с ядерной ДНК.Клетки через 17 ч после индукции Vpr окрашивали на ДНК витальным красителем Hoechst 33342 (Chikashige, 1994, № 8). Третья цветная панель показывает GFP-Vpr в ложном красном цвете и окрашивание ДНК в ложном зеленом цвете с небольшим перекрытием между двумя цветами.

    Экспрессия Vpr NL4-3 в делящихся дрожжах вызывает обширную гибель клеток (50, 51, 55). Два метода используются для измерения гибели клеток, вызванной Vpr. Качественный метод заключается в нанесении штрихом клеток, содержащих vpr , непосредственно с планшета, содержащего тиамин (для подавления экспрессии vpr ), на планшет без тиамина (для индуцирования экспрессии vpr ).В этом анализе не образуются видимые колонии или образуются очень маленькие колонии с клетками, содержащими либо Vpr NL4-3 , либо Vpr LAI (рис. 1Ba) (51). Второй метод является количественным и измеряет колониеобразующую способность экспрессирующих vpr клеток на чашках с тиаминсодержащим агаром (для прекращения экспрессии vpr ). Для Vpr LAI 16,8% ± 3,6% клеток образуют колонии на чашках с агаром после 18 ч индукции в жидкой среде без тиамина, что идентично 16.7% ± 1,3% наблюдается для Vpr NL4-3 (таблица) (55). Таким образом, оба варианта Vpr эффективно убивают делящиеся дрожжевые клетки. Таблица 1 SD) A


    Ядерная локализация Мощность колонии (AVG% выживание ± SD) Структурные домены B Функция VPR пострадавших C Дрожжевые клетки Клетки человека d Дикие типы  Vpr NL4-3 + (1.04 ± 0,08) + + + + (16. 7 ± 1,3) — — Lai + (1.00 ± 0,06) + + + + ( 16.8 ± 3.6) — — — Точечные мутации E17D + (1.00 ± 0,04) + + + (5,6 ± 0,2) α1 None  W18R + (0. 93 ± 0.13) ND ND ↓ (86,9 ± 3,5) α1 D D E24G + (1,02 ± 0.19) + + + ↓ (43,1 ± 16.7 ) α1 D E25K + (1.10 ± 0,06) + ± — (110,4 ± 6,0) α1 D, N H43R ↓ H43R ↓ (0,84 ± 0,23) − ± ↓ (37. 1 ± 3.0) α1 D, N, G 2 F34i + (1,04 ± 0,01) ↓ ± ↓ (87,5 ± 6,7) α1 D , N W54R + (1.04 ± 0,09) ↓ + ↓ (44,2 ± 14.1) α2 D 9 H71R ↓ (0,62 ± 0,32) — ± ± ↓ (41,7 ± 4. 1) α2 D, N, G 2 H78R ↓ (0.38 ± 0.21) ↓ + + (9,5 ± 7.1) C Haft г 2 2 S79A + (1.10 ± 0,30509 + + + (9,5 ± 1,0) C хвост None R88K ↓ (0,31 ± 0,21) ↓ + + (9,5 ± 2,7) C хвост г 2  A89T + (0,91 ± 0. 08) + + + (8,8 ± 1,7) c хвост none R90k + (1.11 ± 0.12) ↓ E + ↑ (1.8 ± 1,3) C хвост D, G 2 9057 2 DELETIONS N15 ↓ (0,62 ± 0,03) ND ± — (94,3 ± 21,3) N хвост D, N, G 2  N27 − (0. 18 ± 0,09) ND ± — (100,1 ± 6,0) N хвост, α1 D, N, G 2 2 C63 — (-0,21 ± 0,30) ND — — (117,6 ± 13.7) α2, C хвост D, N, G 2 C77 ↓ (0,89 ± 0,08) ND ± ↓ (20,9 ± 4,3) C tail D, N, G 2
    Белки Vpr из вирусных вариантов NL4-3 и LAI вызывают клеточные морфологические изменения с незначительными различиями.

    Vpr вызывает морфологические изменения, включая резкое увеличение и неправильную форму клеток млекопитающих (24). При экспрессии Vpr NL4-3 в делящихся дрожжах также наблюдалось значительное увеличение и неправильные выступающие структуры (51). Эти дрожжевые клетки обычно в два-три раза больше, чем нормальные клетки. Более того, выступающие структуры, индуцированные Vpr на клетках, коррелируют с участками повышенного биосинтеза хитина в клеточной стенке. В некоторых клетках неправильной формы (55) были обнаружены множественные перегородки (рис.1Са). При экспрессии Vpr LAI в дрожжах также было обнаружено значительное увеличение клеток и повышенный биосинтез хитина. Интересно, однако, что в клетках, экспрессирующих vpr LAI , не были обнаружены ни нерегулярные выступающие структуры, ни локальное накопление хитина в клеточной стенке. Вместо этого скопление хитина обнаруживалось преимущественно в септальной области (рис. 1В, б).

    Слитый белок GFP-Vpr локализуется в ядерной оправе.

    Для определения клеточной локализации Vpr у делящихся дрожжей ген vpr сливали с репортерным геном, кодирующим GFP, и экспрессировали с промотора nmt1 в клетках делящихся дрожжей.В качестве контроля только ген, кодирующий GFP, экспрессировался с промотора nmt1 . В среде, содержащей тиамин, клетки со слиянием GFP или GFP-Vpr не имели зеленой флуоресценции (данные не показаны). Когда промотор nmt1 индуцировали в среде, не содержащей тиамина, клетки только с геном gfp имели зеленую флуоресценцию, рассеянную по клеткам с очевидной флуоресценцией как в ядерном, так и в цитоплазматическом компартментах (рис. 2Ва). Клетки с одним только GFP оставались нормальными, без морфологических изменений, ареста G 2 или гибели клеток.Напротив, клетки со слиянием GFP-Vpr имели интенсивную зеленую флуоресценцию вокруг ядра по краю ядра с небольшим мечением цитоплазмы (рис. D и 2Bb). Слитый белок GFP-Vpr сохраняет функции Vpr, поскольку он вызывает морфологические изменения, остановку G 2 и гибель клеток (данные не показаны). Поскольку слитый белок является функциональным, локализация слитого белка GFP-Vpr, скорее всего, представляет собой клеточную локализацию Vpr. В двухцветном представлении с GFP произвольного зеленого цвета и ДНК произвольного белого цвета (рис.1Da), комбинация двух цветов на третьей панели показывает, что существует небольшое перекрытие GFP и ДНК, что указывает на то, что GFP-Vpr локализуется преимущественно на ядерном крае, при этом небольшое слияние фактически присутствует в ядре.

    Точечные мутации Vpr одинаково влияют на остановку G
    2 в клетках дрожжей и человека.

    Набор мутантных белков Vpr, использованный в этом исследовании делящихся дрожжей, получен из исследований взаимодействий Vpr с урацил-ДНК-гликозилазой (2, 42). Эти мутантные белки включают четыре делеции, две с амино-конца (N15 и N27) и две с карбокси-конца (С63 и С77), и 13 точечных мутаций, представляющих отдельные аминокислотные замены, распределенные по всему гене.Мутантные генов vpr были клонированы в вектор экспрессии pYZ1N. Иммуноблот-анализ подтвердил, что все мутаций vpr были экспрессированы в делящихся дрожжах. Полоса 15 кДа, соответствующая размеру Vpr, была обнаружена с помощью анти-Vpr сыворотки для всех 13 точечных мутаций (рис. A). Точечные мутации экспрессировали по крайней мере такое же количество белка, как Vpr дикого типа LAI , а точечные мутантные белки W18R, E25K, h43R, F34I, H71R и H78R имели уровни экспрессии выше, чем у дикого типа.Таким образом, любое снижение активности, вызванное точечной мутацией vpr , не связано со снижением экспрессии белка. Поскольку делеционные мутантные белки могут не реагировать с антисывороткой, полученной против синтетического пептида, представляющего часть Vpr (4), экспрессия четырех делеций была измерена с помощью Нозерн-блоттинга, и было показано, что она аналогична экспрессии Vpr LAI путем гибридизации РНК-блот с зондом vpr (рис. 2Аб). Кроме того, при экспрессии в виде слияний с GFP все четыре мутантных белка с делецией Vpr давали легко обнаруживаемую зеленую флуоресценцию, что указывает на то, что слитые белки экспрессировались на сходных уровнях.

    Влияние мутаций Vpr на ядерную локализацию и арест G 2 . (A) Экспрессия мутантных белков Vpr. Экстракты из индуцированных (без тиамина) точечных мутантных белков Vpr (а) и мРНК из делеционных мутантных белков (б) выделяли и подвергали вестерн- и нозерн-блоттингу соответственно. Стрелка указывает полосу шириной 15 кб, ожидаемую для Vpr. +T с тиамином; -Т без тиамина; WT, дикий тип. (B) Мутации, влияющие на локализацию слитого белка GFP-Vpr.( а ) Локализация GFP, не слитого с Vpr, показывает равномерное распределение по клетке. ( б ) Локализация GFP-Vpr LAI , показывающая кольцо или кольцо точек вокруг ядра с незначительной обнаруживаемой меткой цитоплазмы. Панели c-j показывают результаты тех мутаций Vpr, которые изменяют характер локализации: c, E25K; г, h43R; д, F34I; е, H71R; г, делеция N15; h, делеция N27; i, делеция C63; j, делеция C77. (C) Влияние мутаций Vpr на арест G 2 . Репрезентативные анализы проточной цитометрии клеточного цикла показаны для четырех мутаций. Верхние панели относятся к культурам с тиамином, где vpr репрессировано, а нижние панели относятся к культурам без тиамина, где экспрессируется vpr .

    Мутации указывают на то, что карбокси-конец Vpr необходим для индукции ареста G 2 у делящихся дрожжей, но что другие области белка также играют роль в аресте G 2 . В то время как две короткие делеции N15 и C77 уменьшают степень остановки G 2 , более длинные делеции N27 и C63 устраняют остановку G 2 .Что касается точечных мутаций, три из шести мутаций на карбокси-конце (H71R, H78R и R88K) уменьшают остановку G 2 . Мутация h43R является единственной точечной мутацией в амино-концевой половине Vpr, вызывающей остановку G 2 (таблица; рис. C).

    Vpr-индуцированная гибель клеток не зависит от ареста G
    2 .

    Более половины мутаций в этом исследовании вызывали значительное снижение степени гибели клеток, вызванной Vpr (таблица). Три из четырех делеций устраняли гибель клеток, а делеция C77 уменьшала гибель клеток (20.9% ± 4,3%). Семь из 13 точечных мутаций в разной степени уменьшали гибель клеток. Мутации, уменьшающие клеточную гибель, не расположены в небольшой области белка, что указывает на то, что большая часть белка Vpr требуется для клеточной гибели.

    Пять точечных мутаций, снижающих гибель клеток (W18R, E24G, E25K, F34I и W54R), не влияли на способность индуцировать остановку G 2 (таблица). Напротив, две другие мутации, H78R и R88K, продемонстрировали противоположный эффект, с уменьшенной остановкой G 2 , но неизменными уровнями уничтожения клеток.Несоответствие между эффектами ареста G 2 и гибели клеток этих семи мутаций предполагает, что это независимые функции Vpr.

    Ядерная локализация не требуется для ареста G
    2 .

    Все четыре делеции и четыре точечные мутации (E25K, h43R, F34I и H71R) влияют на локализацию слияния GFP-Vpr в ядерном ободе (рис. 2Bc-j). С GFP-Vpr LAI зеленая метка была ограничена в основном краем ядра, при этом большинство клеток не имели обнаруживаемой метки в цитоплазме или самом ядре (рис.D и 2Bb). Напротив, четыре делеции и четыре точечные мутации имели различные уровни мечения в цитоплазме наряду с другими отличиями от паттерна мечения слитого белка GFP-Vpr LAI . Делеции N15 и C77 и точечные мутации h43R, F34I и H71R вызывали более слабое мечение ядерного обода, чем таковое, полученное с GFP-Vpr LAI , в то время как делеции N27 и C63 и точковая мутация E25K вызывали незначительное предпочтительное мечение или не вызывали его вообще. ядерного обода.Общее мечение ядра на разных уровнях наблюдалось для делеций N27 и C77 и четырех точечных мутаций, влияющих на ядерную локализацию. Делеция N15 и, в меньшей степени, делеция C77 часто вызывают сильное пятно мечения на ядерном ободе. Делеция C63 является единственной мутацией, которая почти устраняет любую специфическую маркировку и приводит к маркировке, которая почти случайным образом распределяется в клетке.

    Мутации E25K и F34I указывают на то, что локализация в ядре не требуется для ареста G 2 , поскольку эти мутации вызывали уровни ареста G 2 , сравнимые с уровнями Vpr LAI дикого типа, даже несмотря на локализацию в ядре. обод был уменьшен или устранен.Мутация E25K также приводила к нормальным уровням ареста G 2 в клетках человека (42). Напротив, другие точечные мутации (H78R и R88K), вызывающие типичную ядерную локализацию, снижают способность индуцировать остановку G 2 у дрожжей, что также согласуется с идеей о том, что ядерная локализация и остановка G 2 являются независимыми функциями Vpr. .

    Для уничтожения клеток может потребоваться ядерная локализация.

    Четыре точечные мутации (E25K, h43R, F34I и H71R) и четыре делеционные мутации, снижающие или устраняющие локализацию в ядре, значительно уменьшают гибель клеток, предполагая, что локализация в ядре необходима для уничтожения клеток (таблица). Для подтверждения этого необходим анализ большего количества мутаций на предмет их влияния на уничтожение клеток и локализацию в ядре. Однако, если для уничтожения клеток необходима локализация в ядре, эта серия мутаций ясно показывает, что локализации в ядре недостаточно для уничтожения клеток, поскольку точечные мутации E24G и W54R вызывают типичную локализацию в ядерном ободе, но эти две мутации значительно снижают клеточную атрофию. убивающую способность (43,1% ± 16,7% и 44,2% ± 14,1% по сравнению с 16,7% ± 3.6% Впр LAI ).

    Структурные требования для функций Vpr.

    Третичная структура Vpr, недавно предложенная на основе данных ЯМР и кругового дихроизма, состоит из доменов спираль-петля-спираль и амино- и карбокси-хвостов (28, 34, 40). Приблизительные положения этих структурных элементов: аминокислоты с 1 по 16 для аминокислотного хвоста, с 17 по 34 для первой α-спирали, с 35 по 51 для петли, с 52 по 71 для второй α-спирали и с 72 по 96 для карбоксильный хвост. Исследования ЯМР показывают, что вторая α-спираль может продолжаться еще на несколько аминокислот за пределы положения 71 (40).Две α-спирали в Vpr, на которые указывают круговой дихроизм и данные ЯМР, вероятно, взаимодействуют друг с другом через свои гидрофобные поверхности (28, 40, 44, 49). О третичных структурах петли и N- и C-хвостов пока не сообщается.

    Хотя эта трехмерная структура требует дальнейшего подтверждения, она используется на рис. от a до c для иллюстрации положения точечных мутаций Vpr в качестве основы для идентификации возможных структурных доменов Vpr, необходимых для функции.С-хвост Vpr, по-видимому, играет решающую роль в индукции остановки G 2 у делящихся дрожжей (таблица). Пять из шести мутаций Vpr в этой области вызывали остановку G 2 ; H71R, H78R и R88K уменьшали остановку G 2 , в то время как S79A и R90K усиливали остановку G 2 (рис. а; таблица). Интересно, что наблюдались разные эффекты двух соседних мутаций на остановку G 2 . Уменьшенный арест G 2 (средний мутант: соотношение дикого типа ± стандартное отклонение, 0.38 ± 0,21) наблюдали для H78R, в то время как соседняя мутация S79A приводила к такой же или слегка усиленной остановке G 2 (1,10 ± 0,30). Точно так же противоположный эффект также наблюдался для аминокислот 88 и 90, где R88K уменьшал остановку G 2 (0,31 ± 0,21), а R90K сохранял уровень дикого типа или несколько усиливал остановку G 2 (1,11 ± 0,08; таблица). и рис. А).

    Положения аминокислотных замен, которые влияют на функцию Vpr. Третичная структура Vpr взята из ссылки 28.Аминокислота отображается синим цветом, когда изменение снижает активность, аминокислота отображается желтым цветом, когда не наблюдается активности, и аминокислота отображается красным цветом, когда наблюдается активность дикого типа или повышенная активность. Структурные домены, важные для функции, показаны зеленым цветом. (a) Замены, влияющие на арест G 2 . (b) Замены, влияющие на локализацию в ядерном ободе. (c) Замены, влияющие на гибель клеток.

    Первая α-спираль в N-концевой части Vpr, по-видимому, имеет решающее значение для ядерной локализации.Три одиночные замены (E25K, h43R и F34I), которые находятся внутри или вблизи N-концевой α-спирали, снижают или устраняют локализацию в ядерном ободе (Fig. C). Области Vpr, необходимые для уничтожения клеток, по-видимому, охватывают большую часть белка. Точечные мутации в первой α-спирали или рядом с ней (W18R, E24G, E25K, h43R и F34I) уменьшают гибель клеток, как и две мутации во второй α-спирали (W54R и H71R). Четыре из пяти точечных мутаций в карбокси-хвосте (H78R, S79A, R88K и A89T) не влияют в значительной степени на гибель клеток, но мутация R90K увеличивает гибель клеток.Примечательно, что две точечные мутации (h43R и H71R) снижают все три функции: арест G 2 , ядерную локализацию и уничтожение клеток, и эти две мутации находятся на карбоксильных концах каждой α-спирали (таблица; рис. ).

    ОБСУЖДЕНИЕ

    Впервые о высокой степени сохранения функций Vpr сообщили для варианта вируса Vpr NL4-3 , который индуцирует остановку клеточного цикла G 2 , гибель клеток и локализацию в ядре как у млекопитающих, так и у делящихся дрожжевые клетки (7, 43, 51, 55).Это исследование показывает, что эти эффекты Vpr LAI , который отличается четырьмя аминокислотами от Vpr NL4-3 и который вызывает остановку G 2 , ядерную локализацию и гибель клеток в клетках человека (44, 48), являются по существу такие же, как у Vpr NL4-3 у делящихся дрожжей. Однако эти два варианта Vpr вызывают морфологические изменения у делящихся дрожжей с небольшими различиями (Fig. C). Vpr NL4-3 индуцирует уникальные выступающие структуры, которые коррелируют с накоплением хитина (55).Хотя Vpr LAI также индуцирует повышенный биосинтез хитина, он не индуцирует выступающие структуры с сопутствующим накоплением хитина, а вместо этого повышенное количество хитина накапливается преимущественно в экваториальной области, где формируются множественные новые клеточные стенки (перегородки). Хотя механизм повышенного биосинтеза хитина у делящихся дрожжей и аналогичная функция в клетках человека неизвестны, это тонкое различие между Vpr NL4-3 и Vpr LAI , наблюдаемое у делящихся дрожжей, поднимает вопрос о том, являются ли эти два варианта Vpr также несколько иначе функционируют в клетках человека.

    Результаты, полученные с мутациями в Vpr LAI , являются еще одним свидетельством сохранения функций Vpr, поскольку при изучении одной и той же мутации в клетках человека мутации почти всегда имеют сходные эффекты в клетках человека и дрожжей. Для ареста G 2 9 из 12 мутаций показывают идентичные эффекты на арест G 2 в клетках человека и дрожжей (таблица). Две мутации (F34I и W54R) показывают незначительные различия между делящимися дрожжами и клетками человека с уменьшенной остановкой G 2 в клетках человека, но без изменений в клетках дрожжей.Это несоответствие может быть связано с различиями в оценке эффекта G 2 . Единственным исключением является мутация R90K, которая вызывает дикий тип или несколько усиленную остановку G 2 у делящихся дрожжей (1,11 ± 0,12), в противоположность уменьшенной остановке G 2 , описанной в клетках млекопитающих (42). Этот противоположный эффект можно объяснить различиями во взаимодействии мутантного Vpr R90K с гомологичными белками-мишенями дрожжей и человека, с которыми взаимодействует Vpr, вызывая остановку G 2 ; R90K Vpr может иметь более сильное взаимодействие с белком дрожжей, но более слабое взаимодействие с человеческим белком.Эту возможность можно проверить, когда будет идентифицирован исходный белок-мишень для индукции ареста G 2 .

    Мутации Vpr, по-видимому, почти одинаково влияют на локализацию в ядре в клетках человека и дрожжей. Четыре из мутаций, которые, как было обнаружено, снижают или устраняют локализацию слитого белка GFP-Vpr на ободе ядра у делящихся дрожжей (E25K, F34I, H71R и делеция C77), также влияют на локализацию в ядре в клетках человека. Водика и др. (46) сообщили, что Vpr LAI локализуется на ядерной мембране в клетках человека и почкующихся дрожжей, точно так же, как слитый белок у делящихся дрожжей.Они также показали, что мутантные белки F34I и H71R Vpr не локализуются на ядерной мембране в клетках человека, что хорошо согласуется с представленными здесь результатами, показывающими, что мутация F34I почти устраняет локализацию на ядерной мембране, а H71R значительно уменьшает ее. Яо и др. (49) сообщили, что E25K и делеция C77 продуцируют большое количество белка Vpr в цитоплазме. Это близкое совпадение между клетками человека и дрожжей в отношении эффектов мутаций на остановку G 2 и ядерную локализацию предполагает, что в большинстве случаев результаты исследований дрожжей по мутации Vpr также применимы к клеткам человека.

    Другим признаком высокой консервативности функций Vpr является то, что области Vpr, важные для функции, кажутся сходными в клетках человека и делящихся дрожжей. Для ареста G 2 у делящихся дрожжей точечные мутации на амино-конце не влияют на арест G 2 , за исключением мутации h43R, обсуждаемой ниже. Однако ряд точечных мутаций на С-конце Vpr влияет на остановку G 2 . Сильное влияние карбокси-конца на остановку G 2 иллюстрируется парами близлежащих аминокислот (H78R плюс S79A и R88K плюс R90K), мутация которых оказывает противоположное действие на остановку G 2 .Затем точечные мутации, проанализированные у делящихся дрожжей, указывают на то, что карбоксиконцевой конец особенно важен для ареста G 2 . Тот же самый вывод был сделан из исследований Vpr-индуцированной остановки G 2 в клетках млекопитающих (7, 30, 42, 48).

    Области Vpr, необходимые для локализации в ядре, также кажутся сходными в клетках человека и делящихся дрожжей. Замены пролина, которые разрушают α-спирали, в пяти разных положениях N-концевого домена Vpr нарушают ядерную локализацию в клетках млекопитающих (7, 31).У делящихся дрожжей две N-концевые делеции и три одиночные замены (E25K, h43R и F34I) внутри или вблизи конца N-концевой α-спирали почти устранили ядерную локализацию (Fig. C). Т.о., структурный домен Vpr, необходимый для локализации в ядре, одинаков в клетках человека и делящихся дрожжей.

    Это исследование мутаций Vpr показывает, что мутация часто по-разному влияет на функции Vpr, и предполагает, что некоторые функции Vpr являются независимыми. В частности, четыре мутации (E25K, F34I, H78R и R88K) имеют существенно различающиеся эффекты на остановку G 2 и локализацию в ядре.Лучшим примером этой точки зрения является мутация E25K, которая почти устраняет локализацию в ядерном ободе без какого-либо обнаруживаемого влияния на уровни ареста G 2 . Сходные наблюдения в клетках млекопитающих привели к предположению, что остановка G 2 и локализация в ядре являются независимыми функциями, опосредованными двумя разными структурными доменами Vpr (10, 30, 46).

    Эти исследования на делящихся дрожжах также показывают, что G 2 арест не требуется для уничтожения клеток.Сравнения индуцированной Vpr гибели клеток делящихся дрожжей и клеток человека ограничены небольшим количеством доступных данных о влиянии мутаций Vpr на гибель клеток человека. Только одна изученная здесь мутация была также исследована в клетках человека, и в соответствии с нашими наблюдениями у делящихся дрожжей делеция C77 нарушает как остановку G 2 , так и гибель клеток в Т-клетках Jurkat (48). Однако, вопреки нашему мнению, что арест G 2 и уничтожение клеток являются отдельными функциями Vpr, Yao et al.(48) предположили, что остановка G 2 коррелирует с уничтожением клеток. В их исследованиях было показано, что две из четырех одиночных замен (I63K и R80A) снижают как остановку G 2 , так и гибель клеток. В нашем исследовании уменьшение ареста G 2 и гибели клеток также было вызвано двумя точечными мутациями (h43R и H71R) и всеми четырьмя делециями либо с N-, либо с C-конца. Однако несоответствие между эффектом на остановку G 2 и уничтожением клеток наблюдалось в семи одиночных аминокислотных заменах, включая четыре мутации в N-концевой α-спиральной области (W18R, E24G, E25K и F34I), одна мутация в богатом лейцином домене (W54R) и две мутации на С-конце (H78R и R88K). Эти данные убедительно подтверждают идею о том, что Vpr использует разные пути, чтобы вызвать остановку G 2 и гибель клеток. Эта идея дополнительно подтверждается нашими недавними исследованиями (8), показывающими, что Vpr-индуцированная остановка G 2 может быть подавлена ​​нефосфорилируемой мутацией Tyr15 Cdc2. В этом мутантном штамме дрожжей Vpr не вызывает остановку G 2 , но Vpr по-прежнему способен убивать клетки так же эффективно, как в штамме дрожжей дикого типа. Основываясь на этом результате и данных анализа мутантов Vpr, мы заключаем, что арест G 2 и гибель клеток являются независимыми функциями Vpr у делящихся дрожжей.Другие мутации, особенно такие, как E25K, которая устраняет гибель клеток, но вызывает остановку G 2 дикого типа у делящихся дрожжей, необходимо проанализировать в клетках человека, чтобы определить, являются ли остановка G 2 и апоптоз независимыми функциями Vpr в клетках человека.

    В отличие от независимости ареста G 2 от ядерной локализации и уничтожения клеток у делящихся дрожжей, анализ мутантов предполагает, что ядерная локализация и уничтожение клеток связаны. Мутации, нарушающие ядерную локализацию (E25K, h43R, F34I и H71R), также ослабляют способность Vpr убивать клетки, указывая на то, что Vpr должен локализоваться в ядерном ободе, чтобы быть эффективным в индукции клеточной гибели. Однако ядерной локализации недостаточно для уничтожения клеток. Мутации (E24G и W54R), снижающие способность Vpr убивать клетки, по-прежнему вызывают его локализацию в ядерном ободе. Альтернативное объяснение данных о мутациях, полученных с помощью делящихся дрожжей, заключается в том, что функциональные домены, необходимые для ядерной локализации и уничтожения клеток, просто перекрываются и что, по чистой случайности, ни одна мутация, включенная в это исследование, не разделяет ядерную локализацию и уничтожение клеток.Эта возможность подтверждается точечными мутациями, которые указывают на то, что домен уничтожения клеток включает большую часть белка Vpr и простирается за пределы домена ядерной локализации (Fig. b и c).

    Хотя точечные мутации предполагают, что карбоксильный конец Vpr важен для ареста G 2 и что N-концевая α-спираль важна для ядерной локализации, делеции, напротив, как правило, указывают на то, что общая структура белок Vpr необходим для уровней функций дикого типа. Особенно интересное наблюдение заключается в том, что N-конец Vpr, по-видимому, играет некоторую роль в остановке G 2 , поскольку делеция N15 уменьшает остановку G 2 , а делеция N27 устраняет остановку G 2 . Эта делеция может повлиять на остановку G 2 посредством структурных изменений в Vpr. Третичные структуры амино- и карбокси-хвостов Vpr не известны, но они могут быть близки друг к другу на концах белка, где они могут взаимодействовать друг с другом (рис.). Если амино-хвост служит для удержания карбокси-хвоста в структуре, необходимой для связывания с белком, что приводит к остановке G 2 , то аминоконцевые делеции могут повлиять на остановку G 2 , даже если карбоксильная часть содержит фактический сайт связывания. . Структурные изменения также могут объяснить способность двух точечных мутаций (h43R и H71R) прерывать все три функции. Эти две аминокислоты присутствуют ближе к концу каждой предполагаемой α-спирали и могут представлять сайты, которые имеют решающее значение для поддержания общей структуры, необходимой для функций Vpr. Следовательно, эти сайты могут быть потенциальными мишенями при разработке схем лечения против Vpr.

    Эти исследования мутантных белков Vpr имеют большое значение для функций квазивидов Vpr, присутствующих во время ВИЧ-инфекции. Десять из 13 точечных мутаций, исследованных в этом исследовании, влияли на одну или несколько из трех функций Vpr (G 2 арест, ядерная локализация и уничтожение клеток). Восемь из этих 10 точечных мутаций оказывали значительное влияние только на одну или две из этих трех функций, оставляя другие функции неизменными.Затем мутации Vpr часто имеют функциональные последствия и часто затрагивают только подмножество функций. Даже Vpr LAI и Vpr NL4-3 имели тонкие различия в индукции морфологических изменений у делящихся дрожжей, указывая на то, что все варианты Vpr функционально не эквивалентны. Эти наблюдения поднимают вопрос о том, обладают ли все индивидуальные квазивиды Vpr идентичной G 2 остановкой, ядерной локализацией и активностью апоптоза. Сходные эффекты мутаций Vpr на эту активность в делящихся дрожжах и клетках человека указывают на то, что дрожжевая система будет полезна для оценки функциональных вариаций встречающихся в природе вариантов Vpr.

    БЛАГОДАРНОСТЬ

    Мы благодарим Майкла Эмермана и Жозефину Сайр за точечные и делеционные мутантные генов vpr , соответственно, Ziwei Huang за предоставление координат для создания третичной структуры белка Vpr, Jun Yang за помощь в секвенировании ДНК и Раму Йогеву за поддержку. Антисыворотка HIV-1 Vpr NL4-3 была получена в рамках Программы исследований и эталонных реагентов по СПИДу, Отдел СПИДа, NIAID, NIH, и предоставлена ​​Velpandi Ayyavoo.

    Эта работа была частично поддержана за счет средств Фонда педиатрического факультета Чикаго и гранта Национального института здравоохранения 1R29-AI-40891-091 (YZ).

    ССЫЛКИ

    1. Ayyavoo V, Mahboubi A, Mahalingam S, Ramalingam R, Kudchodkar S, Williams WV, Green DR, Weiner DB. HIV-1 Vpr подавляет иммунную активацию и апоптоз посредством регуляции ядерного фактора каппа B. Nat Med . 1997; 3:1117–1123. [PubMed] [Google Scholar]2. Бухамдан М., Бенишу С., Рей Ф., Наварро Дж.-М., Агостини I, Спайр Б., Камонис Дж., Слупфауг Г., Винье Р., Бенарус Р., Сир Дж.Белок Vpr вируса иммунодефицита человека типа 1 связывается с ферментом репарации ДНК урацил-ДНК-гликозилазой. Дж Вирол. 1996; 70: 697–704. [Бесплатная статья PMC] [PubMed] [Google Scholar]3. Чоу П.Ю., Фасман Г.Д. Эмпирические предсказания конформации белка. Анну Рев Биохим. 1978; 47: 251–276. [PubMed] [Google Scholar]4. Коннор Р.И., Чен Б.К., Чое С., Ландау Н.Р. Vpr необходим для эффективной репликации вируса иммунодефицита человека типа 1 в мононуклеарных фагоцитах. Вирусология. 1995; 206: 935–944. [PubMed] [Google Scholar]5.Conti L, Rainaldi G, Matarrese P, Varano B, Rivabene R, Columba S, Sato A, Belardelli F, Malorni W, Gessani S. Белок vpr ВИЧ-1 действует как негативный регулятор апоптоза в лимфобластоидной Т-клеточной линии человека. : возможные последствия для патогенеза СПИДа. J Эксперт Мед. 1998; 187:403–413. [Бесплатная статья PMC] [PubMed] [Google Scholar]6. Cronan JJ, Narasimhan M, Rawlings M. Инсерционное восстановление альфа-комплементации бета-галактозидазы. Ген. 1988; 70: 161–170. [PubMed] [Google Scholar]7. Ди Марцио П., Чоу С., Эбрайт М., Нобланч Р., Ландау Н.Р.Мутационный анализ остановки клеточного цикла, ядерной локализации и упаковки вирионов вируса иммунодефицита человека типа 1 Vpr. Дж Вирол. 1995; 69: 7909–7916. [Бесплатная статья PMC] [PubMed] [Google Scholar]8. Старейшина, Р. Т., М. Ю, М. Чен и Ю. Чжао. Tyr15 фосфорилирование Cdc2 необходимо для ареста G2 клеточного цикла, индуцированного Vpr ВИЧ-1, и не зависит от гибели клеток у делящихся дрожжей. Представлено для публикации. [В паблике] 9. Фабр Э., Хёрт Э. Генетика дрожжей для анализа комплекса ядерных пор и ядерно-цитоплазматического транспорта.Анну Рев Жене. 1997; 31: 277–313. [PubMed] [Google Scholar] 10. Fletcher TM, 3rd, Brichacek B, Sharova N, Newman MA, Stivahtis G, Sharp PM, Emerman M, Hahn BH, Stevenson M. Ядерный импорт и функции остановки клеточного цикла белка Vpr ВИЧ-1 кодируются двумя отдельными генами в ВИЧ-2/SIV(SM) EMBO J. 1996;15:6155–6165. [Бесплатная статья PMC] [PubMed] [Google Scholar]11. Гиббс Дж. С., Лакнер А. А., Ланг С. М., Саймон М. А., Сегал П. К., Даниэль М. Д., Дерозье Р. С. Прогрессирование до СПИДа при отсутствии гена vpr или vpx .Дж Вирол. 1995; 69: 2378–2383. [Бесплатная статья PMC] [PubMed] [Google Scholar]12. Goh WC, Rogel ME, Kinsey CM, Michael SF, Fultz PN, Nowak MA, Hahn BH, Emerman M. Vpr ВИЧ-1 увеличивает экспрессию вируса путем манипулирования клеточным циклом: механизм отбора Vpr in vivo. Нат Мед. 1998; 4: 65–71. [PubMed] [Google Scholar] 13. Горлич Д., Маттай И. В. Ядерно-цитоплазматический транспорт. Наука. 1996; 271:1513–1518. [PubMed] [Google Scholar] 14. Хе Дж., Чоу С., Уокер Р., Ди Марцио П., Морган Д.О., Ландау Н.Р.Вирусный белок R (Vpr) вируса иммунодефицита человека типа 1 останавливает клетки в фазе G 2 клеточного цикла путем ингибирования активности p34 cdc2 . Дж Вирол. 1995; 69: 6705–6711. [Бесплатная статья PMC] [PubMed] [Google Scholar]15. Хайнзингер Н., Букински М., Хаггерти С., Рэгланд А., Кевалрамани В., Ли М., Гендельман Х., Ратнер Л., Стивенсон М., Эмерман М. Белок Vpr вируса иммунодефицита человека типа 1 влияет на ядерную локализацию вирусных нуклеиновых кислот в неделящихся клетках-хозяевах. .Proc Natl Acad Sci USA. 1994;91:7311–7315. [Бесплатная статья PMC] [PubMed] [Google Scholar]16. Hoch J, Lang SM, Weeger M, Stahl-Hennig C, Coulibaly C, Dittmer U, Hunsmann G, Fuchs D, Müller J, Sopper S, Fleckenstein B, Überla K T. Делеционный мутант vpr вируса иммунодефицита обезьян вызывает СПИД у макак-резусов. Дж Вирол. 1995; 69: 4807–4813. [Бесплатная статья PMC] [PubMed] [Google Scholar]17. Инк Б., Цёрниг М., Баум Б., Хаджибагери Н., Джеймс С., Читтенден Т., Эван Г. Человек Бак индуцирует гибель клеток у Schizosaccharomyces pombe с морфологическими изменениями, сходными с таковыми при апоптозе в клетках млекопитающих. Мол Селл Биол. 1997; 17: 2468–2474. [Бесплатная статья PMC] [PubMed] [Google Scholar]18. James C, Gschmeissner S, Fraser A, Evan GI. CED-4 индуцирует конденсацию хроматина в Schizosaccharomyces pombe и ингибируется прямой физической ассоциацией с CED-9. Карр Биол. 1997; 7: 246–252. [PubMed] [Google Scholar] 19. Jowett J B, Planelles V, Poon B, Shah N P, Chen M-L, Chen I S Y. Ген вируса иммунодефицита человека типа 1 vpr арестовывает инфицированные Т-клетки в фазе G 2 + M клеточного цикла.Дж Вирол. 1995;69:6304–6313. [Бесплатная статья PMC] [PubMed] [Google Scholar]20. Jurgensmeier JM, Krajewski S, Armstrong RC, Wilson GM, Oltersdorf T, Fritz LC, Reed JC, Ottilie S. Bax- и Bak-индуцированная гибель клеток у делящихся дрожжей Schizosaccharomyces pombe . Мол Биол Селл. 1997; 8: 325–339. [Бесплатная статья PMC] [PubMed] [Google Scholar]21. Кнеллер Д. Г., Коэн Ф. Э., Лэнгридж Р. Усовершенствования в предсказании вторичной структуры белка с помощью усовершенствованной нейронной сети. Дж Мол Биол. 1990; 214:171–182.[PubMed] [Google Scholar] 22. Ланг С.М., Вигер М., Шталь-Хенниг С., Кулибали С., Хунсманн Г., Мюллер Дж., Мюллер-Хермелинк Х., Фукс Д., Вахтер Х., Даниэль М.М., Дерозьер Р.С., Флекенштейн Б. Важность vpr для инфекции макак-резусов с обезьяньим вирусом иммунодефицита. Дж Вирол. 1993; 67: 902–912. [Бесплатная статья PMC] [PubMed] [Google Scholar]23. Lee MG, Nurse P. Комплементация, используемая для клонирования человеческого гомолога гена cdc2 , регулирующего клеточный цикл делящихся дрожжей. Природа. 1987; 327:31–35.[PubMed] [Google Scholar] 24. Леви Д.Н., Фернандес Л.С., Уильямс В.В., Вайнер Д.Б. Индукция дифференцировки клеток вирусом иммунодефицита человека 1 vpr . Клетка. 1993; 72: 541–550. [PubMed] [Google Scholar] 25. Леви Д. Н., Рафаэли И., МакГрегор Р. Р., Вайнер Д. Б. Сывороточный Vpr регулирует продуктивную инфекцию и латентность вируса иммунодефицита человека типа 1. Proc Natl Acad Sci USA. 1994; 91:10873–10877. [Бесплатная статья PMC] [PubMed] [Google Scholar]26. Леви Д.Н., Рафаэли Ю., Вайнер Д.Б. Внеклеточный белок Vpr увеличивает восприимчивость клеток к репликации вируса иммунодефицита человека и реактивирует вирус из латентного состояния.Дж Вирол. 1995; 69: 1243–1252. [Бесплатная статья PMC] [PubMed] [Google Scholar]27. Lu YL, Spearman P, Ratner L. Локализация вирусного белка R вируса иммунодефицита человека типа 1 в инфицированных клетках и вирионах. Дж Вирол. 1993; 67: 6542–6550. [Бесплатная статья PMC] [PubMed] [Google Scholar]28. Luo Z, Butcher D J, Murali R, Srinivasan A, Huang Z. Структурные исследования синтетических пептидных фрагментов, полученных из белка Vpr ВИЧ-1. Biochem Biophys Res Commun. 1998; 244:732–736. [PubMed] [Google Scholar] 29. Макреди И.Г., Кастелли Л.А., Хьюиш Д.Р., Киркпатрик А., Уорд А.С., Азад А.А.Домен Vpr вируса иммунодефицита человека типа 1, содержащий повторяющиеся аминокислотные мотивы H(S/F)RIG, вызывает остановку роста клеток и структурные дефекты. Proc Natl Acad Sci USA. 1995; 92: 2770–2774. [Бесплатная статья PMC] [PubMed] [Google Scholar]30. Mahalingam S, Ayyavoo V, Patel M, Kieber-Emmons T, Weiner DB. Ядерный импорт, включение вириона и остановка/дифференциация клеточного цикла опосредованы различными функциональными доменами вируса иммунодефицита человека типа 1 Vpr. Дж Вирол. 1997; 71: 6339–6347. [Бесплатная статья PMC] [PubMed] [Google Scholar]31.Махалингам С., Коллман Р. Г., Патель М., Монкен С. Э., Шринивасан А. Функциональный анализ Vpr ВИЧ-1: идентификация детерминант, необходимых для субклеточной локализации. Вирусология. 1995; 212:331–339. [PubMed] [Google Scholar] 32. Махалингам С., Хан С.А., Мурали Р., Джаббар М.А., Монкен С.Е., Коллман Р.Г., Шринивасан А. Мутагенез предполагаемого альфа-спирального домена белка Vpr вируса иммунодефицита человека типа 1: влияние на стабильность и включение вириона. Proc Natl Acad Sci USA. 1995; 92: 3794–3798.[Бесплатная статья PMC] [PubMed] [Google Scholar]33. Nie Z, Bergeron D, Subbramanian RA, Yao XJ, Checroune F, Rougeau N, Cohen EA. Предполагаемая альфа-спираль 2 вируса иммунодефицита человека типа 1 Vpr содержит детерминанту, которая отвечает за ядерную транслокацию провирусной ДНК в рост- арестованные клетки. Дж Вирол. 1998;72:4104–4115. [Бесплатная статья PMC] [PubMed] [Google Scholar]34. Пиллер С. С., Юарт Г. Д., Премкумар А., Кокс Г. Б., Гейдж П. В. Белок Vpr вируса иммунодефицита человека типа 1 образует катион-селективные каналы в плоских липидных бислоях.Proc Natl Acad Sci USA. 1996; 93: 115–115. [Бесплатная статья PMC] [PubMed] [Google Scholar]35. Planelles V, Jowett J B, Li Q-X, Xie Y, Hahn B, Chen I S. Индуцированная Vpr остановка клеточного цикла сохраняется среди лентивирусов приматов. Дж Вирол. 1996; 70: 2516–2524. [Бесплатная статья PMC] [PubMed] [Google Scholar]36. Пун Б., Джоуэтт Дж. Б., Стюарт С. А., Армстронг Р. В., Риштон Г. М., Чен И. С. Ю. Вирус иммунодефицита человека типа 1 ген vpr вызывает фенотипические эффекты, сходные с эффектами ДНК-алкилирующего агента, азотистого иприта.Дж Вирол. 1997;71:3961–3971. [Бесплатная статья PMC] [PubMed] [Google Scholar]37. Попов С., Рексач М., Ратнер Л., Блобель Г., Букринский М. Вирусный белок R регулирует стыковку преинтеграционного комплекса ВИЧ-1 с комплексом ядерной поры. Дж. Биол. Хим. 1998; 273:13347–13352. [PubMed] [Google Scholar] 38. Re F, Braaten D, Franke E K, Luban J. Вирус иммунодефицита человека типа 1 Vpr останавливает клеточный цикл в G 2 путем ингибирования активации p34 cdc2 -циклина B. J Virol. 1995; 69: 6859–6864.[Бесплатная статья PMC] [PubMed] [Google Scholar]39. Rogel ME, Wu LI, Emerman M. Ген вируса иммунодефицита человека типа 1 vpr предотвращает пролиферацию клеток при хронической инфекции. Дж Вирол. 1995; 69: 882–888. [Бесплатная статья PMC] [PubMed] [Google Scholar]40. Roques BP, Morellet N, de Rocquigny H, Demene H, Schueler W, Jullian N. Структура, биологические функции и ингибирование белков ВИЧ-1 Vpr и NCp7. Биохимия. 1997; 79: 673–680. [PubMed] [Google Scholar]41. Сэйл Р.А., Милнер-Уайт Э.Дж.RASMOL: биомолекулярная графика для всех. Тенденции биохимических наук. 1995; 20:374. [PubMed] [Google Scholar]42. Selig L, Benichou S, Rogel ME, Wu LI, Vodicka MA, Sire J, Benarous R, Emerman M. Урацил-ДНК-гликозилаза специфически взаимодействует с Vpr как вируса иммунодефицита человека типа 1, так и вируса иммунодефицита обезьян сажистых мангабей, но связывание не происходит. коррелируют с остановкой клеточного цикла. Дж Вирол. 1997; 71:4842–4846. [Бесплатная статья PMC] [PubMed] [Google Scholar]43. Стюарт С.А., Пун Б., Джоуэтт Дж.Б., Чен И.С.Ю.Вирус иммунодефицита человека типа 1 Vpr индуцирует апоптоз после остановки клеточного цикла. Дж Вирол. 1997; 71: 5579–5592. [Бесплатная статья PMC] [PubMed] [Google Scholar]44. Subbramanian RA, Yao X J, Dilhuydy H, Rougeau N, Bergeron D, Robitaille Y, Cohen EA. Локализация Vpr вируса иммунодефицита человека типа 1: ядерный транспорт вирусного белка, модулируемый предполагаемой амфипатической спиральной структурой, и его отношение к биологической активности. Дж Мол Биол. 1998; 278:13–30. [PubMed] [Google Scholar]45. Тристем М., Маршалл С., Карпас А., Хилл Ф.Эволюция лентивирусов приматов: данные vpx и vpr . EMBO J. 1992; 11: 3405–3412. [Бесплатная статья PMC] [PubMed] [Google Scholar]46. Vodicka MA, Koepp DM, Silver PA, Emerman M. Vpr ВИЧ-1 взаимодействует с ядерным транспортным путем, способствуя инфицированию макрофагов. Гены Дев. 1998; 12: 175–185. [Бесплатная статья PMC] [PubMed] [Google Scholar]47. Ван Б., Ге И., Паласантиран П., Сян С., Циглер Дж., Дуайер Д., Рэндл С., Доутон Д., Каннингем А., Саксена Н. Дефекты генов, сгруппированные на С-конце гена vpr ВИЧ-1 в долгосрочной перспективе непрогрессирующая пара мать-ребенок: эволюция in vivo квазивидов vpr в крови и плазме.Вирусология. 1996; 223: 224–232. [PubMed] [Google Scholar]48. Yao XJ, Mouland AJ, Subbramanian RA, Forget J, Rougeau N, Bergeron D, Cohen EA. Vpr стимулирует экспрессию вируса и вызывает гибель клеток в делящихся Т-клетках Jurkat, инфицированных вирусом иммунодефицита человека типа 1. Дж Вирол. 1998;72:4686–4693. [Бесплатная статья PMC] [PubMed] [Google Scholar]49. Yao XJ, Subbramanian RA, Rougeau N, Boisvert F, Bergeron D, Cohen EA. Мутагенный анализ вируса иммунодефицита человека типа 1 Vpr: роль предсказанной N-концевой альфа-спиральной структуры в ядерной локализации Vpr и включении вириона.Дж Вирол. 1995; 69: 7032–7044. [Бесплатная статья PMC] [PubMed] [Google Scholar]50. Чжан С., Расмуссен С., Чанг Л.Дж. Ингибирующие эффекты Vpr и Vpx ВИЧ и SIV на клеточный цикл у дрожжей Schizosaccharomyces pombe . Вирусология. 1997; 230:103–112. [PubMed] [Google Scholar]51. Чжао Ю., Цао Дж., О’Горман М. Р. Г., Ю М., Йогев Р. Влияние экспрессии гена белка R вируса иммунодефицита человека типа 1 ( vpr ) на основную клеточную функцию делящихся дрожжей Schizosaccharomyces pombe . Дж Вирол.1996; 70: 5821–5826. [Бесплатная статья PMC] [PubMed] [Google Scholar]52. Zhao Y, Elder R T, Chen M Z, Cao J. Векторы экспрессии делящихся дрожжей, адаптированные для положительной идентификации генной вставки и слияния GFP. БиоТехники. 1998; 25: 2–4. [PubMed] [Google Scholar]53. Zhao Y, Lieberman H B. Schizosaccharomyces pombe : модель для молекулярных исследований эукариотических генов. ДНК-клеточная биол. 1995; 14: 359–371. [PubMed] [Google Scholar]54. Чжао Ю., Лу Ю. Протокол трансформации дрожжей на основе ацетата лития.В: Li Y M, Zhao Y, редакторы. Практические протоколы в молекулярной биологии. Нью-Йорк, штат Нью-Йорк: Science Press Ltd.; 1996. С. 63–64. [Google Академия]55. Чжао Ю., Ю. М., Чен М., Элдер Р. Т., Ямамото А., Цао Дж. Плейотропные эффекты белка R ВИЧ-1 (Vpr) на морфогенез и выживаемость клеток у делящихся дрожжей и антагонизм пентоксифиллина. Вирусология. 1998; 246: 266–276. [PubMed] [Google Scholar]

    ВИЧ репрограммирует метилом m6Am РНК хозяина с помощью вирусной деградации PCIF1, опосредованной белком Vpr

    m

    6 Ам-модификация клеточной мРНК уменьшается при ВИЧ-инфекции и опосредована Vpr-индуцированной деградацией PCIF1

    Чтобы исследовать метилирование мРНК при ВИЧ-инфекции, мы заразили Т-клетки МТ4 ВИЧ и количественно определили модификации m 6 Am и m 6 A в клеточной мРНК с помощью ЖХ-МС/МС 26,29 . Мы обнаружили, что модификация клеточных мРНК m 6 Am, но не m 6 A, была значительно снижена при инфицировании ВИЧ-1 в Т-клетках (рис. 1a и дополнительная рис. 1a). Поскольку PCIF1 является единственным известным ферментом, который катализирует m 6 Am метилирование РНК 8,9,10 , мы проанализировали экспрессию РНК и белка PCIF1 в клетках МТ4, инфицированных штаммом HIV-1 LAI или NL4-3. Наши результаты показали, что, несмотря на сильную инфекцию, ни один из двух штаммов не снижал уровни мРНК PCIF1 (рис.1b и дополнительный рисунок 1b, дополнительные данные 1). С другой стороны, уровни белка PCIF1 были значительно снижены обоими двумя штаммами ВИЧ дозозависимым образом в Т-клетках MT4 (рис. 1c). Деградация PCIF1 также наблюдалась в первичных Т-клетках CD4 + на 2-й и 3-й дни после заражения (рис. 1d). Кроме того, деградация PCIF1 не ограничивается клеточной линией, поскольку ВИЧ-инфекция также дозозависимо снижает уровень белка PCIF1 в клетках HeLa, инфицированных псевдовирусом ВИЧ, только с одним циклом репликации, что позволяет предположить, что деградация зависела от репликации ВИЧ (дополнительная рис. 1с). В целом эти результаты показывают, что метилирование m 6 Am РНК было снижено из-за ВИЧ-опосредованной деградации метилтрансферазного белка PCIF1.

    Рис. 1: ВИЧ-инфекция подавляет m 6 Am модификацию клеточной мРНК с помощью Vpr-индуцированной деградации m 6 Am метилтрансферазы PCIF1.

    a m 6 Ам-модификация клеточной мРНК уменьшается при ВИЧ-инфекции. m 6 Уровни Am были количественно определены в клетках МТ4, инфицированных ВИЧ LAI (MOI = 0.4, 3 сут) по данным ЖХ–МС/МС. n  = 3 биологических независимых эксперимента. Двусторонняя т -тест. Среднее  ± SD, *** p  = 0,0008. b PCIF1 Уровни мРНК не изменяются при ВИЧ-инфекции. Уровни мРНК PCIF1 количественно определяли в клетках МТ4, инфицированных ВИЧ LAI (MOI = 0,4) или HIV NL4-3 (MOI = 2). n  = 3 биологических независимых эксперимента. Двусторонняя т -тест. Среднее  ± SD. c ВИЧ-инфекция снижает PCIF1 в клетках МТ4.Иммуноблотинг PCIF1 и p24 в клетках МТ4, инфицированных ВИЧ LAI или ВИЧ NL4-3 в течение 3 дней. d ВИЧ-инфекция снижает PCIF1 в первичных CD4 + Т-клетках. Иммуноблотинг PCIF1 и p24 в активированных первичных CD4 + Т-клетках, инфицированных ВИЧ LAI (MOI = 1). e PCIF1 подавляется ВИЧ посредством протеасомной деградации. Иммуноблотинг PCIF1, p62 и p24 в клетках МТ4, инфицированных ВИЧ LAI (MOI = 0.4, 3 дня). Клетки инкубировали с ДМСО или MG132 (0,25 мкМ) за 1 день до лизиса. f PCIF1 расщепляется вирусным белком ВИЧ Vpr. Иммуноблоттинг PCIF1 и вирусных белков в клетках HeLa, трансфицированных указанными векторами экспрессии (EV: пустой вектор). г ВИЧ с удаленным Vpr не ухудшает экспрессию белков PCIF1 и ETS1. Иммуноблоттинг указанных белков в клетках МТ4, инфицированных вирусом HIV LAI или HIV LAI Vpr (HIV LAI-∆Vpr ) (MOI = 0. 4, 3 дня). h Vpr взаимодействует с PCIF1. Иммунопреципитацию Flag проводили в клетках HeLa, котрансфицированных плазмидами, экспрессирующими PCIF1 и Flag-меченый Vpr, в течение 2 дней. Экспрессию и обогащение PCIF1 и Vpr определяли вестерн-блоттингом. i Vpr взаимодействует с PCIF1 в Т-клетках. Клетки МТ4, экспрессирующие Flag-PCIF1, инфицировали ВИЧ (MOI = 1) в течение 3 дней с последующей иммунопреципитацией Flag. Экспрессию и обогащение Flag-PCIF1 и Vpr определяли вестерн-блоттингом. j Сайт связывания комплекса E3 Vpr необходим для уменьшения PCIF1. Иммуноблотинг PCIF1 и Vpr в клетках HeLa, трансфицированных плазмидами, экспрессирующими пустой вектор (EV), Vpr или мутантный вектор Vpr-Q65R, в течение 2 дней. k Vpr индуцирует убиквитинирование PCIF1. Иммунопреципитацию HA или FLAG проводили в клетках HeLa, котрансфицированных плазмидами, экспрессирующими Flag-PCIF1, HA-Ub, либо мутант Vpr, либо Vpr-Q65R, в течение 2 дней. Убиквитин, меченный HA, PCIF1, меченный Flag, и экспрессия Vpr были обнаружены с помощью вестерн-блоттинга. Аналогичные результаты были получены в трех независимых экспериментах, и экспрессия GAPDH была показана в качестве контроля загрузки ( c j ).

    Чтобы выявить, какой путь деградации отвечает за подавление PCIF1, клетки МТ4 инфицировали ВИЧ LAI , а затем обрабатывали ингибитором протеасом или лизосом. Деградация PCIF1, вызванная ВИЧ-инфекцией, в значительной степени устранялась протеасомным ингибитором MG132, но не ингибированием лизосом. р62 является субстратом аутофагии и использовался в качестве репортера активности протеасом и лизосом (рис.1e и дополнительный рисунок 2a). Эти результаты позволяют предположить, что PCIF1 расщепляется ВИЧ через протеасомный путь. Геном ВИЧ экспрессирует шесть вспомогательных белков, включая Tat, Rev, Vpu, Vif, Nef и Vpr, четыре из которых (Vpu, Vif, Nef и Vpr), как известно, нацелены на деградацию рестрикционных белков хозяина 30 . Чтобы определить, какой из этих белков участвует в деградации PCIF1, мы сверхэкспрессировали каждый из четырех белков (Vpu, Vif, Nef и Vpr) в клетках HeLa и проанализировали уровни PCIF1. Мы обнаружили, что Vpr как из HIV LAI , так и из HIV NL4-3 снижал экспрессию PCIF1 (рис. 1f). Кроме того, Vpr-индуцированная деградация PCIF1 дозозависимым образом (дополнительная рис. 2b). Чтобы подтвердить, является ли Vpr фактором, ответственным за деградацию PCIF1, клетки инокулировали ВИЧ дикого типа или с удаленным Vpr (∆Vpr). Экспрессия p24 была сравнима как у вирусов дикого типа, так и у вирусов ∆Vpr, в то время как полоса белка Vpr исчезала, а PCIF1 не снижался под действием ∆Vpr ВИЧ (рис.1г). Чтобы исключить роль Vpu, мы провели тот же эксперимент, что и для ∆Vpr, с использованием ВИЧ дикого типа и ∆Vpu. Наши результаты показали, что ∆Vpu не смог спасти деградацию PCIF1 (дополнительный рисунок 2c). В совокупности эти результаты указывают на то, что PCIF расщепляется протеасомой, и предполагают, что HIV Vpr является ключевым белком, участвующим в деградации PCIF1.

    Vpr взаимодействует с факторами хозяина и перепрограммирует комплексы лигазы E3 Cullin4-VprBP (белок, связывающий Vpr) для убиквитинирования и деградации белков хозяина 31,32 . Чтобы исследовать основной механизм индуцированной Vpr деградации PCIF1, мы сначала провели ко-иммунопреципитацию (Co-IP) для определения взаимодействий Vpr и PCIF1. Мы трансфицировали клетки HeLa плазмидами, экспрессирующими PCIF1 и Flag-меченый Vpr, с последующим Co-IP и вестерн-блоттингом. Наши результаты показали, что Vpr обладает способностью взаимодействовать с PCIF1 (рис. 1h). Чтобы определить взаимодействия Vpr-PCIF1 в Т-клетках, мы заразили клетки МТ4, экспрессирующие Flag-меченый PCIF1, ВИЧ LAI в течение 3 дней с последующим Flag-IP и иммуноблоттингом.Наши результаты показали четкое взаимодействие между PCIF1 и Vpr (рис. 1i). Кроме того, мы обнаружили, что и Vpr, и PCIF1 находились в основном в ядре, и в ядре была очевидна деградация PCIF1 (дополнительная рис. 2d). Чтобы исследовать, перепрограммирует ли Vpr комплексы Cullin4-VprBP для убиквитинирования и деградации PCIF1, был сконструирован мутантный Vpr Q65R, который не может связываться с VprBP 33 , чтобы определить его влияние на PCIF1. Мутант Q65R устранял способность Vpr индуцировать деградацию PCIF1 (фиг.1к). Кроме того, обработка MG132 накапливала полиубиквитилированный PCIF1 в клетках, экспрессирующих Vpr, но не мутант Vpr-Q65R (рис. 1k). В целом эти результаты демонстрируют, что Vpr ВИЧ-1 способствует убиквитинированию PCIF1 и деградации протеасомой в комплексе VprBP E3.

    PCIF1 ограничивает инфекцию ВИЧ путем подавления репликации вируса

    Чтобы выяснить, участвует ли PCIF1 в жизненном цикле ВИЧ, мы разработали четыре sgRNA для нокаута (KO) PCIF1 в клетках MT4 (рис. 2a). sgRNA # 1 имеет те же последовательности, что и сообщаемые Boulias et al. 9 . Все четыре sgRNA успешно подавляли экспрессию PCIF1 (рис. 2b). По сравнению с контрольными клетками экспрессия основного белка вируса p24 в клетках PCIF1 KO была значительно повышена (рис. 2b). Экспрессия РНК гена gp120 ВИЧ как в инфицированных клетках, так и в высвобожденных вирусных частицах также была усилена в клетках KO (дополнительная рис. 3a, b). Эти результаты предполагают, что PCIF1 ограничивает ВИЧ-инфекцию. Чтобы дополнительно подтвердить эти результаты с помощью другого подхода, мы использовали две конструкции кшРНК для нокдауна экспрессии PCIF1.ShRNAs значительно мешали экспрессии мРНК и белка PCIF1 (дополнительная рис. 3c). Высвобожденная частица ВИЧ, экспрессия белка p24 и экспрессия РНК gp120 были значительно усилены PCIF1 KD (дополнительная рис. 3c, d).

    Рис. 2: PCIF1 ограничивает заражение ВИЧ, ингибируя его транскрипцию.

    a c PCIF1 ингибирует ВИЧ. a Иллюстрация 4 sgRNA. b , c ELISA р24 проводили в клетках МТ4, трансдуцированных указанными лентивирусными векторами, а затем инфицированных ВИЧ LAI ( b MOI = 0.01, c MOI = 0,2) в течение 3 дней. Резистентный к sgRNA дикий тип (PCIF1) или неактивный мутант (APPA) был сверхэкспрессирован либо в контрольных клетках, либо в клетках PCIF1 KO. Экспрессию белка PCIF1 определяли вестерн-блоттингом. б * р  = 0.02, **** р  = 0.0000047, *** р  = 0.0009, ** р  =0.03.0.0.0 c * p  = 0,0036, **** p  = 4,13E-06, **** p  = 9,65701E-06, нс, не значимо. d , e PCIF1 не влияет на проникновение или высвобождение ВИЧ.Инфекцию ВИЧ выявляли с помощью анализа люциферазы, проведенного в клетках 293FT с нокаутом PCIF1, инфицированных псевдовирусом ВИЧ (HIVpp-luc, MOI = 0,2, 2 дня). **** р  = 0,000064. e p24 ELISA проводили в супернатанте контрольных или нокаутных по PCIF1 клеток 293FT, трансфицированных инфекционным клоном HIV LAI (2 дня). ** р  = 0,0061. f , g PCIF1 не влияет на преинтеграцию и интеграцию ВИЧ. Контрольные клетки и клетки PCIF1 KO Jurkat инфицировали однократным циклом HIVpp-luc.Образование кДНК поздней обратной транскриптазы (поздняя RT) через 10 ч ( и ), а также интегрированной провирусной ДНК через 48 ч ( г ) оценивали с помощью количественной ПЦР. нс, не имеет значения. h , i PCIF1 ингибирует транскрипцию, но не трансляцию ВИЧ. ч Контроль или нокаут PCIF1 Клетки Jurkat были инфицированы псевдовирусом ВИЧ (HIVpp-GFP, MOI = 0,2). Транскрипцию ВИЧ количественно определяли с помощью gp120 RT-qPCR. ** p  = 0,0012, *** p  = 0.00073. i Экспрессию белка ВИЧ определяли путем количественного определения уровней репортера GFP с использованием проточной цитометрии (3 дня). **** р  = 1.4053E-08. j , k PCIF1 ингибирует репликацию ВИЧ в CD4 + первичных Т-клетках. Активированные первичные CD4 + Т-клетки от доноров 1 и 2 трансдуцировали с помощью кшРНК PCIF1 или контрольной кшРНК (shNC). После реактивации клетки инфицировали ВИЧ LAI в течение 3 дней, уровни р24 измеряли с помощью ELISA. Уровни мРНК PCIF1 определяли с помощью RT-qPCR. j *** p  = 0,002, ** p  = 0,029. к *** р  = 0,0002, * р  = 0,04. Все данные представлены как среднее  ± SD и проанализированы с помощью двустороннего t -критерия в b k . n  = 3 ( c k ) или 4 ( b ) независимых экспериментов. Аналогичные результаты иммуноблоттинга были получены в трех независимых экспериментах в b и c . Экспрессия GAPDH была показана в качестве контроля загрузки.

    PCIF1 состоит из двух основных областей, включая домены метилтрансферазы и хеликазы. Сайт активного фермента с мотивом NPPF в метилтрансферазе необходим для распознавания субстрата и катализа 8 . Чтобы определить, отвечает ли метилтрансферазная активность PCIF1 за рестрикцию ВИЧ, были проведены эксперименты по спасению путем введения либо устойчивого к sgRNA PCIF1 дикого типа (WT), либо каталитически неактивного PCIF1 (APPA) обратно в клетки KO. В контрольных клетках сверхэкспрессия PCIF1 дикого типа, но не мутанта APPA, ингибировала экспрессию p24.Более того, в клетках KO, в то время как экспрессия WT PCIF1 восстанавливала репликацию ВИЧ, мутант APPA не влиял на репликацию ВИЧ (рис. 2c и дополнительная рис. 3e). Эти результаты подтверждают, что каталитически активный PCIF1 ингибирует ВИЧ-инфекцию.

    Чтобы выяснить, какие этапы жизненного цикла ВИЧ ингибируются PCIF1, мы использовали две системы вирусной инфекции с одним циклом и клетки PCIF1 KO 293FT. В первом подходе мы использовали псевдовирус ВИЧ, предварительно упакованный с белком оболочки VSV-G, в котором отсутствует белок оболочки ВИЧ, и поэтому он не может быть упакован и высвобожден.Контрольные (не нацеленные на sgRNA) или PCIF1 KO (sgPCIF1) клетки 293FT инфицировали псевдовирусом (HIVpp-luc) и количественно определяли экспрессию люциферазы. Наши результаты показывают, что ВИЧ-инфекция усиливалась в клетках PCIF1 KO (рис. 2d и дополнительная рис. 3f). В соответствии с этими выводами, Т-клетки MT4 или Jurkat, препятствующие экспрессии PCIF1 с использованием кшРНК, также увеличивали репликацию псевдовируса (дополнительная рис. 3g, h). Эти результаты свидетельствуют о том, что PCIF1 не влиял на упаковку или высвобождение частиц ВИЧ. Чтобы исследовать, действует ли PCIF1 на проникновение ВИЧ в клетки-хозяева, инфекционный вектор кДНК HIV LAI был непосредственно трансфецирован в клетки 293FT без необходимости стадий проникновения вируса. Вирус реплицировался и высвобождался в контрольных и КО клетках. Высвобожденные вирусные частицы были количественно оценены с помощью p24, и наблюдалось значительное увеличение количества клеток KO, что позволяет предположить, что PCIF1 не влиял на начальный этап жизненного цикла ВИЧ (рис. 2e). После проникновения вируса в клетки геномная РНК ВИЧ подвергается обратной транскрипции в вирусную ДНК и впоследствии интегрируется в геном хозяина с помощью интегразы ВИЧ.Чтобы определить, влияет ли PCIF1 на предварительную интеграцию и интеграцию, была выбрана колония нокаута PCIF1, которая была лишена экспрессии PCIF1 (дополнительная рис. 3i). Контрольные клетки и клетки PCIF1 KO Jurkat инфицировали однократным циклом HIVpp-luc. Тотальную ДНК экстрагировали через 10 и 48 ч, а образование кДНК поздней обратной транскриптазы (поздняя ОТ), а также интегрированной провирусной ДНК оценивали с помощью количественной ПЦР (рис. 2f, g). Сравнительный анализ образования кДНК поздней ОТ ВИЧ через 10 ч после заражения (рис.3f) показал небольшой эффект PCIF1 на предварительную интеграцию ВИЧ. Комплексный анализ ДНК провируса ВИЧ с помощью Alu-viral LTR qPCR показал, что PCIF1 не влиял на интеграцию ВИЧ через 48 часов после заражения (рис. 3g). Таким образом, PCIF1 может влиять на фазу репликации или трансляции ВИЧ. Для анализа репликации и трансляции ВИЧ контрольные клетки и Т-клетки KO Jurkat инфицировали псевдовирусом с однократным циклом HIVpp-GFP и количественно определяли экспрессию GFP. Кроме того, экспрессию РНК ВИЧ анализировали во время одного цикла репликации ВИЧ.На 2-й день после заражения уровень РНК gp120 был значительно увеличен (примерно в 2 раза), а эффект был дополнительно усилен примерно в 3 раза через 3 дня после заражения (рис. 2h). Экспрессия GFP соответственно увеличилась в 3 раза через 3 дня после заражения (рис. 2i). Эти результаты позволяют предположить, что истощение PCIF1 положительно повлияло на репликацию ВИЧ.

    Рис. 3: Идентификация m 6 Am-модифицированных клеточных генов, измененных ВИЧ-инфекцией.

    a m 6 Пики Am-Exo-MeRIP в 5’UTR снижены в клетках PCIF1 KO.Метагенный анализ пиков m 6 Am-Exo-MeRIP вблизи сайта начала транскрипции (TSS) всех экспрессированных генов в контрольных клетках или клетках PCIF1 KO Jurkat. b m 6 Пики Am-Exo-MeRIP в 5’UTR снижены в ВИЧ-инфицированных клетках. Метагенный анализ пиков m 6 Am-Exo-MeRIP в клетках Jurkat, ложно инфицированных или инфицированных ВИЧ LAI при множественности множественности 4. c m 6 Пики Am изменены ВИЧ-инфекцией. m 6 Пики A-MeRIP были сопоставлены с геномом человека.А пики, расположенные в 5’UTR и уменьшенные в клетках PCIF1 KO, рассматривались как высокодостоверные пики m 6 Am. Из них пики, которые уменьшаются при ВИЧ-инфекции, были показаны как потенциальные пики m 6 Am, измененные ВИЧ. Все пики от до с были консервативными пиками, полученными из двух независимых выборок. d ВИЧ-измененный m 6 Гены Am обогащены категорией транскрипционных факторов. Анализ молекулярной функции GO был выполнен в 854 м 6 генов Am, измененных ВИЧ, с использованием GSEA (http://www.gsea-msigdb.org/gsea/msigdb/annotate.jsp). e На графике Венни показаны 18 измененных ВИЧ факторов транскрипции m6Am-мишеней. 854 ВИЧ-измененных гена m6Am перекрывались с 93 генами, регулирующими транскрипцию, и базой данных по взаимодействию с ВИЧ (перечислены в дополнительной таблице 4, https://www.ncbi.nlm.nih.gov/genome/viruses/retroviruses/hiv-1/ взаимодействия/). f m 6 Пик Am-Exo-MeRIP гена ETS1 в 5’UTR снижен в клетках PCIF1 KO и ВИЧ-инфицированных клетках. Геномные треки гена ETS1 были построены с так называемыми пиками m 6 A.На правой панели увеличены пики m 6 Am. Показан один представитель двух экспериментов. г Кинетика мРНК ETS1 при ВИЧ-инфекции. Экспрессию мРНК ETS1 количественно определяли в клетках МТ4, инфицированных ВИЧ LAI , при МВД 0,4 в течение 1, 2 или 3 дней. n  = 3 независимых эксперимента. Двусторонняя т -тест. Среднее  ± SD. * р  = 0,039.

    Затем мы исследовали функцию PCIF1 в первичных Т-клетках CD4.Первичные Т-клетки CD4 активировали с использованием антител к CD3 и CD28. Две специфические кшРНК, нацеленные на PCIF1, были смешаны в виде пула для повышения эффективности нокдауна. Нокдаун-клетки обогащали путем отбора пуромицином в течение 5 дней. Два донора были использованы для исключения индивидуальных различий. Уровни мРНК PCIF1 были значительно снижены (рис. 2j, k). Затем нокдаунные клетки инфицировали ВИЧ LAI в течение 3 дней. В соответствии с результатами на МТ4 и Т-клетках Jurkat, нокдаун PCIF1 увеличивал экспрессию р24 более чем в 7 раз у обоих доноров (рис.2и). Затем мы спросили, зависит ли способность PCIF1 ингибировать ВИЧ от типа штамма. Чтобы ответить на этот вопрос, мы истощили PCIF1 в клетках THP1 и дифференцировали их в макрофаги с последующим инфицированием с использованием ВИЧ BaL , CCR5-тропного штамма. Наши результаты показывают, что экспрессия мРНК gp120 увеличивалась за счет истощения PCIF1 (дополнительная рис. 3j, k). В совокупности эти результаты показывают, что PCIF1 является широким ингибитором ВИЧ, который регулирует CXCR4 и CXCR5-тропную репликацию вируса в первичных CD4 Т-клетках и макрофагах.

    PCIF1 не метилирует геномную РНК ВИЧ

    Существует два возможных механизма, с помощью которых PCIF1 регулирует транскрипцию ВИЧ: (1) Транскрипты ВИЧ метилируются PCIF1 и, таким образом, влияют на их стабильность. (2) m 6 Am-модифицированные гены хозяина изменяются с помощью PCIF1, который затем регулирует транскрипцию ВИЧ. Чтобы выяснить, модифицируются ли транскрипты ВИЧ с помощью PCIF1, мы выполнили MeRIP-seq в контрольных и PCIF1 KO Jurkat Т-клетках, инфицированных ВИЧ. Количественное определение модифицированных нуклеотидов в контрольных клетках и клетках PCIF1 KO методом ЖХ/МС-МС показало, что m 6 Am не определялся в клетках PCIF1 KO по сравнению с контрольными клетками, в то время как уровни m 6 A не изменились в клетках PCIF1 KO (дополнительная информация). Инжир.4а, б). У позвоночных модификация m 6 A обычно находится рядом с 3′-стоп-кодонами мРНК 2,3 , тогда как модификация m 6 Am находится рядом с 5′-концом мРНК 6,7,8,9 ,10 . Три высокоинтенсивных пика m 6 A были обнаружены в геномной РНК ВИЧ. Один был в 5’UTR, два других были рядом с 3’UTR. Предполагалось, что пики вблизи 3’UTR будут пиками m 6 A, и они также были обнаружены в предыдущих исследованиях 19,21,23 .Неудивительно, что пики около 3’UTR не изменились под действием PCIF1 KO. Примечательно, что пик в 5’UTR также не изменился в клетках PCIF1 KO по сравнению с контрольными клетками, что позволяет предположить, что это была модификация m 6 A, а не модификация m 6 Am (дополнительная рис. 4c, d) . Эти результаты предполагают, что PCIF1 не модифицирует транскрипты ВИЧ, и, таким образом, исключают первую возможность механизма, с помощью которого PCIF1 регулирует транскрипцию ВИЧ.

    Идентификация m

    6 Ам-модифицированные гены хозяина

    Затем мы исследовали второй возможный механизм регуляции PCIF1 транскрипции ВИЧ.Чтобы определить, какие гены-хозяева модифицируются PCIF1 и регулируют ингибирование ВИЧ, мы провели иммунопреципитационное секвенирование m 6 A-метилированной РНК (MeRIP-Seq) с использованием антител m 6 A в контрольных и PCIF1 KO клеточных линиях Jurkat, а также клетки, инфицированные ВИЧ (дополнительный рисунок 5). Поскольку m 6 A и m 6 Am структурно сходны и оба могут распознаваться антителами m 6 A, в предыдущих сообщениях предполагалось, что пики на 5′-конце мРНК, как ожидается, содержат m 6 Am. модификации 34 .В соответствии с предыдущими наблюдениями 10 глобальное распределение m 6 A в теле гена и 3’UTR не сильно отличалось от контрольных клеток (дополнительная рис. 5a, b), что позволяет предположить, что PCIF1 не влиял на m по всему геному. 6 Распределение. Мы наблюдали небольшое уменьшение 5′-конца мРНК в клетках PCIF1 KO и ВИЧ-инфицированных клетках (дополнительная фиг. 5a, b). Мы провели анализ мотивов названных пиков, и все группы имели DRACH (D = A, G, U; RA, G; H = A, C, U) m 6 Консенсус A в качестве общего мотива, предполагая, что большинство пики были m 6 пиков A (дополнительный рис.5в). Эти результаты позволяют предположить, что m 6 A MeRIP-Seq не может быть идеальным методом для прямой идентификации m 6 Am-модифицированных транскриптов.

    Для идентификации m 6 Am-обогащенных РНК по всему транскриптому мы использовали m 6 Am-Exo-Seq, методологию, недавно разработанную Sendinc et al. 10 , в контрольных и PCIF1 KO клетках Jurkat. Параллельно m 6 Am-Exo-Seq в клетках, инфицированных ВИЧ, выполняли для идентификации m 6 Am-модифицированных генов, которые были изменены ВИЧ-инфекцией. Плотность пиков m 6 A была резко снижена в 5’UTR, когда PCIF1 был истощен (рис. 3a). Кроме того, в ВИЧ-инфицированных клетках мы наблюдали значительное снижение 5’UTR (рис. 3b). Чтобы идентифицировать m 6 Am-модифицированные гены в Т-клетках, мы сравнили пик m 6 A в 5’UTR в контроле и клетках KO. Пики, которые были истощены или уменьшены в клетках KO по сравнению с контрольными клетками, считались пиками m 6 Am (рис. 3c и дополнительные данные 2, 3).Было 4202 пика в 2237 генах, которые были идентифицированы как пики m 6 Am (дополнительные данные 2 и 3). Анализ мотивов значительных пиков показал консенсус DRACH m 6 A относительно наиболее распространенного мотива в клетках PCIF1 KO (дополнительная рис. 6a). Ранее m6Am-Exo-Seq в клеточной линии меланомы MEL624 идентифицировал 1521 m 6 Am обогащенных генов 10 . Boulias et al. выполнили miCLIP-Seq в контрольных клетках и клетках PCIF1 KO HEK293T и идентифицировали 1850 генов, обогащенных модификацией m 6 Am 9 . Из наших генов, обогащенных m 6 Am в Т-клетках, мы обнаружили 425 и 539 генов, общих с результатами m 6 Am-Exo-Seq и miCLIP-Seq, соответственно. Было обнаружено 217 m 6 генов Am, общих во всех трех анализах, что позволяет предположить, что эти модификации могут не зависеть от типа клеток. Например, у PARP1 был значительный пик рядом с аннотированным местом начала транскрипции в 5’UTR в контрольных клетках, и он был значительно истощен в клетках KO (дополнительная рис. 6b). Две изоформы SMC1 с отчетливым TSS были модифицированы m 6 Am (дополнительная рис.6в). Эти данные согласуются с представлением о том, что модификации m 6 Am находятся преимущественно в проксимальных пиках TSS.

    Идентификация ВИЧ-измененных генов m

    6 Am

    Среди 4202 m 6 генов Am пики m 6 Am 854 генов были снижены ВИЧ, в то время как другие гены сохранили свои пики (дополнительные данные 3 ). Эти результаты дополнительно подтвердили, что ВИЧ-инфекция привела к большим изменениям модификации m 6 Am в Т-клетках (рис. 3c и дополнительный рисунок 7, дополнительные данные 3, 4). Молекулярно-функциональный анализ показывает, что 93 из 854 ВИЧ-измененных генов m 6 Am относятся к категории транскрипционно-регулирующей активности (рис. 3d). Поскольку мы подтвердили, что транскрипция ВИЧ ингибируется PCIF1 (рис. 2d-i), мы решили сосредоточиться на факторах транскрипции для дальнейших механистических исследований. Чтобы сузить список наиболее значимых мишеней PCIF1, которые могут влиять на транскрипцию ВИЧ, мы объединили 93 гена, регулирующих транскрипцию, с базой данных взаимодействия с ВИЧ (дополнительные данные 4, https://www.ncbi.nlm.nih.gov/genome/viruses/retroviruses/hiv-1/interactions/) и выбрали мишени с аннотированным взаимодействием с ВИЧ. Выявлено 18 измененных ВИЧ m 6 Am целевых транскрипционных факторов: ETS1, EGR1, JUND, SREBF2, PLSCR1, FOS, MYC, YY1, DDIT3, RARA, SP4, CEBPA, IKZF1, CDC5L, ATF4, MLLT1, RCOR1 и SMAD7, которые были среди взаимодействующих с ВИЧ. Например, пики в TSS ETS1 (рис. 3f), CDC5L (дополнительный рис. 7a), DDIT3 (дополнительный рис.7b), CEBPA (дополнительный рисунок 7c), FOS (дополнительный рисунок 7d) и MYC (дополнительный рисунок 7e) были значительно отменены у ВИЧ-инфицированных или PCIF1 KO группы. Большинство генов имеют TSS как аденозин, за исключением EGR1, YY1, DDIT3, CDC5L и RCOR1 , что может быть связано с неправильной аннотацией TSS 9 , хотя мы не можем исключить возможность того, что они не являются м 6 Am модифицированный.

    PCIF1 повышает стабильность ETS1 и ограничивает репликацию ВИЧ

    Чтобы выяснить, какие гены ответственны за PCIF1-направленное ингибирование транскрипции ВИЧ, мы сначала исследовали, были ли уровни РНК выбранных генов-мишеней m 6 Am значительно изменены ВИЧ.Во время ВИЧ-инфекции мРНК ETS1 снижалась на 3-й день после заражения (рис. 3g), что соответствует аналогичной тенденции, наблюдаемой для деградации PCIF1 (рис. 1), что указывает на то, что ETS1 регулировался PCIF1 во время репликации ВИЧ. . Уровни РНК FOS и EGR1 были значительно повышены уже через 1 день после заражения. Поскольку PCIF1 существенно не изменился в первый день после заражения, можно предположить, что PCIF1 может быть не единственным фактором, влияющим на экспрессию FOS и EGR1 во время ВИЧ-инфекции (дополнительная рис.8а). Кроме того, объективный высокопроизводительный одногибридный скрининг дрожжей (eY1H) идентифицировал взаимодействие ETS1 с LTR 35 ВИЧ-1. Поэтому затем мы исследовали, как ETS1 регулируется PCIF1 и может ли ETS1 модулировать репликацию ВИЧ.

    В клетках PCIF1 KO экспрессия мРНК ETS1 была значительно снижена по сравнению с контрольными клетками, в то время как в эктопических Т-клетках, экспрессирующих PCIF1, экспрессия мРНК ETS1 была увеличена примерно в 2 раза по сравнению с контрольными клетками (рис.4а). Эти данные предполагают, что PCIF1 усиливает экспрессию мРНК ETS 1. Чтобы определить, регулируется ли ETS1 PCIF1 посредством его метилтрансферазной активности, PCIF1 дикого типа или каталитически неактивный мутант PCIF1 экспрессировали в клетках PCIF1 KO. Важно отметить, что подавление экспрессии мРНК ETS1 в клетках PCIF1 KO может быть устранено путем экспрессии PCIF1 дикого типа, но не каталитически неактивного мутанта PCIF1, что указывает на то, что PCIF1 регулирует экспрессию ETS1 и требует метилтрансферазной активности фермента (рис.4б).

    Рис. 4: PCIF1 регулирует экспрессию ETS1.

    a Экспрессия мРНК ETS1 была усилена PCIF1. Уровни мРНК ETS1 анализировали с использованием RT-qPCR в контрольных клетках и клетках PCIF1 KO Jurkat или в клетках МТ4 со сверхэкспрессией PCIF1. ** р  = 0,001, *** р  = 0,0001. b PCIF1 регулирует ETS1 посредством своего метилтрансферазного домена. ETS1 мРНК количественно определяли с помощью RT-qPCR в клетках PCIF1 KO, спасенных с помощью мутанта PCIF1 дикого типа или инактивированного метилтрансферазой, как на рис. 2в. ** p  = 0,001, ** p  = 0,0012, ** p  = 0,0076, нс не имеет значения. c Распад мРНК ETS1 ускоряется в клетках PCIF1 KO. Контрольные или PCIF1 KO клетки Jurkat обрабатывали актиномицином D (ActD) в указанные моменты времени и собирали клетки для количественного определения РНК. * p  = 0,019, * p  = 0,012. d CLIP-qPCR, показывающий ассоциацию транскрипта ETS1 с PCIF1 в клетках МТ4 со сверхэкспрессией PCIF1.РНК и белок в контрольных клетках или клетках Flag-PCIF1 MT4 сшивали УФ-излучением и обрабатывали ультразвуком. РНК, связанную с PCIF1, удаляли с помощью антитела Flag. Связанный белок и хроматин расщепляли ферментами и количественно определяли РНК ETS1 и GAPDH с помощью RT-qPCR. Уровни РНК нормализовали к входной РНК. * р  = 0,025. e Уровни белка ETS1 снижены в клетках PCIF1 KO. Экспрессию белков PCIF1 и ETS1 определяли в контрольных и нокаутирующих клетках PCIF1 с помощью вестерн-блоттинга. f Белок ETS1 снижается при ВИЧ-инфекции. Экспрессию белков PCIF1 и ETS1 анализировали в клетках МТ4, инфицированных ВИЧ LAI , при множественности множественности 0,4 или 2 в течение 3 дней. г Кинетика мРНК ETS1 при инфицировании ВИЧ LAI-∆Vpr . Экспрессию мРНК ETS1 количественно определяли в клетках МТ4, инфицированных ВИЧ LAI-∆Vpr , при МВД 0,4 в течение 2, 3 или 5 дней. Все данные представлены как среднее ± ± SD и проанализированы с помощью двустороннего t -критерия в a d , g . n  = 3 ( a , c , d , g ) или 4 ( b ) независимых экспериментов. Аналогичные результаты были получены из трех независимых экспериментов в e и f .

    Модификации РНК могут влиять на экспрессию мРНК, изменяя ее экспорт в цитоплазму или стабильность. Чтобы исследовать, как m 6 Am регулирует экспрессию мРНК ETS1 , количественно определяли распределение и время полужизни мРНК ETS1 в контрольных клетках и клетках PCIF1 KO. Локализация транскриптов ETS1 существенно не изменилась в клетках PCIF1 KO (дополнительная рис. 9a). Однако период полураспада мРНК ETS1 в клетках PCIF1 KO снизился с 3,2 до 2,4 ч (рис. 4с). Между тем, экспрессия и период полураспада GAPDH , немодифицированного гена, не изменились в клетках PCIF1 KO (дополнительная рис. 9b). Кроме того, анализы перекрестной иммунопреципитации (CLIP) продемонстрировали прямое связывание PCIF1 с транскриптами ETS1 (фиг.4г). В целом, эти результаты предполагают, что ETS1 представляет собой m 6 Am, модифицированный PCIF1, а стабильность мРНК ETS1 повышается за счет модификации m 6 Am. Регуляция ETS1 с помощью PCIF1 согласуется с выводами Boulias et al. что модификация m 6 Am повышала стабильность подмножества мРНК 9 .

    Затем мы определили экспрессию белка ETS1 с помощью иммуноблоттинга. В соответствии с данными экспрессии мРНК уровни белка ETS1 были снижены в клетках PCIF1 KO (фиг. 4д). Подобно снижению, наблюдаемому в мРНК (рис. 3g), экспрессия белка ETS1 также снижалась в ВИЧ-инфицированных клетках (рис. 4f). Кроме того, в ВИЧ-инфицированных клетках с дефицитом Vpr мРНК ETS1 не изменилась (рис. 4g и дополнительная рис. 9c), а экспрессия ее белка была восстановлена ​​по сравнению с ВИЧ-инфицированными клетками дикого типа (рис. 1g). Эти данные предполагают, что PCIF1 и ETS1 регулируются экспрессией Vpr. В целом наши данные убедительно свидетельствуют о том, что PCIF1 ингибирует ВИЧ-инфекцию посредством метилирования мРНК ETS1 .

    Чтобы выяснить роль ETS1 в жизненном цикле ВИЧ, мы отредактировали ген ETS1 с использованием специфических sgRNA в клетках МТ4, а затем заразили клетки псевдовирусом ВИЧ. Экспрессия ETS1 была успешно устранена в отредактированных Т-клетках (рис. 5a), а ВИЧ-инфекция значительно увеличилась в отредактированных клетках ETS1 (рис. 5b), как это наблюдалось в клетках PCIF1 KO (рис. 2d). Кроме того, вмешательство в экспрессию ETS1 с помощью двух кшРНК значительно снижало ETS1 и усиливало инфицирование псевдовирусом ВИЧ (рис. 5в, г). Увеличение репликации ВИЧ при нокдауне ETS1 усиливалось при использовании многоцикловой инфекции ВИЧ LAI (рис. 5e).

    Рис. 5: ETS1 ингибирует ВИЧ-инфекцию.

    a , b Нокаут ETS1 способствует инфицированию ВИЧ. МТ4 редактировали с помощью sgRNAs ETS1 в течение 7 дней, а затем контрольные или отредактированные клетки инфицировали HIVpp-luc в течение 2 дней. Уровни белка ETS1 определяли с помощью вестерн-блоттинга ( мкг ). Репликация ВИЧ была обнаружена с помощью анализа люциферазы ( ч ).** р  = 0,0012, *** р  = 0,00015, *** р  = 0,00094. c e Вмешательство в экспрессию ETS1 увеличивает репликацию ВИЧ. Уровни одноцикловой ВИЧ-инфекции определяли с использованием анализов люциферазы в контрольной кшРНК или двух клетках МТ4, трансдуцированных кшРНК с нокдауном ETS1, инфицированных ВИЧpp-luc, при множественности заражения 0,2 в течение 2 дней ( c ). Уровни экспрессии мРНК ETS1 ( d ) и gp120 ( e ) количественно определяли в контрольных клетках кшРНК или ETS1 KD MT4, инфицированных ВИЧ LAI , при MOI 0.01 на 3 дня. C ** P = 0017, ** P = 0021. D ** P = 001, ** P = 002. E **** P = 2.99781 E-06, **** p  = 1,20386E-06. f ETS1 присоединен к промоутеру ВИЧ. ВИЧ-инфицированные клетки МТ4 готовили для анализа ETS1-CHIP. Проводили RT-qPCR промоторных областей ВИЧ или области c-myc или GAPDH, коиммунопреципитированных с ETS. * p  = 0,049, * p  = 0.020, ** p  = 0,007, * p  = 0,0309, нс не имеет значения. г ETS1 ингибирует активность промотора ВИЧ. Плазмиду, содержащую 5′-LTR ВИЧ и репортерную люциферазу (HIV-LTR-luc), использовали для количественного определения активности промотора ВИЧ. Репортерную плазмиду гальванически высевали в контрольные клетки или клетки ETS1 KD MT4, а затем через 2 дня количественно определяли экспрессию белка с использованием анализа люциферазы. *** p  = 0,00017, ** p  = 0,007. h Модель, иллюстрирующая ось регуляции Vpr-PCIF1-ETS1 репликации ВИЧ.Во время репликации ВИЧ PCIF1 ограничивает транскрипцию ВИЧ и становится мишенью вирусного белка Vpr для протеасом-опосредованной деградации, что приводит к нарушению модификации m 6 Am в клеточных мРНК. PCIF1 ингибирует ВИЧ-инфекцию, стабилизируя мРНК фактора транскрипции ETS1 (ETS Proto-Oncogene 1, фактор транскрипции), который связывает промотор ВИЧ для регуляции вирусной транскрипции. Все данные представлены как среднее  ± SD и проанализированы с помощью двустороннего t -критерия в b g . n  = 3 ( c , d , g ) или 4 ( b , e , f ) независимых экспериментов. Аналогичные результаты были получены в трех независимых экспериментах и .

    Чтобы подтвердить связывание ETS1 с промотором ВИЧ, мы проанализировали взаимодействие ETS1 с промотором ВИЧ, выполнив эксперименты ETS1-CHIP в ВИЧ-инфицированных клетках МТ4. Как показано на рис. 4m, ETS1 продемонстрировал значительное взаимодействие с промотором ВИЧ.Взаимодействие ETS1 с c-myc и GAPDH использовали в качестве положительного и отрицательного контроля соответственно (рис. 5f). Чтобы исследовать функцию ETS1 в жизненном цикле ВИЧ, мы подготовили репортерную конструкцию ВИЧ, в которой 5’LTR (длинный концевой повтор), содержащий регуляторные модули, был клонирован перед геном люциферазы, а активность промотора отслеживалась по экспрессии люциферазы. Промотор-репортер ВИЧ (HIV-LTR-luc) вводили в контрольные клетки или клетки с нокдауном ETS1 и количественно определяли активность люциферазы, как описано выше.Мы заметили, что активность промотора была повышена в клетках с нокдауном ETS1, что позволяет предположить, что ETS1 снижает транскрипцию ВИЧ (рис. 5g). В целом, эти результаты демонстрируют, что ETS1 связывается с промотором ВИЧ, чтобы уменьшить транскрипцию ВИЧ.

    Наконец, мы спросили, способствует ли экспрессия ETS1 патогенезу ВИЧ у людей, живущих с ВИЧ (ЛЖВ). Мы проанализировали экспрессию мРНК факторов транскрипции ETS1 в данных секвенирования одноклеточной РНК, полученных из мононуклеарных клеток периферической крови двух здоровых субъектов (15 121 клетка) и шести ВИЧ-инфицированных доноров (28 610 клеток) 36 .Наш анализ показал, что экспрессия мРНК ETS1 была снижена в Т-клетках CD4 ВИЧ-инфицированных людей по сравнению со здоровыми донорами (дополнительная рис. 10). Поскольку ETS1 высоко экспрессируется в Т-клетках, В-клетках и NK-клетках и необходим для выживания и активации Т-клеток 37 , вполне вероятно, что нарушение регуляции ETS1 у ВИЧ-инфицированных вызывает нарушение функции Т-клеток. В совокупности наши результаты показывают, что PCIF1 ограничивает ВИЧ-инфекцию за счет повышения стабильности генов хозяина m 6 Am, включая ETS1.ВИЧ устраняет это ограничение за счет индуцированной Vpr деградации PCIF1 во время вирусного патогенеза (рис. 5h).

    Характеристика ядерного импорта Vpr ВИЧ-1: анализ сигналов и путей | Журнал клеточной биологии

    В то время как белок Vpr ВИЧ-1 участвует в переносе комплекса преинтеграции вируса через комплекс ядерных пор (NPC) неделящихся клеток-хозяев, механизм, с помощью которого Vpr проникает в ядро, остается неизвестным. Теперь мы показываем, что Vpr содержит два дискретных сигнала ядерного нацеливания, которые используют два различных пути импорта, оба из которых отличаются от классического сигнала ядерной локализации (NLS) и M9-зависимых путей. Импорт Vpr, по-видимому, не требует опосредованного Ran гидролиза GTP и сохраняется в условиях низкой энергии. Эксперименты с конкуренцией также предполагают, что Vpr напрямую взаимодействует с NPC в двух отдельных местах. Эти сайты, по-видимому, образуют дистальные компоненты общего пути импорта, используемого белками, содержащими NLS и M9.В совокупности наши данные свидетельствуют о том, что Vpr обходит многие растворимые рецепторы, участвующие в импорте клеточных грузов. Скорее этот вирусный белок, по-видимому, имеет прямой доступ к NPC, свойство, которое может помочь гарантировать способность ВИЧ реплицироваться в неделящихся клеточных хозяевах.

    Ключевым событием на ранних стадиях жизненного цикла вируса иммунодефицита человека (ВИЧ) 1 в неделящихся клетках является активный транспорт преинтеграционного комплекса вируса (PIC) через ядерную оболочку, что позволяет интегрировать ДНК ВИЧ в хромосому хозяина . Способность ВИЧ инфицировать такие неделящиеся клетки, как терминально дифференцированные макрофаги, отличает этот и другие лентивирусы приматов от онкоретровирусов, поражающих только пролиферирующие клетки (Humphries and Temin, 1974). Например, проникновение в ядро ​​и интеграция ДНК вируса мышиного лейкоза требует прохождения клетки-хозяина через митоз, во время которого ядерная мембрана разрушается, и вирус проникает в ядро ​​(Roe et al., 1993; Lewis and Emerman, 1994). ). В случае ВИЧ матрица (Bukrinsky et al., 1993; фон Шведлер и др., 1994; Gallay et al., 1995), интеграза (Gallay et al., 1997) и белки Vpr (Heinzinger et al., 1994; Popov et al., 1998; Vodicka et al., 1998) были идентифицированы как возможные медиаторы. ядерной локализации вируса PIC. Белки матрикса и интегразы содержат классические SV-40-подобные последовательности сигналов ядерной локализации (NLS) и, по-видимому, используют импортин α/импортин β (см. ниже) для транспорта через комплекс ядерных пор (NPC) (Bukrinsky et al. , 1993; Галлай и др., 1996, 1997; Попов и др., 1996). Однако точный вклад матрикса и интегразы в импорт PIC остается неясным (Freed et al., 1995; Fouchier et al., 1997). Хотя считается, что Vpr способствует ядерному нацеливанию вирусного PIC, ядерный импорт Vpr является плохо изученным процессом. Сигнал внутри Vpr, ответственный за ядерную локализацию, неизвестен, и путь импорта, используемый Vpr, также не определен. Vpr значительно усиливает репликацию вируса в терминально дифференцированных макрофагах (Connor et al., 1995), функция, которая, как полагают, связана с его кариофильными свойствами (Heinzinger et al., 1994).

    Vpr представляет собой небольшой белок, состоящий всего из 96 аминокислот и эффективно упаковываемый в вирионы (Cohen et al., 1990; Yuan et al., 1990) из-за его связи с областью p6 p55 gag . предшественник (Paxton et al., 1993; Lu et al., 1995). Помимо усиления репликации в неделящихся макрофагах, Vpr также вызывает остановку или задержку пролиферирующих клеток человека в фазе G2 клеточного цикла (He et al. , 1995; Джоуэтт и др., 1995; Ре и др., 1995; Эмерман, 1996). Это свойство Vpr может служить для усиления экспрессии вирусных генов, поскольку длинный терминальный повтор ВИЧ-1 более активен во время G2 (Goh et al., 1998).

    Анализ вторичной структуры Vpr предсказывает присутствие двух α-спиральных доменов в пределах 70-концевых аминокислот NH 2 (Mahalingam et al., 1995). Связывание Vpr с p6 gag и включение вириона, по-видимому, требуют первого из этих двух α-спиральных доменов.Напротив, многие из детерминант остановки клеточного цикла находятся в богатой аргинином СООН-концевой части белка (Di Marzio et al., 1995; Zhou et al., 1998). Эта СООН-концевая область Vpr больше всего напоминает каноническую NLS; однако эта область может быть удалена без нарушения ядерной локализации (Di Marzio et al., 1995). Тем не менее, недавнее исследование показало, что замена пяти аргининов, расположенных в СООН-концевой области, остатками глутамина приводит к цитоплазматическому паттерну локализации Vpr, предполагая, что СООН-концевая область участвует в ядерном нацеливании (Zhou et al. , 1998). NH 2 -терминальная часть Vpr не имеет никакого сходства с каноническим NLS; аминокислотные мутации, разбросанные по всей этой области, нарушают функцию нацеливания на ядро ​​Vpr (Mahalingam et al., 1997). Более того, мутационный анализ указывает на важность предсказанной α-спиральной вторичной структуры для ядерной локализации Vpr (Di Marzio et al., 1995; Mahalingam et al., 1995).

    Ранее охарактеризованные пути сигнал-опосредованного импорта белков в ядро ​​имеют несколько общих черт.Во-первых, сигнальный кариофильный белок распознается специфическим транспортным рецептором, во-вторых, белковый комплекс активно транслоцируется через NPC. Наконец, попав в ядро, транспортируемый груз диссоциирует от рецептора, и рецептор возвращается в цитоплазму (Nigg, 1997; Ohno et al., 1998). Путь импорта в ядро ​​лучше всего охарактеризован для белков, содержащих богатые основными остатками NLS, прототипом которых является NLS, присутствующий в большом Т-антигене SV-40. Белки, содержащие такой классический положительно заряженный NLS, связываются с гетеродимерным рецепторным комплексом, состоящим из импортина α (кариоферин α; альтернативные названия см. в Nigg, 1997) (Görlich et al., 1994; Weis et al., 1995) и импортин β (кариоферин β, р97) (Chi et al., 1995; Görlich et al., 1995, ; Radu et al., 1995, ). Импортин α отвечает за связывание с белком, несущим NLS, в то время как импортин β опосредует связывание транспортного комплекса с NPC (Görlich et al., 1995 b ). Взаимодействие импортина α с импортином β происходит через NH 2 конец импортина α, называемый доменом связывания импортина β (IBB). При слиянии с гетерологичными белками одного домена IBB достаточно для проникновения в ядро ​​через импортин β (Görlich et al., 1996 и ; Вайс и др., 1996). Система импортин α/импортин β также требует участия небольшой Ras-родственной ГТФазы, Ran/TC4 (Moore and Blobel, 1993; Melchior et al., 1993) и p10 (NTF2) (Moore and Blobel, 1994; Paschal и Джераче, 1995). Однако механизм перемещения грузов и точный вклад Ran-опосредованного гидролиза GTP в реакцию импорта изучены недостаточно. Предполагается, что асимметричное распределение белка, активирующего ГТФазу, RanGAP (цитоплазма), и фактора обмена нуклеотидов, RCC1 (ядро), создает крутой градиент RanGTP между этими двумя клеточными компартментами, и этот градиент может придавать векторность различным транспортным путей (Görlich et al., 1996 б ; Izaurralde et al., 1997 a ). В связи с этим, как только комплекс импортин α/импортин β/карго достигает ядра, связывание RanGTP с импортином β диссоциирует тройной комплекс, обеспечивая доставку груза и рециркуляцию импортина α и импортина β в цитоплазму (Rexach and Blobel, 1995; Görlich). et al., 1996 b ; Koepp and Silver, 1996).

    Для РНК-связывающего белка hnRNP A1 был идентифицирован отдельный путь импорта в ядро.Этот белок содержит сигнальную последовательность, названную М9, которая не имеет гомологии последовательности с классической NLS и обеспечивает как ядерный импорт, так и экспорт hnRNP A1 (Siomi and Dreyfuss, 1995; Michael et al. , 1995). Транспортин, новый рецептор, отдаленно родственный импортину β, связывается с доменом М9 и опосредует импорт hnRNP A1 in vitro (Aitchison et al., 1996; Pollard et al., 1996; Fridell et al., 1997). Как и в классическом пути NLS, импорт hnRNP A1 зависит от присутствия Ran/TC4 (Nakielny et al., 1996). Связывание RanGTP с транспортином в ядре также приводит к диссоциации hnRNP A1 и рециркуляции транспорта в цитоплазме (Izaurralde et al., 1997b; Siomi et al., 1997).

    Импортин β и транспортин являются членами большого суперсемейства белков, которые содержат домены связывания RanGTP и, как полагают, функционируют как ядерные транспортные рецепторы для неизвестных клеточных грузов (Fornerod et al., 1997 a ; Görlich et al., 1997). Совсем недавно члены этого суперсемейства были вовлечены в импорт рибосомных белков (Rout et al., 1997; Schlenstedt et al., 1997), импорт белков, участвующих в процессинге РНК (Pemberton et al. , 1998; Rosenblum et al., 1998). al., 1998; Senger et al., 1998), а также экспорт импортина α (Kutay et al., 1997 a ), экспорт тРНК (Arts et al., 1998; Kutay et al., 1998), а также цитоплазматическая доставка белков, содержащих богатый лейцином сигнал ядерного экспорта, подобный обнаруженному у HIV Rev (Fornerod et al., 1997б; Фукуда и др., 1997; Оссарех-Назари и др., 1997; Стаде и др., 1997).

    Используя установленный in vitro анализ импорта в ядро, мы теперь демонстрируем, что Vpr ВИЧ содержит два различных сигнала ядерной мишени, которые используют разные рецепторы для проникновения в ядро. Более того, мы показываем, что ни один из этих сигналов Vpr не зависит от импортина α/импортина β или транспортина для проникновения в ядро ​​и что Ran/TC4-опосредованный гидролиз GTP, по-видимому, не требуется.Далее мы обнаруживаем, что оба сигнала в Vpr эффективно работают в условиях минимальной энергии. Наконец, конкурентные эксперименты предполагают, что Vpr напрямую взаимодействует с NPC в двух дискретных сайтах пути ядерного импорта, также используемого белками, содержащими NLS и M9. Наши данные подтверждают механизм проникновения, при котором Vpr обходит растворимые рецепторы, участвующие в импорте клеточных грузов, и вместо этого напрямую нацеливается на факторы, расположенные внутри самого NPC.

    Плазмиду, кодирующую слитый белок β-галактозидазы (βgal), конструировали путем вставки ПЦР-фрагмента, соответствующего последовательности lacZ из Escherichia coli , в сайты рестрикции XbaI/XmaI эукариотического вектора экспрессии pCMV4.5′-ПЦР-праймер включал сайт расщепления тромбином (Leu-Val-Pro-Arg-Gly-Ser), расположенный между сайтом XbaI и первым кодоном lacZ . Полноразмерные Vpr и мутанты с делецией Vpr конструировали путем вставки соответствующих ПЦР-фрагментов в сайты HindIII/XbaI pCMV-3′ βgal. Все последовательности Vpr были получены из аллеля NL4-3 ВИЧ-1. Экспрессия рекомбинантных слитых белков в E . coli проводили с использованием вектора pET28 (Novagen, Мэдисон, Висконсин). Все конструкции Vpr подтверждали секвенированием ДНК, а экспрессию белка подтверждали иммуноблоттингом с моноклональным антителом против βgal (Boehringer Mannheim Corp., Индианаполис, Индиана). Плазмиду, кодирующую глутатион-S-трансферазу (GST)-M9, получали путем вставки последовательности M9 (аминокислоты 268–305 hnRNP A1), амплифицированной из EST-клона 81773, в сайты EcoRI/XhoI в pGEX-4T1 (Pharmacia Biotech, Piscataway , Нью-Джерси). Прокариотический экспрессионный вектор для импортина β (71–876) был подарен Dr.С. Адам (Северо-Западный университет, Чикаго, Иллинойс).

    Рекомбинантные слитые белки были экспрессированы в E . coli , штамм BL21(DE3). Культуры выращивали до OD 600 нм 0,9 и индуцировали 1 мМ IPTG в течение 2–5 ч при 30°C. После промывания PBS бактериальные осадки ресуспендировали в 20 мМ Hepes, pH 7,3, 100 мМ NaCl, 1 мМ βME и 10% глицерина (буфер А) и обрабатывали ультразвуком. Белки слияния, содержащие Vpr или фрагменты Vpr, последовательно распределяются на нерастворимую фракцию при получении этим способом.Тельца включения солюбилизировали ультразвуком в 5 мМ имидазоле, 0,5 М NaCl, 20 мМ Трис-HCl, рН 7,9 и 6 М мочевине (буфер В) и инкубировали в течение ночи при 0°С. После ультрацентрифугирования лизатов растворимые слитые белки выделяли с помощью хроматографии Ni-NTA (Invitrogen Corp., Карлсбад, Калифорния). Белки элюировали со смолы буфером Б, содержащим 4 М имидазол. Денатурированные белки рефолдировали путем медленного диализа в буфер А. После завершения экспериментов, включенных в эту рукопись, Vpr(73–96)–βgal впоследствии получали в растворимой форме.Частичная характеристика in vitro растворимого FITC-меченого Vpr(73–96)–βgal не показала явных отличий от денатурированной/ренатурированной формы белка. IBB-βgal, импортин β (71–876), RanQ69L и GST-M9 получали, как описано ранее (Bischoff et al., 1994; Pollard et al., 1996; Weis et al., 1996; Chi et al., 1997). Пептиды, кодирующие Vpr(73–96) или ту же последовательность в обратном порядке, что и контроль, были получены от Research Genetics (Хантсвилл, Алабама). Чистоту пептидов подтверждали масс-спектрометрией и анализом ВЭЖХ.Флуоресцентное мечение белков выполняли, как подробно описано в инструкциях, прилагаемых к сложным эфирам N -гидроксилсукцинимида либо родамина изотиоцианата, либо флуоресцеина (Pierce Chemical Co., Rockford, IL). Избыток метки удаляли диализом в буфере А.

    Перед трансфекцией клетки HeLa (Американская коллекция типовых культур, Роквилл, Мэриленд) высевали на покровные стекла.Трансфекцию проводили с использованием преципитатов фосфата кальция. Через 48 часов клетки окрашивали, как описано ранее (Weis et al., 1996). Первичное антитело представляло собой моноклональное антитело против βgal, используемое в разведении 1:500 в 10% BSA в PBST (0,05% Tween-20 в PBS). Вторичные антимышиные антитела, конъюгированные с FITC или LRSC (Jackson ImmunoResearch, West Grove, PA), использовали в разведении 1:100 в 10% BSA в PBST. Покровные стекла монтировали с помощью гелевого крепления (Biomeda Corp., Foster City, CA), а образцы визуализировали с помощью сканирующего конфокального микроскопа (модель MRC-600; Bio-Rad Labs, Hercules, CA).

    Клетки

    HeLa высевали на покровные стекла за 24 ч до обработки в течение 5 мин при комнатной температуре 50 мкг/мл дигитонина (Fluka AG, Buchs, Швейцария) в транспортном буфере (20 мМ Hepes, KOH, pH 7,3, 110 мМ ацетат калия, 5 мМ ацетата натрия, 2 мМ ацетата магния, 1 мМ EGTA и 2 мМ DTT) (Adam et al., 1990). Реакции импорта смешивали в объеме 10 мкл, вращали при 10000 об/мин в течение 15 мин при 4°С, а затем накладывали поверх покровных стекол, содержащих высеянные клетки HeLa.В качестве источника цитозольных факторов использовали лизат ретикулоцитов кролика, содержащий энергорегенерирующую систему (Promega Corp., Madison, WI). Транспортные реакции всегда проводили параллельно с IBB-βgal в качестве контроля. Слитые белки Vpr и GST-M9 использовали в концентрации 20 нг/мкл, тогда как IBB-βgal использовали в концентрации 40 нг/мкл. Концентрации белка удваивали для конкурентных реакций с использованием пептидов Vpr. Транспортные реакции устанавливали на льду, а затем оставляли для протекания при комнатной температуре в течение 1 часа.Покровные стекла промывали PBST, фиксировали, монтировали, а затем визуализировали, как описано выше.

    Ранее было показано, что

    Vpr локализуется в ядре как во временно трансфицированных клетках, так и в клетках, инфицированных ВИЧ (Lu et al., 1993; Zhao et al., 1994; Yao et al., 1995). Поскольку молекулярная масса Vpr (14 кДа) значительно меньше предела размера 40–60 кДа для пассивной диффузии белков через NPC, наблюдаемое расположение Vpr в ядре может быть результатом как минимум двух возможных механизмов: ( a ) Vpr импортируется через сигнал ядерного нацеливания, или ( b ) Vpr проникает в ядро ​​путем пассивной диффузии и удерживается в этом клеточном компартменте за счет связывания с ядерными белками. Чтобы различить эти две возможности, мы сконструировали химерный белок, состоящий из Vpr, слитого на его СООН-конце с βgal, и проанализировали его субклеточную локализацию как in vivo после трансфекции в клетках HeLa, так и in vitro с использованием пермеабилизированных дигитонином клеток HeLa и флуоресцентно меченного рекомбинантного Vpr. –белки слияния βgal (рис. 1). Размер полученного слитого белка (~130 кДа для мономера и ~520 кДа для тетрамера) достаточно велик, чтобы исключить пассивную диффузию в ядро.

    Как и ожидалось, в транзиторно трансфицированных клетках HeLa, только βgal локализуется в цитоплазме (фиг. 1, A ). Напротив, слитый белок Vpr-βgal был почти исключительно локализован в ядре (рис. 1 B ) трансфицированных клеток. Используя непрямую иммунофлуоресценцию, мы наблюдали нуклеоплазматическое, но ненуклеолярное окрашивание более чем 85% трансфицированных клеток. Эти результаты субклеточной локализации были дополнительно подтверждены в исследованиях биохимического фракционирования, где Vpr-βgal был в основном обнаружен в ядерной фракции, тогда как только βgal был цитоплазматическим (данные не показаны). Из этих экспериментов мы делаем вывод, что Vpr содержит сигнал ядерного нацеливания, который опосредует поглощение ядра.

    Затем мы оценили, может ли Vpr-опосредованный ядерный импорт быть воссоздан in vitro с использованием пермеабилизированных дигитонином клеток HeLa. В качестве положительного контроля использовали химерный белок, состоящий из βgal, слитого с доменом IBB импортина α. Белок IBB-βgal, как сообщалось ранее (Görlich et al., 1996 a ; Weis et al., 1996), был эффективно локализован в ядре (Fig. 1, D ), в то время как только βgal был цитоплазматическим (Fig. 1, C ). В соответствии с наблюдениями in vivo, слияние репортерного белка βgal с Vpr эффективно перенаправляет этот обычно цитоплазматический белок в ядро ​​(Fig. 1 E ). Будучи локализованным в нуклеоплазме, белок Vpr-βgal был исключен из ядрышек.

    Чтобы выяснить, отражает ли поглощение ядра Vpr-βgal активный транспорт через ядерную пору, были изучены эффекты агглютинина зародышей пшеницы (WGA). Этот лектин связывается с остатками N -ацетил-d-глюкозамина, присутствующими на многих нуклеопоринах, и блокирует NLS-опосредованный импорт без ограничения пассивной диффузии малых молекул (Finlay et al., 1987). Добавление WGA заметно ингибировало поглощение ядром как IBB-βgal (Fig. 2, B ), так и Vpr-βgal (Fig. 2, F) 90–170 . Vpr-опосредованный ядерный импорт также исследовали в присутствии доминантно-негативного мутанта с делецией importin β, importin β (71–876). У этого мутанта отсутствует связывающий домен RanGTP, и было показано, что он ингибирует множественные пути ядерного импорта и экспорта через NPC (Izaurralde et al., 1997 и ; Kutay et al., 1997 b ). Добавление импортина β (71-876) эффективно блокировало ядерную локализацию как IBB-βgal (Fig. 2, C ), так и Vpr-βgal (Fig. 2, G ). Наконец, мы исследовали температурную зависимость реакции импорта, опосредованной Vpr. Когда реакцию импорта проводили на льду (0°C), а не при комнатной температуре (25°C), локализация в ядре как IBB-βgal (рис. 2, D ), так и Vpr-βgal ингибировалась (рис. 2). Н ).Взятые вместе, эти результаты указывают на то, что ядерный импорт Vpr является температурно-зависимым, опосредованным сигналом процессом, который протекает через NPC.

    Далее мы исследовали, какие последовательности внутри Vpr необходимы и достаточны для наблюдаемого поглощения Vpr-βgal ядром. На первом этапе два фрагмента Vpr, содержащие аминокислоты 1–71 и 73–96, были индивидуально слиты с βgal и протестированы. Неожиданно оба этих фрагмента Vpr эффективно нацеливали белок βgal на ядро ​​in vivo (рис.3, A и B ) и in vitro (фиг. 3, C и D ). Эти находки предполагают, что Vpr содержит по крайней мере два функциональных сигнала ядерного нацеливания.

    Предыдущее исследование показало, что насыщение классического пути NLS с использованием пептида, соответствующего большой последовательности Т-антигена SV-40, не оказывает ингибирующего действия на импорт Vpr (Gallay et al. , 1996). Этот результат свидетельствует о том, что Vpr не связывается с импортином α в грузовом сайте NLS, но не исключает прямого связывания с импортином β.В связи с этим сообщалось об импортин-β-зависимом и импортин-α-независимом проникновении в ядро ​​для транслокации U snRNPs (Palacios et al., 1997). Чтобы дополнительно подтвердить отсутствие участия импортина α и исследовать использование импортина β с помощью Vpr, мы провели анализы ядерного импорта в присутствии избытка IBB в качестве немеченого конкурента. Включение домена IBB сильно ингибировало NLS-опосредованный импорт in vitro (рис. 4, A против B ) путем насыщения сайта связывания импортина α на импортине β (Görlich et al., 1996; Вайс и др., 1996). Напротив, добавление конкурента IBB не нарушало поглощение Vpr-βgal ядром (рис. 4, C против D ). Однако, поскольку один, но не оба сигнала Vpr могут включать путь NLS, каждый сигнал тестировали отдельно. Добавление конкурента IBB не ингибировало ни сигнал Vpr (Vpr[1–71], рис. 4, E против F , ни Vpr[73–96], рис. 4, G против Н ). В совокупности эти находки указывают на то, что Vpr не использует классический путь NLS для проникновения в ядро ​​через какой-либо из его ядерных сигналов-мишеней.

    После классического пути NLS лучше всего охарактеризованным процессом импорта является путь М9, используемый белком hnRNP A1 и его рецепторным транспортином. Чтобы исследовать использование Vpr пути M9, были проведены конкурентные эксперименты с использованием последовательности ядерного нацеливания M9. Как и ожидалось, насыщение пути М9 с использованием избытка сигнальной последовательности М9 ингибировало импорт в ядро ​​флуоресцентно меченого GST-M9 (рис.4, I против J) . Однако добавление избытка GST-M9 не влияло на импорт белка, опосредованный полноразмерным Vpr (рис. 4, K против L) , Vpr(1–71) (рис. 4, M против . N ), или Vpr(73–96) (рис. 4, O против P ). В соответствии с ранее опубликованными данными (Izaurralde et al., 1997 b ), добавление конкурента М9 также не оказывало ингибирующего действия на ядерный импорт IBB-βgal (данные не показаны). Т.о., проникновение в ядро ​​Vpr, по-видимому, не связано с транспортин-зависимым путем М9.

    Чтобы дополнительно охарактеризовать транспортный путь (пути), используемый двумя сигналами Vpr, потребность в гидролизе GTP с помощью Ran/TC4 была изучена с использованием доминантно-негативного мутанта Ran, RanQ69L. Этот мутант связывает GTP, но не способен гидролизовать этот нуклеотидтрифосфат и, следовательно, остается в состоянии, связанном с GTP. Было показано, что добавление RanQ69L блокирует ядерный импорт NLS- (Palacios et al., 1996) и М9-содержащие белки (Nakielny et al., 1996), а также ядерный импорт U-мяРНП (Palacios et al. , 1996). В соответствии с этими результатами включение мутанта RanQ69L блокировало импорт IBB-βgal (рис. 5, A против B ). Напротив, мутант RanQ69L не проявлял ингибирующего действия на импорт в ядро, опосредованный Vpr(1–71)–βgal (рис. 5, C против D ), Vpr(73–96)–βgal (рис. 5, E vs. F) , или полноразмерный Vpr–βgal (рис.5, G по сравнению с H ). Эти результаты предполагают, что ядерный импорт, опосредованный любым сигналом Vpr, происходит независимо от Ran-опосредованного гидролиза GTP.

    Для дальнейшего сравнения двух сигналов нацеливания внутри Vpr мы исследовали ядерный импорт белков Vpr(1-71)-βgal и Vpr(73-96)-βgal in vitro в различных условиях. Сначала мы исследовали зависимость реакций импорта от белковых факторов, обеспечиваемых лизатом ретикулоцитов кролика.В соответствии с предыдущими исследованиями, импорт IBB-βgal в ядро ​​полностью зависел от добавления лизата ретикулоцитов (Fig. 5, I ) (Weis et al., 1996; Görlich et al., 1996 a ). Напротив, как Vpr(1-71)-βgal, так и Vpr(73-96)-βgal легко проникали в ядро ​​в присутствии одного только буфера (рис. 5, J и K ). Точно так же полноразмерный белок Vpr-βgal проникал в ядро ​​независимым от лизата образом (Fig. 5  L ). Эти результаты показывают, что во время процедуры пермеабилизации дигитонина не теряются никакие ограничивающие скорость факторы, необходимые для импорта любого нацеливающего сигнала Vpr.

    Эти исследования не исключали возможности того, что ядерная локализация, наблюдаемая с Vpr(1–71)–βgal, Vpr(73–96)–βgal и полноразмерным Vpr–βgal на рис. 5, J–L , может отражать процесс «облегченной диффузии», а не фактическое накопление Vpr в ядре в результате векторного импорта. Вход, основанный на чисто облегченной диффузии, как ожидается, даст паттерн локализации, совместимый с уравновешиванием белка между ядерным и цитоплазматическим компартментами. Различие между механизмом облегченной диффузии и фактическим накоплением ядер не может быть сделано из предыдущего эксперимента, проведенного в буфере; ядерная флуоресценция будет наблюдаться в обоих случаях, потому что интенсивное промывание клеток удаляет фоновую флуоресценцию. Чтобы различить эти две возможности, мы измерили поглощение ядер FITC-меченых белков в буфере через 30 минут после реакции импорта в отсутствие промывки или фиксации. В этих условиях ИББ-βgal исключается из ядра (рис.5, М ). Напротив, Vpr(1–71), Vpr(73–96) и полноразмерный белок Vpr, слитый с βgal, претерпевают существенное накопление в ядре против градиента концентрации даже в отсутствие системы регенерации энергии (рис. 5, НП ). Т.о., проникновение Vpr в ядро, по-видимому, не является результатом облегченной диффузии, а скорее отражает векторный транспорт белка в ядро.

    Чтобы изучить потребность в энергии для ядерного импорта, опосредованного двумя сигналами Vpr, каждую из транспортных реакций инкубировали с апиразой для истощения пула нуклеотидтрифосфатов. Как и ожидалось, обработка лизата апиразой эффективно устраняла импорт IBB-βgal (рис. 5, Q против R ). Напротив, импорт Vpr(1–71)–βgal (рис. 5, S против T ), Vpr(73–96)–βgal (рис. 5, U против V ) , или полноразмерный Vpr-βgal (рис. 5, W против X) не подвергался значительному влиянию истощения энергии, вызванного апиразой. Сопоставимые результаты были получены при использовании гексокиназы/глюкозы вместо апиразы для истощения энергии, присутствующей в лизатах (данные не показаны).Вместе эти находки предполагают, что Vpr(1-71), Vpr(73-96) и полноразмерный Vpr способны опосредовать ядерный импорт в присутствии минимальной энергии.

    Для дальнейшего изучения специфичности рецепторов в двух путях Vpr были проведены перекрестные конкурентные эксперименты с использованием фрагментов Vpr. Добавление 300-кратного молярного избытка немеченого фрагмента белка Vpr(1–71) ингибировало ядерный импорт Vpr(1–71)–βgal (рис. 6, A против B ). Однако добавление эквимолярного количества Vpr(1–71) не предотвратило проникновение в ядро, опосредованное Vpr(73–96) (рис. 6, C против D ) или полноразмерным Vpr (рис. 6). , E против F) . Эти находки демонстрируют, что ядерный импорт, происходящий через фрагмент Vpr(1-71), является насыщаемым процессом, опосредованным через рецептор, отличный от того, который участвует в импорте Vpr(73-96). Кроме того, способность Vpr-βgal проникать в ядро ​​в присутствии избытка фрагмента белка Vpr(1-71) указывает на то, что COOH-концевой сигнал является функциональным в контексте полноразмерного белка.

    Затем эти конкурентные эксперименты были расширены до COOH-концевого сигнала Vpr с использованием синтетических пептидов, соответствующих аминокислотам 73–96, синтезированных в прямой или обратной ориентации. Пептид Vpr(73–96) эффективно ингибировал ядерную локализацию Vpr(73–96)–βgal (Fig. 6, 90–169 J) 90–170 . Напротив, ядерный импорт Vpr(73-96)-βgal не ингибировался контрольным обратным пептидом (рис. 6, I ).Эти находки демонстрируют, что в транспорте СООН-концевого сигнала Vpr также участвует насыщаемый рецептор. Добавление пептида Vpr(73–96) также блокировало импорт в ядро ​​как Vpr(1–71)–βgal (рис. 6, G против H ), так и полноразмерного Vpr–βgal (рис. 6, K против L ). Эти результаты предполагают, что два сигнала связываются с двумя факторами, которые могут последовательно участвовать в общем пути импорта в ядро, при этом Vpr(73-96) взаимодействует с рецептором, расположенным ниже по течению от рецептора, распознаваемого Vpr(1-71).

    В этом исследовании мы показываем, что ядерная локализация Vpr является сигнал-опосредованным процессом. В частности, Vpr эффективно нацеливается на присоединенный белок к ядру, даже если партнером по слиянию является нормально цитоплазматический белок, размер которого превышает предельный размер 40–60 кДа для пассивной диффузии. Это наблюдаемое свойство согласуется с предполагаемой ролью Vpr в опосредовании ядерного поглощения большого вирусного PIC.Опосредованный Vpr транспорт в ядро, по-видимому, происходит через NPC, поскольку этот процесс ингибируется добавлением как WGA, так и доминантно-негативного мутанта импортина β, импортина β (71–876), который блокирует множественные независимые пути импорта и экспорта. (Кутай и др., 1997 b ). В противоположность недавнему сообщению, предполагающему, что Vpr нацеливает белки на ядерную оболочку (Vodicka et al., 1998), мы наблюдаем опосредованное Vpr нацеливание на нуклеоплазму. Следует отметить, что временная трансфекция клеток экспрессионным вектором без метки Vpr аналогичным образом приводит к характеру локализации нуклеоплазмы, обнаруживаемому с помощью иммунофлуоресцентного окрашивания антителом против Vpr (данные не показаны).Мы подозреваем, что использование разных аллелей Vpr и/или небольших конформационных вариаций между экспериментальными слитыми белками Vpr может способствовать этим различным результатам. В отдельном исследовании (Fouchier et al., 1998) сообщалось, что белковая химера, состоящая из Vpr, слитого с белком, связывающим мальтозу, локализуется в ядре, в то время как химера Vpr-βgal была обнаружена как в ядре, так и в ядерной оболочке. Для белковой химеры Vpr-βgal, используемой в этом исследовании, мы обнаруживаем нуклеоплазматическую локализацию как для экспрессированного белка в временно трансфицированных клетках HeLa, так и для рекомбинантного белка в пермеабилизированных дигитонином клетках HeLa.Эти результаты показывают, что Vpr способен направлять белки в ядро.

    Наши исследования дополнительно демонстрируют, что Vpr содержит два функциональных сигнала ядерного нацеливания, которые находятся внутри фрагментов 1-71 и 73-96 и могут эффективно направлять этот белок ВИЧ в нуклеоплазму. Следует отметить, что эти две области Vpr хорошо коррелируют с областями, наблюдаемыми после ограниченного протеолиза, что позволяет предположить, что они могут соответствовать структурным доменам внутри белка (Zhao et al. , 1994). В отличие от предыдущих исследований, указывающих на заметную роль конца NH 2 Vpr в ядерном нацеливании (Di Marzio et al., 1995; Mahalingam et al., 1995; Yao et al., 1995), мы обнаружили, что COOH -концевой сигнал также способен опосредовать ядерную локализацию, как сам по себе, так и в контексте полноразмерного белка. Способность Vpr получать доступ к ядру с использованием двух разных сигналов следует принимать во внимание при попытке идентифицировать отдельные аминокислотные остатки, критические для такого нацеливания.

    Особенностью опосредованного Vpr ядерного импорта, который резко контрастирует с импортом, опосредованным классическим NLS- или M9-зависимым путем, является способность Vpr эффективно проникать в ядро ​​в условиях минимальной энергии. Это свойство Vpr обеспечивается обоими его ядерными сигналами нацеливания. В частности, мы показываем, что Vpr-опосредованное проникновение в ядро ​​происходит в отсутствие экзогенно добавленной энергии и даже сохраняется в лизатах с истощенным запасом энергии. Несмотря на такие условия ограниченной энергии, локализация Vpr в ядре является результатом суммарного накопления, а не простого уравновешивания за счет облегченной диффузии.

    Каким образом Vpr может способствовать обогащению ядер при наличии минимальных энергетических уровней? Снижение потребности в энергии для входа может быть функцией дискретных участков вдоль NPC, где связываются Vpr(1-71) и Vpr(73-96). Основываясь на нескольких линиях доказательств, оба сигнала нацеливания Vpr, по-видимому, взаимодействуют с NPC в позициях, расположенных ниже по течению от мест ассоциации NLS- и M9-транспортных комплексов (см. ниже).Альтернативно, абсолютная потребность в энергии для Vpr-опосредованного ядерного импорта может быть просто намного ниже, чем наблюдаемая для импорта посредством классического пути NLS. Наконец, пермеабилизация дигитонина может не полностью высвобождать запасы энергии, связанные с NPC, что объясняет способность Vpr проникать в ядро ​​в отсутствие экзогенно добавленных нуклеотидтрифосфатов. Тот факт, что транслокация, опосредованная Vpr, не происходит при 0°C, предполагает, что требуется некоторая энергия. Однако мы не можем исключить зависящие от температуры конформационные изменения в NPC, которые ингибируют опосредованный сигналами транспорт.Будущие эксперименты попытаются различить эти различные возможности. Дальнейшее изучение импорта Vpr также обещает дать новое понимание механизма, с помощью которого белки перемещаются с одной стороны NPC на другую. Способность Vpr локализоваться в ядре в отсутствие экзогенно добавленных белковых факторов и энергии обеспечивает упрощенную модельную систему, которая должна способствовать выяснению точной механики транспортной реакции. Наконец, наличие сигналов ядерного нацеливания, которые эффективно действуют в условиях ограниченной энергии, может усилить репликацию вируса и его распространение в неделящихся клетках, облегчая поглощение вирусного PIC ядром за счет увеличения кинетики его импорта.

    В отличие от импорта в ядро, происходящего посредством классических сигналов NLS и M9, проникновение в ядро ​​Vpr-βgal, по-видимому, не требует гидролиза GTP, опосредованного Ran/TC4. В частности, как слитые белки Vpr(1-71)-βgal, так и Vpr(73-96)-βgal полностью устойчивы к ингибирующим эффектам мутанта RanQ69L, который не подвергается гидролизу GTP.

    В соответствии с Ran-независимостью от транспорта, блокада Ran-зависимого пути NLS или M9 с использованием избытка немеченых IBB- или M9-содержащих белков-конкурентов не оказывала ингибирующего действия на ядерный импорт, опосредованный полноразмерным Vpr, или либо фрагментов Впр.Эти находки подтверждают, что Vpr не использует importin α/importin β- или опосредованные транспортином пути для проникновения в ядро. Сообщалось о связывании Vpr как с импортином α дрожжей, так и с человеческим (Popov et al., 1998; Vodicka et al., 1998). Однако способность Vpr эффективно проникать в ядро ​​в присутствии избытка конкурента IBB ясно демонстрирует, что функция импортина α не требуется для импорта самого Vpr.

    Что касается других рецепторов, которые, возможно, используются Vpr, мы формально не исключили человеческий гомолог Kap123p, недавно описанного дрожжевого переносчика рибосомных белков (Rout et al. , 1997). Однако использование Vpr этого пути кажется маловероятным, поскольку Kap123p, подобно импортину β и транспортину, содержит связывающий домен RanGTP и, как было показано, связывает RanGTP in vitro (Schlenstedt et al., 1997), что указывает на роль Ran в транспорте Kap123p. . Как отмечалось выше, на импорт Vpr не влияет присутствие доминантно-негативного мутанта Ran, RanQ69L, что свидетельствует о том, что Vpr не использует Kap123p или, по аналогии, др. членов этого надсемейства белков, связывающих RanGTP.

    Необычной особенностью Vpr является то, что этот небольшой белок ВИЧ, состоящий из 96 аминокислот, содержит два различных сигнала ядерной мишени, которые используют разные рецепторы.Характеристика двух сигналов ядерного нацеливания Vpr показывает, что импорт, опосредованный любым сигналом, in vitro происходит независимо от добавленных лизатных белков и, как отмечалось выше, в условиях ограниченной энергии. Конкурентные эксперименты, предназначенные для исследования задействованных рецепторов, демонстрируют, что добавление избытка белкового фрагмента Vpr(1–71) ингибирует импорт, опосредованный Vpr(1–71), но не изменяет импорт, опосредованный Vpr(73–96) или полноразмерный белок Vpr. Напротив, конкуренция с избытком немеченого пептида Vpr(73–96), а не с обратным пептидом в качестве контроля, ингибирует импорт Vpr(1–71)–βgal и Vpr(73–96)–βgal, а также полноценный длина Vпр–βгал.Эти находки указывают на модель проникновения Vpr(73-96) в ядро ​​с участием рецептора, расположенного дистально в конвергентном пути импорта, используемом обоими сигналами Vpr.

    Дальнейшее подтверждение такого конвергентного пути ядерного импорта также было получено, когда фрагменты Vpr были проверены на воздействие на пути импорта NLS и M9. Хотя NLS- и M9-специфические ингибиторы не оказывают ингибирующего действия ни на один из сигналов ядерного нацеливания Vpr, оба фрагмента Vpr(1-71) и Vpr(73-96) при добавлении в качестве конкурентов эффективно блокируют пути NLS и M9. Эти находки подтверждают, что два фрагмента Vpr действуют на более поздних этапах пути импорта в ядро, также используемого белками, несущими NLS и M9, и их соответствующими рецепторами. В связи с этим Popov et al. (1998) также сообщили, что Vpr блокирует ядерный импорт субстратов, содержащих NLS. Возможная конвергенция различных путей ядерного импорта в NPC также подтверждается данными Майкла и его коллег (1997), которые описали ингибирование путей NLS и M9 путем насыщения пути импорта, используемого сигналом ядерного нацеливания hnRNP K, и по данным Kutay et al. (1997 b ), демонстрирующим ингибирование множественных путей импорта и экспорта импортином β (71–876).

    Какова природа этих рецепторов Vpr? Как уже отмечалось, как NH 2 -, так и COOH-концевые сигналы Vpr опосредуют проникновение в ядро ​​в отсутствие добавленных растворимых факторов, указывая либо на то, что импортные рецепторы не высвобождаются из NPC при дигитониновой пермеабилизации, либо на то, что оба Vpr(1 –71) и Vpr(73–96) непосредственно связаны с компонентами NPC. В связи с этим связывание полноразмерного Vpr с дрожжевым нуклеопорином Nsp1p (Vodicka et al., 1998) и недавно был описан нуклеопорин позвоночных POM 121 (Fouchier et al., 1998). Кроме того, хотя Vpr-опосредованный импорт в ядро ​​не зависит от IBB-домена импортина α, включение полноразмерного импортина β ингибирует ядерную локализацию Vpr-βgal (данные не показаны), указывая на то, что Vpr и импортин β могут использовать общие промежуточные соединения для войти в ядро. Фрагменты Vpr(1-71) и Vpr(73-96), несомненно, будут служить ценными реагентами для исследования идентичности этих двух различных рецепторов.Также возможно, что два сигнала ядерного нацеливания Vpr взаимодействуют с разными сайтами одного и того же белка. Такая модель может также объяснить наблюдаемый невзаимный характер ингибирования, наблюдаемый для связывания Vpr(73–96) и Vpr(1–71).

    Было высказано предположение, что Vpr действует как специализированный импортин β для доставки преинтеграционного комплекса ВИЧ в ядерную оболочку (Vodicka et al. , 1998). Было показано, что Vpr связывается с импортином α и содержащими повторы FG нуклеопоринами Nsp1p и POM 121. Точно так же было показано, что импортин β напрямую связывается с нуклеопоринами, содержащими повторы FG, in vitro (Radu et al., 1995 b ; Рексач и Блобель, 1995). Сверхэкспрессия Vpr в дрожжах приводила к дефекту экспорта мРНК, но неожиданно не наблюдалось дефекта импорта (Vodicka et al., 1998).

    Наши данные свидетельствуют о том, что Впр содержит минимальное количество элементов, необходимых для транспорта, что позволяет проходить через НПС.Как и в случае с импортином β, транспортином и экспортином-t (Kose et al., 1997; Nakielny and Dreyfuss, 1997; Kutay et al., 1998), ядерный импорт Vpr не требует растворимых факторов. Как наблюдалось с импортином β (71–876), добавление либо NH 2 — либо COOH-концевого сигнала ядерного нацеливания Vpr блокирует импорт как NLS-, так и M9-несущих импортных субстратов. Основываясь на экспериментах, проведенных in vitro, Букрински и его коллеги предположили, что функция Vpr заключается в усилении ассоциации классического NLS, обнаруженного в белке матрикса, с импортином α, тем самым превращая слабый кариофил в более сильный кариофил (Popov et al., 1998). Наши результаты ясно показывают, что проникновение Vpr в ядро ​​происходит независимо от функции importin α, а также демонстрируют, что Vpr сам по себе очень кариофилен и способен сам по себе обеспечивать локализацию в ядре посредством двух путей, отличных от классического пути NLS.

    Хотя мы идентифицировали два пути импорта, отличные от классического пути NLS, к которым потенциально может получить доступ вирусный PIC, до сих пор неизвестно, как эта сборка локализуется в ядре.Считается, что матрикс и интеграза направляют этот вирусный комплекс в ядро ​​посредством классического пути NLS. Наши данные предполагают, что PIC также имеет доступ благодаря Vpr к двум неповторяющимся путям импорта, отличным от тех, которые используются классическими NLS-содержащими белками. Присутствие Vpr может способствовать поглощению PIC ядром, возможно, путем влияния на кинетику импорта из-за доступности NLS, которая эффективно работает в условиях минимальной энергии, и/или позволяя вирусному PIC напрямую взаимодействовать с NPC.Несмотря на эти неопределенности, эти результаты подчеркивают эволюцию ВИЧ, чтобы кодировать вирусный фактор, который обходит многие критические проксимальные компоненты, которые управляют другими путями ядерного импорта. Скорее, Vpr, по-видимому, связывается с рецепторами, расположенными внутри NPC, и это свойство может способствовать обеспечению способности ВИЧ реплицироваться в неделящихся клетках-хозяевах.

    XVMLL485000LMMV0 XVML L48 5000LM MVOLT 40K 80CRI Lithonia Lighting 4′ Led VPR Tight 4K 5000LM

    • Спасибо за ваши предложения! Мы ценим вашу помощь в улучшении нашего программного обеспечения. Это помогает нам обслуживать вас еще лучше!

      Режим редактирования: Пожалуйста, войдите, чтобы предложить улучшения для этого предмета. Закрывать Помогите улучшить наши данные
      Особенности
      Тип лампы
      Светодиод — статический
      Номинальное напряжение
      от 120 до 277 В
      Материал
      Поликарбонат
      Форма
      Линейный
      Мощность
      33 Вт
      Материал, цвет и отделка
      цвет корпуса
      серый
      Материал корпуса
      Поликарбонат
      Размеры и вес
      Длина
      47-13/16 дюймов
      Ширина
      4-1/2 дюйма
      Высота
      3 дюйма
      Описания
      Подробное описание
      Светодиодный газонепроницаемый, линейной формы, 33 Вт, от 120 до 277 В, яркость 5000 лм (люмен), длина 47-13/16 дюймов, ширина 4-1/2 дюйма, высота 3 дюйма, материал корпуса из поликарбоната, гарантия 5 лет, 6. 1 фунт
      удлиненное описание
      LITH XVML L48 5000LM МВОЛЬТ 40K 80CR
      Тип продукта
      Светодиодный паронепроницаемый
      Описание
      4′ LED VPR TIGHT 4K 5000LM
      Особенности
      Испытайте экономию.Почувствуйте ценность. Паронепроницаемые светодиодные светильники XVML от Lithonia Lighting(R) представляют собой экономичные закрытые светильники с прокладками, разработанные специально для требовательных условий. XVML LED паронепроницаемый — это простое в установке и недорогое решение для влажных помещений, устойчивое к пыли и грязи благодаря степени защиты IP66.
      Краткое описание
      LED Vapor Tight 33 Вт, 120–277 В, 5000 лм
      Дополнительная информация
      Время отклика
      7.000 календарных дней
      количество поддонов
      99
      Тип крепления
      Линейный
      Яркость (люмен)
      5000 лм
      лампа типа
      ВЕЛ
      включает
      Крючки; 10 защелок
      Соответствие стандартам
      Внесен в список UL/cUL
      Гарантия
      5 лет
      количество в упаковке
      1 ЦС
      Информация производителя
      Номер детали производителя
      XVML L48 5000LM МВОЛЬТ 40K 80CR
      Марка
      Литония Освещение
      GTIN
      001621952
      УПК
      1621952
      Таксономии, классификации и категории
      Тип
      ЛИНЕЙНЫЙ
      Категория Описание
      СВЕТОДИОДНОЕ ОСВЕЩЕНИЕ ДЛЯ ОПАСНЫХ ЗОН И ПАРОНЕПРОНИЦАЕМОСТИ
      Упаковка
      Масса
      6. 1 фунт; 2,8 кг
      Вес каждого
      6.4
      Коробка
      1
      Использование, сертификаты и стандарты
      Применение
      Потолок встречается со стеной под углом 90°
      Помогите улучшить наши данные
        Режим редактирования: Пожалуйста, войдите, чтобы предложить улучшения для этого элемента. Закрывать
    • У вас должна быть учетная запись клиента, чтобы просматривать наличие запасов во всех местах.
    • Выберите категорию (категории), с которой вы хотите связать этот элемент.

      (Вы можете выбрать несколько категорий, удерживая клавишу Ctrl при нажатии)

      Категория ссылки

    * Все цены могут быть изменены.

    Предложить сопутствующий товар

    Тип: ЗаменительАналог/Аксессуар

    Поиск Связанный каталожный номер:

    Отправка вашего предложения

    Дождитесь завершения операции.

    Локализация Vpr ВИЧ-1 в ядерной оболочке: влияние на функции Vpr и репликацию вируса в макрофагах | Ретровирусология

  • Ямашита М. , Эмерман М.: Ретровирусная инфекция неделящихся клеток: старые и новые взгляды.Вирусология. 2006, 344: 88-93. 10.1016/ж.вирол.2005.09.012.

    КАС Статья пабмед Google ученый

  • Кроу С., Чжу Т., Мюллер В.А.: Вклад инфекции и распространения моноцитов в персистенцию вируса и поддержание резервуара вируса при ВИЧ-инфекции. Дж. Лейкок Биол. 2003, 74: 635-41. 10.1189/jlb.0503204.

    КАС Статья пабмед Google ученый

  • Yamashita M, Emerman M: Независимость клеточного цикла ВИЧ-инфекции не определяется известными кариофильными вирусными элементами.PLoS Патог. 2005, 1: e18-10.1371/journal.ppat.0010018.

    Центральный пабмед Статья пабмед Google ученый

  • Фассати А: ВИЧ-инфекция неделящихся клеток: проблема разделения. Ретровирусология. 2006, 3: 74-10.1186/1742-4690-3-74.

    Центральный пабмед Статья пабмед Google ученый

  • Balliet JW, Kolson DL, Eiger G, Kim FM, McGann KA, Srinivasan A, Collman R: Различные эффекты в первичных макрофагах и лимфоцитах дополнительных генов вируса иммунодефицита человека типа 1 vpr, vpu и nef: мутационный анализ первичного изолята ВИЧ-1.Вирусология. 1994, 200: 623-31. 10.1006/viro.1994.1225.

    КАС Статья пабмед Google ученый

  • Connor RI, Chen BK, Choe S, Landau NR: Vpr необходим для эффективной репликации вируса иммунодефицита человека типа 1 в мононуклеарных фагоцитах. Вирусология. 1995, 206: 935-44. 10.1006/viro.1995.1016.

    КАС Статья пабмед Google ученый

  • Экштейн Д.А., Шерман М.П., ​​Пенн М.Л., Чин П.С., Де Норонья С. М., Грин В.К., Голдсмит М.А.: Vpr ВИЧ-1 увеличивает вирусную нагрузку, способствуя инфицированию тканевых макрофагов, но не неделящихся CD4+ Т-клеток.J Эксперт Мед. 2001, 194: 1407-19. 10.1084/ем.194.10.1407.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Хайнзингер Н.К., Букински М.И., Хаггерти С.А., Рэгланд А.М., Кевалрамани В., Ли М.А., Гендельман Х.Е., Ратнер Л., Стивенсон М., Эмерман М.: Белок Vpr вируса иммунодефицита человека типа 1 влияет на ядерную локализацию вирусных нуклеиновых кислот в неделящихся клетках-хозяевах. Proc Natl Acad Sci USA. 1994, 91: 7311-5.10.1073/пнас.91.15.7311.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Зайцева Л., Майерс Р., Фассати А.: тРНК способствуют импорту в ядро ​​внутриклеточных комплексов обратной транскрипции ВИЧ-1. PLoS биол. 2006, 4: e332-10. 1371/journal.pbio.0040332.

    Центральный пабмед Статья пабмед Google ученый

  • Морелле Н., Буазиз С., Петитжан ​​П., Рокес Б.П.: ЯМР-структура регуляторного белка ВИЧ-1 VPR.Дж Мол Биол. 2003, 327: 215-27. 10.1016/S0022-2836(03)00060-3.

    КАС Статья пабмед Google ученый

  • Muller B, Tessmer U, Schubert U, Krauslich HG: Белок Vpr вируса иммунодефицита человека типа 1 включается в вирион в значительно меньших количествах, чем gag, и фосфорилируется в инфицированных клетках. Дж Вирол. 2000, 74: 9727-31. 10.1128/ОВИ.74.20.9727-9731.2000.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Selig L, Pages JC, Tanchou V, Preveral S, Berlioz-Torrent C, Liu LX, Erdtmann L, Darlix J, Benarous R, Benichou S: Взаимодействие с доменом p6 предшественника gag опосредует включение в вирионы Белки Vpr и Vpx лентивирусов приматов. Дж Вирол. 1999, 73: 592-600.

    Центральный пабмед КАС пабмед Google ученый

  • Cohen EA, Dehni G, Sodroski JG, Haseltine WA: Продукт vpr вируса иммунодефицита человека представляет собой регуляторный белок, ассоциированный с вирионом. Дж Вирол. 1990, 64: 3097-9.

    Центральный пабмед КАС пабмед Google ученый

  • Пакстон В., Коннор Р.И., Ландау Н.Р.: Включение Vpr в вирионы вируса иммунодефицита человека типа 1: потребность в p6-области gag и мутационного анализа.Дж Вирол. 1993, 67: 7229-37.

    Центральный пабмед КАС пабмед Google ученый

  • Yu XF, Matsuda M, Essex M, Lee TH: Открытая рамка считывания vpr вируса иммунодефицита обезьян кодирует ассоциированный с вирионом белок. Дж Вирол. 1990, 64: 5688-93.

    Центральный пабмед КАС пабмед Google ученый

  • Le Rouzic E, Benichou S: Белок Vpr ВИЧ-1: разные роли в жизненном цикле вируса. Ретровирусология. 2005, 2: 11-10.1186/1742-4690-2-11.

    Центральный пабмед Статья пабмед Google ученый

  • Goh WC, Rogel ME, Kinsey CM, Michael SF, Fultz PN, Nowak MA, Hahn BH, Emerman M: Vpr ВИЧ-1 увеличивает экспрессию вируса путем манипулирования клеточным циклом: механизм отбора Vpr in vivo .Нат Мед. 1998, 4: 65-71. 10.1038/nm0198-065.

    КАС Статья пабмед Google ученый

  • Chen R, Le Rouzic E, Kearney JA, Mansky LM, Benichou S: Опосредованное Vpr включение UNG2 в частицы ВИЧ-1 необходимо для модуляции скорости мутации вируса и репликации в макрофагах. Дж. Биол. Хим. 2004, 279 (27): 28419-28425. 10.1074/jbc.M403875200.

    КАС Статья пабмед Google ученый

  • Di Marzio P, Choe S, Ebright M, Knoblauch R, Landau NR: Мутационный анализ остановки клеточного цикла, ядерной локализации и упаковки вирионов вируса иммунодефицита человека типа 1 Vpr.Дж Вирол. 1995, 69: 7909-16.

    Центральный пабмед КАС пабмед Google ученый

  • Kamata M, Aida Y: Два предполагаемых альфа-спиральных домена вируса иммунодефицита человека типа 1 Vpr опосредуют ядерную локализацию по крайней мере двумя механизмами. Дж Вирол. 2000, 74: 7179-86. 10.1128/ОВИ.74.15.7179-7186.2000.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Waldhuber MG, Bateson M, Tan J, Greenway AL, McPhee DA: Исследования с использованием слитых белков GFP-Vpr: индукция апоптоза, но устранение остановки клеточного цикла, несмотря на ядерную мембрану или локализацию в ядре. Вирусология. 2003, 313: 91-104. 10.1016/S0042-6822(03)00258-7.

    КАС Статья пабмед Google ученый

  • Depienne C, Roques P, Creminon C, Fritsch L, Casseron R, Dormont D, Dargemont C, Benichou S: Клеточное распределение и кариофильные свойства белков матрикса, интегразы и Vpr вирусов иммунодефицита человека и обезьян. Разрешение ячейки опыта. 2000, 260: 387-95. 10.1006/искл.2000.5016.

    КАС Статья пабмед Google ученый

  • Попов С., Рексач М., Ратнер Л., Блобель Г., Букрински М.: Вирусный белок R регулирует присоединение преинтеграционного комплекса ВИЧ-1 к комплексу ядерной поры.Дж. Биол. Хим. 1998, 273: 13347-52. 10.1074/jbc.273.21.13347.

    КАС Статья пабмед Google ученый

  • Vodicka MA, Koepp DM, Silver PA, Emerman M: Vpr ВИЧ-1 взаимодействует с ядерным транспортным путем, способствуя заражению макрофагами. Гены Дев. 1998, 12: 175-85.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Фушье Р.А., Мейер Б.Е., Саймон Дж.Х., Фишер У., Олбрайт А.В., Гонсалес-Скарано Ф., Малим М.Х.: Взаимодействие белка Vpr вируса иммунодефицита человека типа 1 с комплексом ядерной поры.Дж Вирол. 1998, 72: 6004-13.

    Центральный пабмед КАС пабмед Google ученый

  • Tran EJ, Wente SR: Комплексы динамических ядерных пор: жизнь на грани. Клетка. 2006, 125: 1041-53. 10.1016/j.cell.2006.05.027.

    КАС Статья пабмед Google ученый

  • Le Rouzic E, Mousnier A, Rustum C, Stutz F, Hallberg E, Dargemont C, Benichou S: Стыковка Vpr ВИЧ-1 с ядерной оболочкой опосредована взаимодействием с нуклеопорином hCG1.Дж. Биол. Хим. 2002, 277: 45091-8. 10. 1074/jbc.M207439200.

    КАС Статья пабмед Google ученый

  • Нитахара-Касахара Ю., Камата М., Ямамото Т., Чжан Х., Миямото Ю., Мунета К., Иидзима С., Йонеда Ю., Цунэцугу-Йокота Ю., Аида Ю.: новый ядерный импорт Vpr, продвигаемый импортином {альфа} имеет решающее значение для репликации ВИЧ-1 в макрофагах. Дж Вирол. 2007, ОВИ.01928-06

    Google ученый

  • Уизерс-Уорд Э.С., Джоуэтт Дж.Б., Стюарт С.А., Се Ю.М., Гарфинкель А., Шибагаки Ю., Чоу С.А., Шах Н., Ханаока Ф., Савиц Д.Г., Армстронг Р.В., Соуза Л.М., Чен И.С.: Вирус иммунодефицита человека типа 1 Vpr взаимодействует с HHR23A, клеточным белком, участвующим в репарации ДНК путем эксцизии нуклеотидов.Дж Вирол. 1997, 71: 9732-42.

    Центральный пабмед КАС пабмед Google ученый

  • Selig L, Benichou S, Rogel ME, Wu LI, Vodicka MA, Sire J, Benarous R, Emerman M: Урацил-ДНК-гликозилаза специфически взаимодействует с Vpr как вируса иммунодефицита человека типа 1, так и вируса иммунодефицита обезьян сажистых мангабей, но связывание не коррелирует с остановкой клеточного цикла. Дж Вирол. 1997, 71: 4842-6.

    Центральный пабмед КАС пабмед Google ученый

  • Манский Л.М., Преверал С., Селиг Л., Бенарус Р., Бенишу С.: Взаимодействие vpr с урациловой ДНК-гликозилазой модулирует скорость мутаций вируса иммунодефицита человека типа 1 in vivo.Дж Вирол. 2000, 74: 7039-47. 10.1128/ОВИ.74.15.7039-7047.2000.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Schwede T, Kopp J, Guex N, Peitsch MC: SWISS-MODEL: сервер автоматизированного моделирования гомологии белков. Нуклеиновые Кислоты Res. 2003, 31: 3381-5. 10.1093/нар/гкг520.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Guex N, Peitsch MC: SWISS-MODEL и Swiss-PdbViewer: среда для сравнительного моделирования белков.Электрофорез. 1997, 18: 2714-23. 10.1002/элпс.1150181505.

    КАС Статья пабмед Google ученый

  • Peitsch MC, Wells TN, Stampf DR, Sussman JL: Коллекция Swiss-3DImage и PDB-Browser в Интернете. Тенденции биохимических наук. 1995, 20: 82-4. 10.1016/S0968-0004(00)88963-Х.

    КАС Статья пабмед Google ученый

  • Mahalingam S, Ayyavoo V, Patel M, Kieber-Emmons T, Weiner DB: Импорт в ядро, включение вириона и остановка/дифференциация клеточного цикла опосредованы различными функциональными доменами вируса иммунодефицита человека типа 1 Vpr.Дж Вирол. 1997, 71: 6339-47.

    Центральный пабмед КАС пабмед Google ученый

  • Yao XJ, Subbramanian RA, Rougeau N, Boisvert F, Bergeron D, Cohen EA: Мутагенный анализ вируса иммунодефицита человека типа 1 Vpr: роль предполагаемой N-концевой альфа-спиральной структуры в ядерной локализации Vpr и включении вириона . Дж Вирол. 1995, 69: 7032-44.

    Центральный пабмед КАС пабмед Google ученый

  • Thotala D, Schafer EA, Tungaturthi PK, Majumder B, Janket ML, Wagner M, Srinivasan A, Watkins S, Ayyavoo V: Структурно-функциональный анализ вируса иммунодефицита человека типа 1 (ВИЧ-1) Vpr: роль остатки лейцина при опосредованной Vpr трансактивации и репликации вируса.Вирусология. 2004, 328: 89-100. 10.1016/ж.вирол.2004.07.013.

    КАС Статья пабмед Google ученый

  • Yang XJ: Многосайтовая модификация белка и внутримолекулярная передача сигналов. Онкоген. 2005, 24: 1653-62. 10.1038/sj.onc.1208173.

    КАС Статья пабмед Google ученый

  • de Noronha CM, Sherman MP, Lin HW, Cavrois MV, Moir RD, Goldman RD, Greene WC: Динамические нарушения архитектуры и целостности ядерной оболочки, вызванные ВИЧ-1 Vpr. Наука. 2001, 294: 1105-8. 10.1126/научн.1063957.

    КАС Статья пабмед Google ученый

  • Somasundaran M, Sharkey M, Brichacek B, Luzuriaga K, Emerman M, Sullivan JL, Stevenson M: Доказательства детерминанты цитопатогенности в ВИЧ-1 Vpr. Proc Natl Acad Sci USA. 2002, 99: 9503-8. 10.1073/пнас.142313699.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Le Rouzic E, Belaidouni N, Estrabaud E, Morel M, Rain JC, Transy C, Margottin-Goguet F: Vpr ВИЧ1 останавливает клеточный цикл, рекрутируя DCAF1/VprBP, рецептор убиквитинлигазы Cul4-DDB1.Клеточный цикл. 2007, 6: 182-8.

    КАС Статья пабмед Google ученый

  • Hrecka K, Gierszewska M, Srivastava S, Kozaczkiewicz L, Swanson SK, Florens L, Washburn MP, Skowronski J: Lentiviral Vpr узурпирует убиквитинлигазу Cul4-DDB1 [VprBP] E3 для модуляции клеточного цикла. Proc Natl Acad Sci USA. 2007, 104: 11778-83. 10.1073/пнас.0702102104.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Belzile JP, Duisit G, Rougeau N, Mercier J, Finzi A, Cohen EA: ВИЧ-1 Vpr-опосредованный арест G2 включает убиквитинлигазу DDB1-CUL4A (VPRBP) E3.PLoS Патог. 2007, 3: e85-10.1371/journal.ppat.0030085.

    Центральный пабмед Статья пабмед Google ученый

  • Tan L, Ehrlich E, Yu XF: DDB1 и Cul4A необходимы для ареста вируса иммунодефицита человека типа 1, индуцированного Vpr G2. Дж Вирол. 2007, 81 (19): 10822-10830. 10.1128/ОВИ.01380-07.

    Центральный пабмед КАС Статья пабмед Google ученый

  • DeHart JL, Zimmerman ES, Ardon O, Monteiro-Filho CM, Arganaraz ER, Planelles V: Vpr ВИЧ-1 активирует контрольную точку G2 путем манипулирования протеасомной системой убиквитина. Вирол Дж. 2007, 4: 57-10.1186/1743-422X-4-57.

    Центральный пабмед Статья пабмед Google ученый

  • Andersen JL, Zimmerman ES, DeHart JL, Murala S, Ardon O, Blackett J, Chen J, Planelles V: ATR и GADD45alpha опосредуют апоптоз, индуцированный Vpr ВИЧ-1. Смерть клеток 2005, 12: 326-34. 10.1038/sj.cdd.4401565.

    КАС Статья пабмед Google ученый

  • Muthhumani K, Hwang DS, Desai BM, Zhang D, Dayes N, Green DR, Weiner DB: Vpr ВИЧ-1 индуцирует апоптоз через каспазу 9 в Т-клетках и мононуклеарных клетках периферической крови.Дж. Биол. Хим. 2002, 277: 37820-31. 10.1074/jbc.M205313200.

    КАС Статья пабмед Google ученый

  • Stewart SA, Poon B, Song JY, Chen IS: Вирус иммунодефицита человека типа 1 vpr индуцирует апоптоз посредством активации каспазы. Дж Вирол. 2000, 74: 3105-11. 10.1128/ОВИ.74.7.3105-3111.2000.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Юань Х., Се Ю.М., Чен И.С.: Истощение киназы Wee-1 необходимо как для вируса иммунодефицита человека типа 1, так и для апоптоза, вызванного гамма-облучением.Дж Вирол. 2003, 77: 2063-70. 10.1128/ОВИ.77.3.2063-2070.2003.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Yuan H, Kamata M, Xie YM, Chen IS: Повышенные уровни киназы Wee-1 в G(2) необходимы для остановки G(2), вызванной Vpr- и гамма-облучением. Дж Вирол. 2004, 78: 8183-90. 10.1128/ОВИ.78.15.8183-8190.2004.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Чен М., Старейшина Р.Т., Ю М., О’Горман М.Г., Селиг Л., Бенарус Р. , Ямамото А., Чжао И.: Мутационный анализ остановки G2, индуцированной Vpr, ядерной локализации и гибели клеток у делящихся дрожжей.Дж Вирол. 1999, 73: 3236-45.

    Центральный пабмед КАС пабмед Google ученый

  • Nishizawa M, Kamata M, Mojin T, Nakai Y, Aida Y: Индукция апоптоза белком Vpr вируса иммунодефицита человека типа 1 происходит независимо от G(2) остановки клеточного цикла. Вирусология. 2000, 276: 16-26. 10.1006/виро.2000.0534.

    КАС Статья пабмед Google ученый

  • Лум Дж. Дж., Коэн О. Дж., Ни З., Уивер Дж. Г., Гомес Т. С., Яо X. Дж., Линч Д., Пилон А. А., Хоули Н., Ким Дж. Э., Чен З., Монпетит М., Санчес-Дардон Дж., Коэн Э. А., Бэдли А. Д. : Vpr R77Q связан с длительной непрогрессирующей ВИЧ-инфекцией и нарушением индукции апоптоза.Джей Клин Инвест. 2003, 111: 1547-54. 10.1172/JCI200316233.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Фрид Э.О., Инглунд Г., Мартин М.А.: Роль основного домена матрицы вируса иммунодефицита человека типа 1 в макрофагальной инфекции.Дж Вирол. 1995, 69: 3949-54.

    Центральный пабмед КАС пабмед Google ученый

  • Subbramanian RA, Yao XJ, Dilhuydy H, Rougeau N, Bergeron D, Robitaille Y, Cohen EA: Вирус иммунодефицита человека типа 1 Локализация Vpr: ядерный транспорт вирусного белка, модулируемый предполагаемой амфипатической спиральной структурой, и его отношение к биологическая активность. Дж Мол Биол. 1998, 278: 13-30. 10.1006/jmbi.1998.1685.

    КАС Статья пабмед Google ученый

  • Cadwell RC, Joyce GF: Рандомизация генов с помощью ПЦР-мутагенеза.Прил. методы ПЦР. 1992, 2: 28-33.

    КАС Статья пабмед Google ученый

  • Py B, Slomianny C, Auberge P, Petit PX, Benichou S: Siva-1 и альтернативная форма сплайсинга без домена смерти, Siva-2, аналогичным образом индуцируют апоптоз в Т-лимфоцитах через каспазозависимый митохондриальный путь. Дж Иммунол. 2004, 172: 4008-17.

    КАС Статья пабмед Google ученый

  • Zufferey R, Nagy D, Mandel RJ, Naldini L, Trono D: Множественно ослабленный лентивирусный вектор обеспечивает эффективную доставку генов in vivo.Нац биотехнолог. 1997, 15: 871-5. 10.1038/nbt0997-871.

    КАС Статья пабмед Google ученый

  • Мански Л.М., Преверал С., Ле Рузик Э., Бернар Л.С., Селиг Л., Депьен С., Бенарус Р., Бенишу С.: Взаимодействие вируса иммунодефицита человека типа 1 Vpr с белком репарации ДНК HHR23A не коррелирует с множественными биологическими функциями Впр.Вирусология. 2001, 282: 176-85. 10.1006/виро.2000.0791.

    КАС Статья пабмед Google ученый

  • Perez-Bercoff D, David A, Sudry H, Barre-Sinoussi F, Pancino G: Опосредованное рецептором Fcgamma подавление репликации вируса иммунодефицита человека типа 1 в первичных макрофагах человека. Дж Вирол. 2003, 77: 4081-94. 10. 1128/ОВИ.77.7.4081-4094.2003.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Ограниченные возможности отправки | Research Development

    Ограниченные возможности подачи (LSO) — это возможности финансирования, в которых спонсор наложил ограничения на количество заявок, которые могут быть поданы от учреждения.В UVA есть внутренний процесс отбора, чтобы определить, какие кандидаты будут использовать эти возможности; Офис вице-президента по исследованиям (VPR) наблюдает за этим процессом. Если вы обнаружите интересную возможность финансирования и считаете, что она ограничена, вы должны  связаться с нами по телефону  немедленно; VPR рассмотрит возможность и определит следующие шаги. Чтобы просмотреть и подать заявку на открытые ограниченные возможности подачи заявок, которые в настоящее время координирует VPR, посетите страницу конкурса ограниченных заявок.

    Конкурс с ограниченным количеством заявок Страница

    Преподавателям предлагается выступить в качестве рецензента для UVA Limited Submissions. Если вы заинтересованы, пожалуйста, свяжитесь с нами .


    ОБЗОР ПРОЦЕССА ОГРАНИЧЕННОЙ ПОДАЧИ

    ИДЕНТИФИКАЦИЯ И ОБЪЯВЛЕНИЕ ОБ ОГРАНИЧЕННЫХ ВОЗМОЖНОСТЯХ ПРЕДОСТАВЛЕНИЯ

    Управление VPR отслеживает ряд повторяющихся ограниченных возможностей подачи и регулярно распространяет внутренние запросы.Если LSO предназначен для преподавателей школы/департамента, офис VPR будет обращаться к этому подразделению для согласования. Если есть дополнительные LSO, которые школы хотели бы, чтобы VPR добавила в список для координации, пожалуйста, , сообщите нам об этом . Уведомления о LSO, обрабатываемых VPR, публикуются следующим образом:

    • Страница конкурса ограниченных заявок — Эта страница содержит открытые возможности, управляемые VPR, и часто обновляется.
    • Список рассылки LSO:
      • Отправьте сообщение на [email protected] с адреса, на который вы хотите подписаться.
      • В строке темы сообщения введите: subscribe lso_announce Имя Фамилия (замените Имя собственными именем и фамилией).
      • Оставьте текст сообщения пустым.
    • Целевые электронные письма — рассылаются заместителям деканов по исследованиям и другим лицам из соответствующих школ, отделов и подразделений. В каждой школе есть отдельные процессы для обмена этими объявлениями с преподавателями и персоналом.
    ПРОЦЕСС ВНУТРЕННЕГО КОНКУРСА
    • Письмо о намерениях (LOI) Предоставление – инструкции доступны здесь.
    • Подача предварительного предложения – Если интерес превышает разрешенное спонсором количество заявок, лица, подавшие LOI, будут приглашены подать предварительное предложение для внутреннего конкурса. Информация о предварительном предложении обычно предоставляется во внутреннем запросе.
    • Рассмотрение и отбор кандидатов Предварительные предложения передаются на оценку рецензентам.
      • Внутренний обзор – Комитеты по внутреннему обзору проводят критические обзоры и дают рекомендации по предварительным предложениям, которые должны быть отправлены на рассмотрение внешним организациям. Члены комитета приглашаются для работы в конкретных комиссиях в зависимости от их знаний в предметной области и/или их опыта работы с конкретным спонсором или программой. VPR следует передовому опыту многих фондов и агентств и не раскрывает имена отдельных рецензентов, входящих в состав конкретной группы рецензентов.
      • Внешняя проверка — Офис VPR также будет запрашивать внешнюю экспертную оценку через профессиональные организации и контакты по мере необходимости, чтобы облегчить тщательную научную проверку выбранных возможностей.
      • Автоматический выбор – Используется, когда получен только один LOI. Отзыв о предложении не предусмотрен.

    Примечание. Группа по ограниченной подаче заявок уведомляет отдельных внутренних заявителей о результатах рассмотрения их предварительного предложения по электронной почте.Если преподаватель решит отказаться от участия, он должен как можно скорее уведомить об этом , связаться с нами по телефону , чтобы другой преподаватель мог принять участие в внешнем конкурсе.

    ПРОЦЕСС ПРОВЕРКИ И ВЫБОРА ДЛЯ НОВЫХ И ОДНОРАЗОВЫХ (AD HOC) ОГРАНИЧЕННЫХ ВОЗМОЖНОСТЕЙ

    Специальные LSO относятся к ограниченным возможностям отправки, которые в настоящее время не включены в список LSO, которые отслеживаются и обрабатываются VPR. Если физическое лицо обнаруживает интересующую его возможность финансирования, о которой не было объявлено нашим офисом, и это ограниченная возможность подачи, он должен связаться с офисом VPR ([email protected] эду) немедленно.

    • Специальная процедура — стандартная временная шкала:  При наличии достаточного времени (≥8 недель) будет запущен внутренний конкурс, который будет управляться централизованно в качестве стандартного процесса LSO, описанного выше для повторяющихся запросов. Типичный график выглядит следующим образом:
      • ≈ 1 неделя на внутреннюю отправку LOI
      • ≈ 2 недели на внутреннюю подачу предварительного предложения
      • ≈ 2 недели на рассмотрение внутренних предварительных предложений
      • ≈ 3-4 недели, чтобы PI подготовил внешнее предложение, получил одобрение и отправил.
    • Ad hoc – срок краткосрочного уведомления:  Если для проведения внутреннего конкурса недостаточно времени (<8 недель), VPR проведет процесс отбора следующим образом:
      • Возможности с внешним дедлайном в течение 8 недель:
        • Запустите LSO LOI для определения процентов. Если школам известно о каких-либо ожидаемых кандидатах, школы предупредят этих ожидаемых кандидатов, чтобы облегчить ответ на LOI в сокращенном графике.
        • Если есть признаки того, что будет больше предложений, чем разрешено спонсором, VPR будет использовать ускоренный процесс принятия решения, чтобы определить наилучшее предложение, которое будет представлено спонсору.
          • Если позволяет время, VPR пригласит экспертов в области для проверки и выбора.
          • Если нет достаточного времени для того, чтобы привлечь экспертов в предметной области для выполнения функций рецензентов, персонал, занимающийся исследованиями и разработками, после консультации с VPR сделает выбор.
          • В крайнем случае, когда у научно-исследовательского отдела или VPR недостаточно времени для рассмотрения и принятия решения, в качестве крайней меры офис VPR может выбрать первую полученную заявку для продвижения вперед.
          • Кандидат должен будет ответить текстом или электронной почтой о своем намерении в течение нескольких часов после уведомления, в противном случае срок действия уведомления об отборе истечет, и он перейдет к следующему в очереди.
    ДОЛЯ ЗАТРАТ

    Некоторые ограниченные возможности отправки включают требования о разделении затрат. Требования к долевому участию на этапе предварительного предложения могут различаться; в некоторых случаях доля затрат должна быть указана на этапе предварительного предложения, в то время как в других случаях требуется только оценка.PI должны работать с Департаментом и деканатом для разработки пакета разделения затрат, который подходит для конкретной ограниченной программы подачи, как описано во внутреннем RFP.

    РАЗРАБОТКА ПРЕДЛОЖЕНИЯ

    В зависимости от возможности финансирования, сотрудники VPR, отдел по связям с корпоративными и фондами UVA или другие подразделения могут предоставить дополнительные ресурсы для разработки предложений преподавателям, которые были выбраны для представления спонсору.

    ВНЕШНЯЯ ПОДАЧА

    Если вы выбраны в качестве кандидата от UVA с ограниченной возможностью подачи, процесс получения соответствующих разрешений и подачи предложений спонсорам обычно осуществляется администраторами исследований в вашем отделе или в вашей школе; пожалуйста, не забудьте связаться с вашим администратором исследования, чтобы подтвердить детали.

    ВОПРОСЫ?

    Пожалуйста, свяжитесь с нами   с вопросами.

    Воссоединение 4 сезона «Правил Вандерпамп»: Кристен защищает себя

    Ночь обвинений и опровержений! Актеры Vanderpump Rules поговорили о «фальшивых» извинениях Кристен Доут и о пристрастиях Майка Шэя в первой части воссоединения 4-го сезона сериала «Браво» в понедельник, 21 марта. После Энди Коэн поприветствовал каждого индивидуально — особенно женщины, демонстрирующие свое декольте — группа сразу же погрузилась во все расставания и макияжи, которые произошли в этом сезоне.

    «Если вы посмотрите на эту группу, все они — когда-то — ненавидят друг друга», — Лиза Вандерпамп  сказала, и она была так права.

    Джеймс так устал от Кристен

    Ни для кого не секрет, что одна из самых больших вражд в сериале разгорелась между Джексом Тейлором и Джеймсом Кеннеди . Джакс сказал, что, по его мнению, у Джеймса скверный язык, и Джеймс любит подстрекать его, тем более что Джакс находится на испытательном сроке и не может попасть в новые неприятности. Он даже сказал Джеймсу, что хотел бы ударить его «так сильно», но не может.Джеймсу лучше следить за тем, когда Джакс выйдет из испытательного срока , потому что весь ад, вероятно, разразится.

    Джеймс и Кристен обсудили свою непростую историю, в миллионный раз обвинив друг друга в измене. Она вспомнила, как Джеймс использовал ее, чтобы получить все, когда они были вместе, включая место в шоу. «Эй, есть причина, по которой я встречаюсь с пумой», — ответил Джеймс и назвал Кристен «сахарной мамой». Не похоже, чтобы у Джеймса было какое-либо намерение расположить к себе Кристен с хорошей стороны, а если и собирается, то делает это очень плохо.

    Кристен переходит в оборону

    Актеры вспомнили долгий путь «поезда извинений» Кристен после того, как ее выгнали из Сура и она пошла к психологу, чтобы попытаться наладить свою жизнь. Ее бывший парень Том Сандовал обвинил Кристен в том, что она извинилась перед Арианой Мэдикс только после того, как она взбесилась из-за романа Арианы и Тома, чтобы получить приглашение в их поездку на Гавайи.

    «Были вещи, в которых я должна была признаться», — сказала Кристен.Она утверждала, что ее извинения перед всеми были настоящими, но практически все в группе, кроме Кэти, обвиняли ее в извинениях только как в «отчаянной попытке» наладить дружеские отношения. «Я не могу дождаться, когда она снова разобьет тебе сердце, потому что это произойдет», — сказал Джеймс Кэти о Кристен.

    Джакс Тейлор, Кристен Доут, Кэти Мэлони и Том Шварц на «Воссоединении правил Вандерпамп». Николь Вайнгарт/Браво

    Майк очищается!

    Майк Шей впервые появился на воссоединении, чтобы решить свою предыдущую проблему с зависимостью.Вернувшись домой, в дом своих родителей, чтобы собраться (*кашель-кашель* уйти от Шеаны Шей ), он привел себя в порядок. Шеана призналась, что сначала она не думала, что привычка ее мужа была такой большой проблемой, потому что она ничего не знала о зависимости.

    Однако Майк признался, что после того, как он начал принимать викодин из-за спортивной травмы, он принимал от пяти до шести таблеток в день. «Я думала, что это быстро пройдет и никому даже не нужно будет об этом знать», — сказала Шеана.

    Сервер Sur был очень неправ и нуждался в поддержке своих друзей, когда она получила массовую критику в Интернете и от Тома Сандовала за то, что он поощрял Майка продолжать пить, но только в умеренных количествах. Шеана сильно плакала, но утверждала, что она «намного улучшила себя», потому что она лучше осведомлена о зависимости после того, как пережила ее.

    Ариана Мэдикс, Лала Кент, Том Сандовал, Джеймс Кеннеди и Шеана Мари на «Воссоединении правил Вандерпамп» с Энди Коэном. Николь Вайнгарт/Браво

    Майк тоже не винил ее, поскольку он стал причиной проблемы и «виноват на 100 процентов».Сейчас он полностью отказался от таблеток и не пил уже три месяца. «Я должен был выбрать Шеану или выбрать наркотики», — эмоционально сказал он и добавил, что если бы не его жена, он, вероятно, до сих пор был бы зависим от веществ.

    Лала придерживается своей истории

    Лала Кент с тех пор, как устроилась туда на работу, чувствовала себя оторванной от многих людей в Sur. «Страшно попасть в такую ​​группу», — сказал ведущий Sur. Она не совсем правильно начала, когда солгала Лизе, сказав, что она модель и должна путешествовать, тогда как на самом деле мужчины платили за то, чтобы она ездила в дорогой отпуск.Она утверждала, что никогда не спала ни с одним из мужчин, которые отправляли ее в экзотические места, но добавила, что «сбилась со счета», сколько раз это случалось.

    «Если бы я спала с одним из них, я бы носила его с гордостью», — сказала Лала. Однако ее коллеги по съемочной площадке не были убеждены ее историей, и кто мог их винить? У Лалы не совсем идеальный послужной список.

    Author: alexxlab

    Добавить комментарий

    Ваш адрес email не будет опубликован.